Chitinase PMChi85 from paenibacillus mucilaginosus as well as preparation method and application of chitinase PMChi85

Abstract

The invention belongs to the field of gene engineering, and particularly relates to chitinase PMChi85 from paenibacillus mucilaginosus as well as a preparation method and application of the chitinase PMChi85. The chitinase PMChi85 provided by the invention is derived from paenibacillus mucilaginosus and has the preservation number of CGMCC (China General Microbiological Culture Collection Center) No.30802; the nucleotide sequence of the chitinase PMChi85 is as shown in SEQ ID NO. 1. The invention also discloses a preparation method of the chitinase PMChi85. According to the invention, chitinase derived from paenibacillus mucilaginosus C1 is found for the first time, and the chitinase has good enzymatic characteristics; in addition, the chitinase PMChi85 provided by the invention has very good salt stability and specificity; the chitinase PMChi85 provided by the invention can degrade insoluble colloid chitin into soluble sugar, degradation products mainly comprise monosaccharide, disaccharide and trisaccharide, a new path is developed for research and application of chitinase, and development of related fields is promoted.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and particularly relates to a chitinase PMChi85 from Paenibacillus mucilaginosus, a preparation method and an application thereof. Background Art

[0002] Chitin, a linear polysaccharide found widely in insect exoskeletons, fungal cell walls, and crustacean shells, is the second-largest renewable resource in nature, second only to cellulose. Chitinases, enzymes that hydrolyze chitin's β-1,4-glycosidic bonds, breaking it down into oligosaccharides and monosaccharides, play a key role in the material cycle and energy flow of ecosystems. Their mechanism of action is based on the catalytic domain and chitin-binding domain within the enzyme structure. The former is responsible for hydrolyzing the glycosidic bonds, while the latter facilitates a tight binding of the enzyme to the substrate, enhancing catalytic efficiency. Chitinases have enormous potential for application in agriculture. Because insect exoskeletons are primarily composed of chitin, chitinases can act as growth regulators, disrupting the insect molting process and thereby inhibiting their growth and reproduction. Furthermore, chitinases can effectively inhibit the growth and spread of plant pathogenic fungi by degrading chitin in their cell walls, thereby reducing the incidence of plant diseases. Chito-oligosaccharides, produced by chitinase degradation of chitin, are also widely used in industries such as food, cosmetics, and biomaterials due to their diverse biological activities, including immunomodulatory, anti-inflammatory, antibacterial, and moisturizing properties. Currently, research on chitinases, both domestically and internationally, focuses on screening enzyme-producing strains from microorganisms, often using single colony pure culture methods. However, over 99% of microorganisms in soil are unculturable, and traditional isolation and culture methods can only recover less than 1% of these microorganisms, significantly limiting the development and utilization of microbial resources. Furthermore, with the growth of seafood aquaculture and processing, the rich chitin content in aquatic processing waste is in urgent need of new chitinases for resource development. Summary of the Invention

[0003] In response to the problems existing in the prior art, the present invention provides a chitinase PMChi85 from Paenibacillus mucilaginosus.

[0004] The present invention also provides a method for preparing the chitinase PMChi85.

[0005] Another object of the present invention is to provide the use of the chitinase PMChi85 in degrading chitin.

[0006] In order to achieve the above object, the present invention provides the following technical solutions: The present invention provides a chitinase PMChi85, wherein the chitinase PMChi85 is derived from Paenibacillus mucilaginosus; the deposit number of the Paenibacillus mucilaginosus is CGMCC No. 30802; the nucleotide sequence of the chitinase PMChi85 is shown in SEQ ID NO.1.

[0007] The present invention also provides a recombinant protein of chitinase PMChi85, the amino acid sequence of the recombinant protein is shown as SEQ ID NO.2.

[0008] The present invention also provides a recombinant expression plasmid comprising the nucleotide sequence of chitinase PMChi85 shown in SEQ ID NO.1.

[0009] The present invention also provides a recombinant strain comprising the nucleotide sequence of chitinase PMChi85 shown in SEQ ID NO.1 or the above recombinant expression plasmid.

