Tea tree development and cold resistance regulation gene CsLOT1 and application thereof

Abstract

The invention discloses a tea tree development and cold resistance regulation gene CsLOT1 and application thereof. The nucleotide sequence of the gene CsLOT1 is as shown in SEQ ID NO. 1. By silencing the CsLOT1 gene, the chlorophyll fluorescence intensity and the Fv / Fm value of the leaves are remarkably reduced, and the cutin thickness on the leaves is reduced; and the overexpression CsLOT1 gene leaf shows an opposite trend. The gene can simultaneously and positively regulate and control the cutin thickness on the leaf and the cold resistance of the leaf. The research finds that brand new gene resources and molecular targets are provided for tea tree variety improvement, a new cold-resistant tea tree variety is cultivated through a genetic engineering means, and economic losses caused by low-temperature freezing injury are reduced; a new thought and a reference direction are provided for cold-resistant breeding of other plants, and the method has a wide application prospect and a huge economic value in coping with an extreme low-temperature environment caused by global climate change.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to a tea tree development and cold resistance regulating gene CsLOT1 and an application thereof. Background Art

[0002] The tea plant (Camellia sinensis (L.) O. Kuntze), a key leaf-producing cash crop in my country, holds both significant economic and cultural value. Tea is a perennial woody plant that prefers warmth to cold and is extremely sensitive to low temperatures throughout its growth and development cycle.

[0003] In recent years, due to the impact of global climate change, extreme low temperatures have become increasingly frequent, significantly increasing the risk of tea plantations being affected by cold weather. In low temperatures, the water within tea plant cells freezes. The formation of ice crystals disrupts the cell structure, causing damage to cell membranes and electrolyte leakage, thus affecting normal cellular function. Furthermore, low temperatures inhibit the activity of various enzymes within the tea plant, slowing its metabolism and disrupting the balance between photosynthesis and respiration.

[0004] Therefore, in-depth exploration of the key genes that regulate tea leaf development and cold resistance has important scientific significance and application value for improving the cold resistance of tea trees and promoting the sustainable development of the tea industry. Summary of the Invention

[0005] The main purpose of the present invention is to propose a tea plant development and cold resistance regulatory gene CsLOT1 and its application, aiming to improve the cold resistance of tea plants and tea yield through gene regulation.

[0006] To achieve the above objectives, the present invention proposes a tea plant development and cold resistance regulatory gene CsLOT1, the nucleotide sequence of the gene CsLOT1 is shown in SEQ ID NO.1.

[0007] The present invention also provides a recombinant plasmid pMDC43-CsLOT1, wherein the recombinant plasmid pMDC43-CsLOT1 is obtained by inserting the gene CsLOT1 described above into the vector pMDC43.

[0008] The present invention also provides a primer pair for amplifying the tea plant development and cold resistance regulatory gene CsLOT1 as described above, the primer pair comprising a forward primer having a nucleotide sequence as shown in SEQ ID NO.2 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.3.

[0009] The present invention also provides a gene-specific fragment CsLOT1-vigs of the tea plant development and cold resistance regulatory gene CsLOT1. The nucleotide sequence of the gene-specific fragment CsLOT1-vigs of the gene CsLOT1 is shown in SEQ ID NO.4.

[0010] The present invention also provides a recombinant plasmid pTRV2-CsLOT1-vigs, wherein the recombinant plasmid pTRV2-CsLOT1-vigs is obtained by inserting the gene-specific fragment CsLOT1-vigs of the gene CsLOT1 described above into the vector pTRV2.

[0011] The present invention also provides a primer pair for amplifying the gene-specific fragment CsLOT1-vigs as described above, wherein the primer pair comprises a forward primer having a nucleotide sequence as shown in SEQ ID NO.5 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.6.

[0012] The present invention also provides a recombinant strain, which contains the recombinant plasmid pMDC43-CsLOT1 or the recombinant plasmid pTRV2-CsLOT1-vigs described above, and the starting strain of the recombinant strain is the Agrobacterium strain GV3101-p19.

[0013] The present invention also proposes an application of the gene CsLOT1 described above in regulating plant development and enhancing cold resistance.

[0014] Preferably, the regulating plant development is regulating the thickness of cuticle on plant leaves.

[0015] Preferably, the plant development is regulated and the cold resistance is enhanced by over-expressing the gene CsLOT1.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] The present invention, by silencing the CsLOT1 gene, significantly reduced leaf chlorophyll fluorescence intensity and Fv / Fm values, and thinned leaf cuticle thickness. Overexpressing CsLOT1, however, showed the opposite trend. This suggests that the gene positively regulates both leaf cuticle thickness and cold tolerance. This discovery not only provides new genetic resources and molecular targets for improving tea varieties, enabling the development of new cold-resistant tea varieties through genetic engineering and reducing economic losses caused by freezing, but also offers new insights and references for cold-tolerant breeding in other plants. It holds broad application prospects and significant economic value in addressing the extreme low temperatures caused by global climate change. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other relevant drawings can be obtained based on these drawings without paying any creative work.

[0019] Figure 1 The following are the results of genome-wide association analysis; A is the relative content distribution diagram of Trait1 (cold injury phenotype); B is the sample quantile-total quantile diagram (Quantile-Quantile diagram); and C is the Manhattan diagram.

[0020] Figure 2 Figure 2 is the genetic association with the chilling phenotype; A is the Manhattan plot of chromosome 2 associated with the chilling phenotype; B is the LD heat map around the chromosome 2 peak; C is the difference in leaf cold tolerance and upper cuticle thickness among different alleles of SNP (Chr2_94038844; Chr2-94053105); D is the phylogenetic tree of the CsLOT1 gene family.

[0021] Figure 3 This is the test result of cold resistance and leaf structure of tea leaves after silencing and transient overexpression of CsLOT1 gene.

[0022] The purpose, features and advantages of the present invention will be further described with reference to the accompanying drawings and in conjunction with the embodiments. DETAILED DESCRIPTION

[0023] In order to make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. If specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or the conditions recommended by the manufacturer. If the reagents or instruments used are not specified by the manufacturer, they are all conventional products that can be purchased commercially. In addition, the technical solutions between the various embodiments can be combined with each other, but must be based on the ability of ordinary technicians in this field to achieve. When the combination of technical solutions is mutually contradictory or cannot be achieved, it should be considered that the combination of such technical solutions does not exist and is not within the scope of protection required by the present invention. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0024] The technical solutions of the present invention are further described in detail below in conjunction with specific embodiments and drawings. It should be understood that the following embodiments are only used to explain the present invention and are not used to limit the present invention.

[0025] Example 1: Localization of the dual-function gene CsLOT1 for tea leaf development and cold resistance

[0026] The present invention collects 217 tea plant germplasm resources, uses the genome of tea plant Shuchazao as the reference genome, analyzes its transcriptome RNA, and obtains 217 tea plant genotype files. At the same time, 504,896 SNPs were obtained after quality control and filtering, and GWAS analysis was performed using the GLM, MLM, FarmCPU models of rMVP software and the LM and LMM models of GEMMA software (the appropriate model was selected according to the QQ-plot diagram). The threshold of significant SNPs was determined by GEC software. The effective SNP number calculated by GEC was 241218.59, and the significant SNP threshold was 4.14562E-06 (1 / effective SNP number). A significantly associated QTL was found on chromosome 2 of the SCZ tea plant genome, and a gene related to tea resistance (Trait1) was identified in the QTL ( Figure 1 ).