[0010] The present invention further provides a method for preparing the chitinase PMChi85, comprising the following steps: (1) Using the extracted genomic DNA of Paenibacillus subtilis as a template, PCR amplification of the target gene fragment was performed using FastPfu DNA polymerase; (2) The expression vector pET-22b was treated with NdeI and XhoI double enzymes and recovered, and the treated expression vector and gene fragment were connected using SoSoo Mix. After successful connection, the recombinant expression plasmid was obtained; (3) Transform the recombinant expression plasmid into the cloning strain E. coli DH5α was plated on a solid plate of freshwater LB containing Amp+ and cultured. Positive clones were picked and transferred to a liquid medium of freshwater LB containing Amp+ for culture. Chitinase PMChi85 was obtained after extraction and purification.

[0011] Preferably, in step (1), the primer sequences used for PCR amplification are: PMChi85-F: AAGAAGGAGATATACATATGCAGACCCTCGGTGCGGT; PMChi85-R: TGGTGGTGGTGGTGCTCGAGCGGCGTCAGCTTCGGC.

[0012] Preferably, in step (2), the molar ratio of the expression vector to the gene fragment is 1:1-1:10; and the connection conditions are: reaction at 50°C for 15 min.

[0013] Preferably, in step (3), the concentration of Amp+ in the system is 100 μg / mL.

[0014] The present invention also provides the use of the chitinase PMChi85 in degrading chitin.

[0015] The purpose of the present invention is to obtain a chitinase gene PMChi85 from Paenibacillus mucilaginosus C1 through phenotypic analysis, genome sequencing and sequence analysis. ， Through current molecular biological techniques, a chitinase gene expression vector PMChi85 was constructed and recombinantly expressed in Escherichia coli BL21 (DE3). Chitinase PMChi85 was obtained by optimizing the protein separation and purification process.

[0016] The chitinase PMChi85 provided by the present invention has been found to contain four structural domains ( Figure 2 ), but does not have the GH18 family catalytic conserved sequence ( Figure 3 ), phylogenetic analysis found that PMChi85 is more closely related to GH19 family chitinases than to GH18 family chitinases ( Figure 4 ). Therefore, chitinase PMChi85 has a newer sequence and is a novel chitinase.

[0017] The beneficial effects of the present invention are: (1) The present invention discovered for the first time a chitinase derived from Paenibacillus subtilis C1, which has good enzymatic properties; the enzyme activity is highest at 40°C and has good stability; it maintains high activity and stability in the pH range of 2.0 to 12.0; and it can tolerate a variety of metal ions. The chitinase PMChi85 provided by the present invention has good salt stability and specificity. When NaCl < 2 M, the enzyme activity does not change significantly. When NaCl > 2 M, the enzyme activity increases with the increase of salt concentration. (2) The chitinase PMChi85 provided by the present invention can degrade insoluble colloidal chitin into soluble sugars. The degradation products are mainly monosaccharides, disaccharides and trisaccharides, which opens up new paths for the research and application of chitinase and promotes the development of related fields.

[0018] Preservation Information Deposit date: May 28, 2024; Depository: General Microbiology Center, China Culture Collection Administration; Deposit number: CGMCC NO.30802; Address of the depository: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing; Postal code: 100101; Classification name: Paenibacillus mucilaginosus Paenibacillus mucilaginosus . BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Agarose gel electrophoresis images; Figure 2 Domain prediction for chitinase PMChi85; Figure 3 Alignment of chitinase PMChi85 with the GH18 family catalytic conserved sequence; Figure 4 Evolutionary analysis of chitinase PMChi85 and chitinases from different sources; Figure 5 is the SDS-PAGE electrophoresis diagram of chitinase PMChi85; Figure 6 N-acetylglucosamine standard curve; Figure 7 The optimal temperature and temperature stability are shown in Table 1. A. Enzyme activity at different temperatures; B. Stability analysis at different temperatures; Figure 8 The optimal pH and pH stability are shown in Table 1. A. Enzyme activity under different pH conditions; B. Stability analysis under different pH conditions; Figure 9 is the optimal salt concentration and salt stability; A. enzyme activity at different NaCl concentrations; B. stability analysis at different NaCl concentrations; Figure 10 The effect of metal ions on enzyme activity; Figure 11 The enzymatic digestion products were analyzed by TLC. DETAILED DESCRIPTION