[0027] In the genome-wide association analysis of the degree of freezing damage to tea leaves ( Figure 2 ) and identified 10 significant SNPs, all located on chromosome 2. Most of these were located in the CDS, followed by the 3'-UTR, with only one significant site located in an intron. We discovered two significant SNPs on chromosome 2 (Chr2_94038844, 1.76E-07; Chr2_94053105, 2.87E-06), which significantly regulate tea plant cold tolerance and leaf cuticle thickness. Linkage disequilibrium (LD) analysis of the region surrounding this locus revealed that it lies within a 51.27 kb LD region (Chr1: 94.002-92.053 Mb). Within this region, three significant SNPs (Chr2_94038844, 1.76E-07; Chr2_94039110, 1.78E-06; and Chr2_94053105, 2.87E-06) are located in the 3'-UTR, intron, and CDS regions of the gene CSS0046411 (designated CsLOT1), respectively. The nucleotide sequence of the CsLOT1 gene is shown in SEQ ID NO. 1. This gene belongs to the LOT family and is homologous to IbNucL in Camellia angustifolia, implicated in cold stress.

[0028] SEQ ID NO.1:

[0029] ATGGATGCCTCTACTGCTCTGCCCTCTGATTCAAATCCAACCCCCGGCGGCGCTTCCAAGTTCCTCGCCGACCTCCCCTCTCGCGGCCTCTCTCCTCCACTGTCCCTCTCCAATCCGGGTGGGATGCGGGTTTATATCTGTGATCATGACACATCACCCCCAGAGGACCAGCTGATAAAGACAAACCAAACGAACATACTGATTAGGTCTCTTGTGCTTAAGAAACAGAAGGGGGATTCCAGTTCA AAGGATGTAAAGACTGCAGCTTGCAAGTGAGGCTTCTAGAAAGAGGCCTGCTGAAAAAGTAATGGATGGCCGGGCTTCAGCAAAAAGGGCTGCGACCAACACTCAAGAAGGATCCAAATCTCGTGTACCTGAGAAGGATTTGCATAGTTTGACTGTAGAGAGACTTCGTGCTCTTTTGAGAGAGAAAGGTCTTTCCAATAGAGGAAAGAAGGATGAACTGGTTGCACGATTAAGAAGTGCAAGTGGCTAA

[0030] Example 2 Functional verification of the tea plant CsLOT1 gene

[0031] 1. Cloning of the bifunctional gene CsLOT1 associated with tea plant resistance and leaf development

[0032] RNA was extracted from leaves of 'Echa No. 10'. The first strand of cDNA was synthesized. The cDNA was then used as a template to amplify the target gene CsLOT1. The following primers were designed:

[0033] Forward primer: 5'-ATGGATGCCTCTACTGCTCT-3' (SEQ ID NO. 2) Reverse primer: 5'-TTAGCCACTTGCACTTCTTA-3' (SEQ ID NO. 3)

[0034] 2. CsLOT1 gene silencing in tea leaves

[0035] (1) Using the tea plant CsLOT1 gene as a template, a primer was designed with a homologous recombination linker (Tsingke) added to the 5' end to amplify the CsLOT1 gene-specific fragment CsLOT1-vigs (SEQ ID NO. 4).

[0036] SEQ ID NO.4:

[0037] TGGGATGCGGGTTTATATCTGTGATCATGACACATCACCCCCAGAGGACCAGCTGATAAAGACAAACCAAACGAACATACTGATTAGGTCTCTTGTGCTTAAGAAACAGAAGGGGGATTCCAGTTCAAAGGATGTAAAGACTGCAGCTGCAAGTGAGGCTTCTAGAAAGAGGCCTGCTGAAAAAGTAATGGATGGCCGGGCTTCAGCAAAAAGGGCTGCGACCAACACTCAAGAAGGATCCAAATCTCGTG

[0038] The primer sequences are as follows:

[0039] Forward primer:

[0040] 5'-AGATGAGGAGAAGAGCCCGGGTGGGATGCGGGTTTATATCTGTG-3'(SEQ ID NO.5)

[0041] Reverse primer:

[0042] 5'-TGCTCGACGACAAGACCCGGGCACGAGATTTGGATCCTTCTTGA-3'(SEQ ID NO.6)

[0043] (2) The gene-specific fragment of the CsLOT1 gene was inserted into the pTRV2 vector that had been digested with SamI by homologous recombination to obtain a recombinant plasmid containing the gene-specific fragment of the CsLOT1 gene.