[0020] The present invention is described in detail below with reference to the accompanying drawings and examples. The examples described below are merely preferred embodiments of the present invention. It should be noted that the following description is merely for the purpose of explaining the present invention and does not limit the present invention in any form. Any simple modifications, equivalent changes, and modifications made to the embodiments based on the technical essence of the present invention fall within the scope of the technical solution of the present invention.

[0021] In the following examples, the materials and reagents used were obtained from commercial sources unless otherwise specified.

[0022] Example 1 Gene cloning and expression plasmid construction The bacterial genomic DNA was extracted using a bacterial genomic DNA extraction kit (Tiangen Biochemical, DP302-02). Paenibacillus mucilaginosusstrain) C1 genomic DNA, and PCR amplification primers were designed for this genomic DNA (Table 1). The target gene fragment was amplified using FastPfu DNA polymerase using the extracted genomic DNA of Paenibacillus mucilaginosus C1 as a template. The PCR reaction system and conditions are shown in Tables 2 and 3. PCR products were detected by 1% agarose gel electrophoresis at a voltage of 175V for 20 minutes. Using a gel imager, the PMChi85 gene PCR product was observed near the 2 kbp marker band (e.g. Figure 1 After cutting out the desired band (see label 3), purify the PCR product according to the instructions of the agarose gel recovery kit. The purified PCR product is sent to a sequencing company for sequencing.

[0023] Table 1 Strains Paenibacillus mucilaginosus Primers used to amplify the chitinase gene PMChi85 in strain C1

[0024] Table 2 PCR reaction system for amplification of chitinase gene PMChi85

[0025] Table 3 PCR reaction program settings

[0026] The expression vector pET-22b was digested with NdeI and XhoI and recovered, and the concentrations of the fragment and vector were determined. The recovered vector and gene fragment were ligated using SoSoo Mix, with a vector-to-fragment molar ratio of 1:1-1:10. The ligation reaction was carried out at 50°C for 15 minutes. The ligation product was transformed into the cloning strain using the heat shock method. E. coli DH5α was plated onto a solid plate containing freshwater LB medium (100 μg / mL) and cultured overnight at 37°C. Positive clones were selected and transferred to liquid LB medium containing 100 μg / mL of Amp+. Plasmids were extracted using a plasmid extraction kit. The recombinant plasmid was verified by enzyme digestion and sequencing. The sequence is shown in SEQ ID NO. 1.

[0027] The culture medium composition of the above-mentioned fresh water LB solid plate containing Amp+ (100 μg / mL) is as follows: 10 g of peptone, 5 g of yeast powder, 10 g of sodium chloride, 15 g of agar powder, and 0.1 g of ampicillin (Amp+) per 1000 mL of distilled water, and the pH is adjusted to 7.5-8.0.

[0028] The above-mentioned freshwater LB liquid medium containing Amp+ (100 μg / mL) (LB-Amp+ liquid medium, the same below) is composed of: 10 g of peptone, 5 g of yeast powder, 10 g of sodium chloride, and 0.1 g of ampicillin (Amp+) per 1000 mL of distilled water, and the pH is adjusted to 7.5-8.0.

[0029] Example 2 Heterologous expression and purification of recombinant protein (1) Heterologous expression of recombinant protein: Sequencing to verify the correct recombinant plasmid is transformed into expression competent cells E. coli BL21 (DE3) was plated onto a freshwater LB solid plate containing Amp+ (100 μg / mL) and incubated at 37°C for 14-18 h. The colonies on the plate were transferred to LB-Amp+ liquid medium (containing 100 μg / mL Amp+, composition as in Example 1) and incubated at 37°C, 180 rpm until the OD 600 to 0.6-0.8, and inoculated into 1 L of LB-Amp+ liquid medium (containing 100 μg / mL Amp+, with the same composition as in Example 1) at a 1% inoculum size, and cultured at 37°C and 180 rpm until the OD600 value of the bacterial liquid reached 0.6-0.8. The shaking temperature was then lowered to 20°C, 500 μL of IPTG stock solution (1 M) was added, and expression was induced at 20°C and 110 rpm for 16 h. The bacteria were then collected by centrifugation at 8000 rpm for 5 min at 4°C.

[0030] (2) Preparation of crude enzyme solution: Resuspend the cells in 3 volumes of Binding Buffer (50 mM Tris-HCl, 100 mM NaCl, 5 mM Imidazole, pH 8.0), disrupt the cells using a pressure disruptor, and centrifuge at 4°C and 12,000 rpm for 60 min. The resulting supernatant is the crude enzyme solution.

[0031] (3) Nickel affinity chromatography: After pre-treating the nickel affinity column with Binding Buffer, the crude enzyme solution was loaded onto the nickel affinity column. The column was first washed with Binding Buffer for 10 column volumes, then with Wash Buffer (50 mM Tris-HCl, 100 mM NaCl, 15 mM Imidazole, pH 8.0) for 10 column volumes, and finally with Elute Buffer (50 mM Tris-HCl, 100 mM NaCl, 350 mM Imidazole, pH 8.0) to elute the target protein. After collection, the column was regenerated by washing with 5 column volumes of 0.5 M imidazole solution and then sealed with water for storage.

[0032] (4) Desalting: Concentrate the sample after nickel ion affinity chromatography to 2.5 mL using an ultrafiltration tube with a molecular weight cutoff of 10 kDa. Load the concentrate onto a PD10 desalting column and elute with 3.5 mL of 20 mM Tris-HCl (pH 8.0) buffer containing 100 mM NaCl. Collect the eluate.

[0033] (5) The collected eluate was verified by SDS-PAGE. The denatured protein electrophoresis was conventional SDS-PAGE with a separation gel concentration of 12.5% ​​and a current of 180 mA. Figure 5 shown.

[0034] Example 3 Protein concentration detection and chitinase activity determination method (1) Protein concentration was determined using the BCA protein quantitative analysis kit.

[0035] (2) Chitinase activity determination method: The enzyme activity was determined using the DNS method. The substrate was 1% colloidal chitin (w / v), the buffer system was acetate buffer, and the standard reaction system was as follows: the enzyme solution was diluted to an appropriate concentration, 20 μL of enzyme solution was added to 200 μL of 1% colloidal chitin, and the reaction was carried out at 40°C for 30 min. 100 μL of DNS was added to terminate the reaction, and the color was developed by boiling for 10 min. After cooling, the solution was centrifuged at 12,000 rpm for 3 min, and the supernatant was taken to measure the OD550 absorbance value.

[0036] The standard curve was determined using N-acetylglucosamine as the standard. Figure 6 ) and calculate the reducing sugar concentration based on the standard curve. An enzyme activity unit (U) is defined as the amount of enzyme (mg) required to catalyze the production of 1 μmol of reducing sugar per minute under certain conditions.

[0037] Example 4 Enzyme Property Analysis (1) The steps for analyzing the optimal reaction temperature and temperature stability are as follows: (1) Optimal reaction temperature analysis: Under PBS buffer conditions, using colloidal chitin as the substrate, the enzyme activity of PMChi85 was measured at five temperature points at intervals of 10°C between 30 and 70°C. The reaction temperature at which the enzyme activity was the highest was taken as the optimal reaction temperature of PMChi85, and the enzyme activity at the highest temperature was defined as 100%.

[0038] (2) Temperature stability analysis: The enzyme solution was kept at 40°C, 50°C, 60°C and 70°C for 10, 20, 30, 40, 50 and 60 min respectively. Then, the residual enzyme activity of the enzyme was detected at the optimal temperature using colloidal chitin as the substrate under PBS buffer conditions. The enzyme activity at 0°C was defined as 100%.