[0044] (3) The recombinant plasmid was chemically transformed into the Agrobacterium strain GV3101-p19, and a recombinant Agrobacterium strain containing the recombinant plasmid CsLOT1 specific fragment was screened. Tea leaves were vacuum-infected with the recombinant Agrobacterium strain containing the recombinant plasmid CsLOT1 specific fragment and cultured for 21 days.

[0045] 3. Tea leaves with CsLOT1 gene overexpression

[0046] (1) Using the tea plant CsLOT1 gene as a template, gene-specific primers containing the homologous recombination sequences attB1 and attB2 were designed to amplify the full-length nucleotide sequence containing the CsLOT1 gene. The primer sequences are as follows:

[0047] Forward primer: 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTATGGATG CCTCTACTGCTCT-3' (SEQ ID NO. 7)

[0048] Reverse primer: 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTGCCACTT GCACTTCTTAATC-3' (SEQ ID NO. 8)

[0049] (2) Using the plasmid derived from the transition vector pTOPO connected to the target gene as a template, amplify the target gene twice by PCR, add homologous sequences to both ends of the target gene sequence, and recover and purify it. The target gene is connected to the entry vector pDONR221 by BP recombination reaction, and then connected to the pMDC43 overexpression vector by LR recombination reaction, and transformed into Escherichia coli.

[0050] The recombinant plasmid was chemically transformed into Agrobacterium strain GV3101-p19, and a recombinant Agrobacterium strain containing the recombinant plasmid CsLOT1 was screened and vacuum-infected with tea leaves and then cultured for 5 days.

[0051] Example 3 Effects of CsLOT1 gene silencing and overexpression on tea leaves

[0052] 1. Detection of CsLOT1 expression in silenced and overexpressed tea leaves by RT-PCR

[0053] Total RNA was extracted from silenced and overexpressed tea leaves using a plant RNA extraction kit and reverse transcribed using a reverse transcription kit (Simgen). Random primers were used for reverse transcription of CsLOT1, and GAPDH was used as the internal reference gene for fluorescence quantification of CsLOT1. Quantitative analysis was performed on the AB StepOne Plus real-time PCR system using a 2× Sybr Green qPCR mixture (PC6102, Adelaide). Results showed that CsLOT1 expression in silenced leaves was significantly downregulated ( Figure 3 A), the expression of CsLOT1 in overexpressing leaves was significantly upregulated ( Figure 3 F), indicating that the CsLOT1 gene was successfully transferred into the leaves of 'Echa 10' and was stably silenced and overexpressed.

[0054] The internal reference gene is GAPDH. The primers are designed as follows:

[0055] Forward primer: 5'-TTGGCATCGTTGAGGGTCT-3' (SEQ ID NO. 9)

[0056] Reverse primer: 5'-CAGTGGGAACACGGAAAGC-3' (SEQ ID NO. 10)

[0057] The reverse transcription primers for the CsLOT1 gene were designed as follows:

[0058] Forward primer: 5'-ATGGATGCCTCTACTGCTCT-3' (SEQ ID NO. 11)

[0059] Reverse primer: 5'-CCCGGATTGGAGGAGGGGAC-3' (SEQ ID NO. 12)

[0060] 2. Verify the effect of CsLOT1 on leaf cold resistance in silenced and overexpressed leaves

[0061] After 21 days of silencing, the tea seedlings were treated at 4°C for 2 days and then at -5°C for 4 hours. After 5 days of overexpression, the tea seedlings were treated at -5°C for 4 hours, and then the maximum photosynthetic efficiency of photosystem II (Fv / Fm) of these leaves was measured. The results showed that after freezing treatment, the CsLOT1-silenced leaves showed a significant cold-sensitive phenotype, that is, the chlorophyll fluorescence intensity and Fv / Fm ratio decreased, and were significantly lower than those of the no-load group ( Figure 3 BC). The chlorophyll fluorescence intensity and Fv / Fm value of OE-CsLOT1 leaves were significantly higher than those of the control group ( Figure 3 GH). This indicates that the CsLOT1 gene is related to the degree of chilling injury in tea leaves.