[0039] The results showed that the optimal reaction temperature of chitinase PMChi85 was 40℃ ( Figure 7 A in the figure); PMChi85 showed no significant change in enzyme activity when incubated at 40°C for 1 hour, but the enzyme activity decreased significantly when incubated at 50 and 60°C for 10 minutes, and completely lost when incubated at 70°C for 10 minutes ( Figure 7 B in ).

[0040] (II) The steps for analyzing the optimal reaction pH and pH stability are as follows: (1) Analysis of the optimal reaction pH: Britton-Robinson buffer solutions with pH values ​​of 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, and 9.0 were prepared, and the enzyme activity of PMChi85 was detected at 40°C using colloidal chitin as the substrate. The pH of the reaction buffer solution at which the enzyme activity was the highest was defined as the optimal pH of PMChi85, and the enzyme activity with the highest enzyme activity was defined as 100%.

[0041] (2) pH stability analysis: The enzyme solution was diluted to an appropriate concentration with Britton-Robinson buffer of different pH values ​​ranging from pH 2.0 to 12.0 (pH interval of 1 unit), and then kept at 0°C for 1 h. The residual enzyme activity of PMChi85 was detected at 40°C using colloidal chitin as a substrate under PBS buffer conditions, and the highest enzyme activity of PMChi85 was defined as 100%.

[0042] The results showed that the optimal reaction pH of chitinase PMChi85 was 7.0 ( Figure 8 PMChi85 has good pH stability. After the enzyme solution was incubated in pH 2.0-12.0 buffer for 1 hour, it still maintained more than 60% of the enzyme activity ( Figure 8 B in ).

[0043] (III) The steps for analyzing the optimal reaction NaCl concentration and NaCl stability are as follows: (1) Optimal reaction NaCl concentration: NaCl was added to the reaction system at a final concentration between 0 and 4.0 M, with an interval of 0.5 M. A total of 9 different NaCl concentrations were taken. Under PBS (optimal pH) buffer conditions, colloidal chitin was used as the substrate, and the enzyme activity was detected at the optimal temperature. The enzyme activity when the NaCl concentration was 0 M was defined as 100%.

[0044] (2) NaCl stability analysis: The enzyme solution was diluted to an appropriate concentration with a NaCl solution with a final concentration of 0-4.5 M, and then kept at 0°C for 1 h. The residual enzyme activity of the enzyme was detected under PBS (optimal pH) buffer conditions with colloidal chitin as the substrate at the optimal temperature. The enzyme activity at a NaCl concentration of 0 M was defined as 100%.

[0045] The results showed that during the enzyme activity assay, the activity of PMChi85 decreased with the increase of NaCl concentration. When NaCl < 0.5 M, there was no effect on the enzyme activity. When NaCl > 0.5 M, the enzyme activity decreased with the increase of salt concentration ( Figure 9 A); However, PMChi85 has good salt stability. When NaCl < 2 M, the enzyme activity does not change significantly. When NaCl > 2 M, the enzyme activity increases with the increase of salt concentration. This is also the characteristic of chitinase PMChi85 ( Figure 9 B in ).

[0046] (IV) Effects of metal ions on enzyme activity: Mn 2+ Mg 2+ , K + , Ca 2+ 、Co 2+ 、Zn 2+ and Cu 2+ Prepare 1 M stock solutions of each of the chlorides with triple-distilled water. Chitinase PMChi85 activity was measured under optimal reaction conditions at final metal ion concentrations of 1 mM and 10 mM. The activity in the reaction without metal ions was defined as 100%.

[0047] The results showed that by analyzing the effects of seven metal ions on enzyme activity, Mn 2+ , K + , Ca 2+ The concentration range of 1-10 mM does not affect the enzyme activity of PMChi85. 2+ 、Zn 2+ 、Cu 2+ It has a significant inhibitory effect on the enzyme activity of PMChi85 under the condition of 10mM ( Figure 10 ).