[0062] 3. Verify the effect of CsLOT1 on leaf development in silenced and overexpressed leaves

[0063] After 21 days of silencing, leaves with stable silencing were harvested and sliced; after 5 days of overexpression, leaves with stable overexpression were harvested and sliced. The slices were photographed under an optical microscope, and the cuticle thickness on the leaves in the slice images was measured using ImagJ software. In the software, the field of view parameters were set as follows: field of view length and width: 560 mm × 420 mm, field of view area: 0.2352 mm 2 The results showed that: from the slice diagram and the data of the upper cuticle thickness, we found that the upper cuticle thickness of the pTRV2-CsLOT1 leaf was thinner than that of the empty group, indicating that CsLOT1 silencing affected the thickening of the upper cuticle ( Figure 3 DE); while the cuticle of OE-CsLOT1 leaves became thicker ( Figure 3 IJ). These results indicate that CsLOT1 affects the development of leaf cuticle and that overexpression of CsLOT1 can promote the thickening of leaf cuticle.

[0064] The above results 2 and 3 showed that the CsLOT1 gene was related to the degree of chilling injury of tea leaves and was associated with the thickness of the cuticle on the leaves, indicating that the CsLOT1 gene positively regulates the thickness of the cuticle on the leaves and the cold resistance of the leaves.

[0065] The above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Those skilled in the art will readily appreciate that the present invention is susceptible to various modifications and variations. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention shall be included within the scope of the present invention.

Claims

1. A tea plant development and cold resistance regulatory gene CsLOT1, characterized in that The nucleotide sequence of the gene CsLOT1 is shown in SEQ ID NO.

1.

2. A recombinant plasmid pMDC43-CsLOT1, characterized in that: The recombinant plasmid pMDC43-CsLOT1 is obtained by inserting the gene CsLOT1 as claimed in claim 1 into the vector pMDC43.

3. A primer pair for amplifying the tea plant development and cold resistance regulatory gene CsLOT1 as claimed in claim 1, characterized in that: The primer pair includes a forward primer having a nucleotide sequence as shown in SEQ ID NO.2 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.

3.

4. A gene-specific fragment CsLOT1-vigs of the tea plant development and cold resistance regulatory gene CsLOT1, characterized in that: The nucleotide sequence of the gene-specific fragment CsLOT1-vigs of the gene CsLOT1 is shown in SEQ ID NO.

4.

5. A recombinant plasmid pTRV2-CsLOT1-vigs, characterized in that: The recombinant plasmid pTRV2-CsLOT1-vigs is obtained by inserting the gene-specific fragment CsLOT1-vigs of the gene CsLOT1 as claimed in claim 4 into the vector pTRV2.

6. A primer pair for amplifying the gene-specific fragment CsLOT1-vigs according to claim 4, characterized in that: The primer pair includes a forward primer whose nucleotide sequence is shown as SEQ ID NO.5 and a reverse primer whose nucleotide sequence is shown as SEQ ID NO.

6.

7. A recombinant strain, characterized in that The recombinant strain contains the recombinant plasmid pMDC43-CsLOT1 according to claim 2 or the recombinant plasmid pTRV2-CsLOT1-vigs according to claim 5, and the starting strain of the recombinant strain is Agrobacterium strain GV3101-p19.

8. Use of the gene CsLOT1 according to claim 1 in regulating plant development and enhancing cold resistance.

9. The use according to claim 8, characterized in that The regulating plant development is regulating the thickness of cuticle on plant leaves.

10. The use according to claim 8, characterized in that The plant overexpression gene CsLOT1 is used to regulate plant development and enhance cold resistance.

Images