[0048] Example 5 Analysis of degradation products The specific operation of thin layer chromatography analysis is as follows: (1) Sample preparation: 40 μL of the crude enzyme solution prepared in Example 2 (the control group used an equal volume of inactivated enzyme solution that had been boiled for 10 minutes instead of the crude enzyme solution) was reacted with 200 μL of a 1% colloidal chitin solution at 40°C for 24-48 h. The reaction was terminated by boiling for 10 min, and then centrifuged at 12,000 rpm for 5 min. The supernatant was freeze-dried and concentrated (the concentration factor was determined based on the amount of product) for thin-layer chromatography analysis. (2) Prepare the chromatography fluid: add 26 mL of n-butanol, 13 mL of acetic acid, 13 mL of deionized water, and 2.6 mL of ammonia water to the chromatography cylinder in sequence, mix well, and seal for at least 4 hours; (3) Spotting: Use a glass capillary to spot the sample and standard onto a silica gel plate so that the sample diameter is less than 1 mm. The standard substances are 1 mol / L N-acetylamino sugar GlcNAc, chitobiose (GlcNAc)2, chitotriose (GlcNAc)3, chitotetraose (GlcNAc)4, chitopentaose (GlcNAc)5, and chitohexaose (GlcNAc)6. (4) Layer development: Place the sampled silica gel plate in a chromatography tank for approximately 2.5 h. (5) Color development: After the development is completed, blow dry the silica gel plate and evenly spray the plate with diphenylamine-aniline-phosphoric acid color developer (0.8 g diphenylamine, 40 mL acetone, 0.8 mL aniline and 4 mL 85% phosphoric acid). Develop the color at 110 °C for 10 min and then observe.

[0049] Since the color developer is corrosive, the chromatography results need to be observed and scanned immediately after the color development is completed, otherwise the silica gel plate will corrode and turn black quickly.

[0050] The results showed that chitinase PMChi85 could degrade insoluble colloidal chitin into soluble sugars, and the degradation products were mainly monosaccharides, disaccharides and trisaccharides ( Figure 11 ). Figure 11 In the figure, M is the standard group, C is the control group, and numbers 1, 2, and 3 are parallel crude enzyme solution samples.

Claims

1. A chitinase PMChi85, characterized in that Chitinase PMChi85 is derived from Paenibacillus mucilaginosus; the deposit number of Paenibacillus mucilaginosus is CGMCC No. 30802; the nucleotide sequence of the chitinase PMChi85 is shown in SEQ ID NO.

1.

2. A recombinant protein of chitinase PMChi85 according to claim 1, characterized in that The amino acid sequence of the recombinant protein is shown in SEQ ID NO.

2.

3. A recombinant expression plasmid, characterized in that: It includes the nucleotide sequence shown in SEQ ID NO.

1.

4. A recombinant strain, characterized in that It comprises the nucleotide sequence shown in SEQ ID NO.1 or the recombinant expression plasmid according to claim 3.

5. A method for preparing chitinase PMChi85 according to claim 1, characterized in that: The following steps are involved: (1) Using the extracted genomic DNA of Paenibacillus subtilis as a template, PCR amplification of the target gene fragment was performed using Fast Pfu DNA polymerase; (2) The expression vector pET-22b was treated with NdeI and XhoI double enzymes and recovered, and the treated expression vector and gene fragment were connected using SoSoo Mix. After successful connection, the recombinant expression plasmid was obtained; (3) Transform the recombinant expression plasmid into the cloning strain E. coli DH5α was plated on a solid plate of freshwater LB containing Amp+ and cultured. Positive clones were picked and transferred to a liquid medium of freshwater LB containing Amp+ for culture. Chitinase PMChi85 was obtained after extraction and purification.

6. The preparation method according to claim 5, characterized in that In step (1), the primer sequences used for PCR amplification are: PMChi85-F: AAGAAGGAGATATACATATGCAGACCCTCGGTGCGGT; PMChi85-R: TGGTGGTGGTGGTGCTCGAGCGGCGTCAGCTTCGGC.

7. The preparation method according to claim 5, characterized in that In step (2), the molar ratio of the expression vector to the gene fragment is 1:1-1:10; the connection conditions are: 50°C reaction for 15 min.

8. The preparation method according to claim 5, characterized in that In step (3), the concentration of Amp+ in the system is 100 μg / mL.

9. Use of the chitinase PMChi85 according to claim 1 in degrading chitin.

Images