Application of GhCASPL1F1 gene in cultivation of high-temperature-resistant cotton germplasm

Abstract

The invention belongs to the technical field of molecular biology breeding, and particularly relates to application of a GhCASPL1F1 gene in cultivation of high-temperature-resistant cotton germplasm, and an amino acid sequence of a protein coded by the GhCASPL1F1 gene is shown as SEQ ID NO.3. The invention also relates to application of the GhCASPL1F1 gene in cultivation of high-temperature-resistant cotton germplasm. The invention provides a novel gene GhCASPL1F1 for negative regulation of high-temperature resistance of cotton, and by negative regulation of expression of the gene, adaptability of plants to high temperature and high-temperature stress tolerance can be improved, male fertility in a high-temperature environment can be maintained and improved, and high-temperature resistance of the plants can be improved. The method has important theoretical value and practical significance for improving the high-temperature resistance of commercial crops and improving the yield and quality of the crops in a high-temperature frequent environment, has good economic benefits, and has wide application prospects in cultivation of new high-temperature-resistant varieties of cotton.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biological breeding, and in particular to application of the GhCASPL1F1 gene in cultivating high-temperature-resistant cotton germplasm. Background Art

[0002] Cotton (Gossypium spp.) is an important fiber crop and a major oilseed crop. Suitable temperatures are essential for cotton's growth and development. Extremely low or high temperatures can disrupt its physiological activities during its growth period, affecting its quality and yield. However, as a thermophilic crop, cotton is primarily grown in the summer, with its budding and flowering periods generally occurring in July and August. During this period, temperatures often reach above 35°C, with occasional peaks approaching 40°C. Such high temperatures can significantly impact cotton's reproductive development and even cause plant death. Research has shown that cotton's reproductive processes are more sensitive to high temperatures than its vegetative growth, particularly its male reproductive organs. Sustained temperatures exceeding 35°C significantly inhibit reproductive development, causing pollen grain deformities, reduced pollen viability, and anther abortion. This, in turn, leads to bud and boll dropout, a decrease in boll number per plant, and a decrease in seed cotton yield, resulting in significant yield reductions. Furthermore, prolonged high-temperature stress can reduce fiber strength and uniformity, compromising cotton quality. Therefore, in-depth research on the mechanisms of abnormal pollen development and male sterility caused by high temperature is crucial for breeding of high temperature-resistant varieties.

[0003] In the field of plant breeding, there are two main approaches: traditional breeding and transgenic breeding. Traditional breeding methods have numerous drawbacks, such as high costs, lengthy time periods, and low breeding efficiency. These drawbacks make it difficult for traditional breeding to meet today's rapidly developing breeding needs. In this context, transgenic breeding has become increasingly important. CRISPR / Cas9, a simple and efficient gene editing technology, has played a key role in plant transgenic breeding in recent years and has been widely applied in crops such as cotton and rapeseed. Studying the response mechanisms and feedback mechanisms of plants to high temperature stress, identifying key response genes involved in the heat stress response, and applying transgenic technology to commercial crops is an effective way to enhance crop stress resistance and cultivate heat-tolerant varieties. Therefore, discovering heat-tolerant genes has become a key task in contemporary cotton breeding and a crucial measure for increasing cotton yield. However, the discovery of heat-tolerant genes in cotton is still in its infancy. Exogenous target genes for genetically improving plant heat tolerance mainly include transcription factors and heat shock proteins. Limited genetic resources available for heat-tolerant breeding have severely constrained cotton breeding efforts. Summary of the Invention

[0004] To address the aforementioned technical issues in the prior art, the present invention provides a novel gene that negatively regulates high-temperature resistance in cotton—the GhCASPL1F1 gene. By negatively regulating the expression of this gene, the plant's adaptability to high temperatures and tolerance to high-temperature stress can be improved, maintaining and improving male fertility in high-temperature environments. This gene has important theoretical value and practical significance, as well as good economic benefits, for improving the high-temperature resistance of cash crops and increasing crop yield and quality in high-temperature environments. It has broad application prospects in the breeding of new high-temperature-tolerant cotton varieties. Therefore, the present invention provides the use of the aforementioned GhCASPL1F1 gene in breeding high-temperature-resistant cotton germplasm.

[0005] The present invention is specifically implemented through the following technical solutions:

[0006] In a first aspect, the present invention provides the use of the GhCASPL1F1 gene in cultivating high-temperature-resistant cotton germplasm. The amino acid sequence of the protein encoded by the GhCASPL1F1 gene is shown in SEQ ID NO.3.

[0007] Furthermore, the nucleotide sequence of the GhCASPL1F1 gene is shown as SEQ ID NO.1 or SEQ ID NO.2.

[0008] Furthermore, the application includes: reducing the expression level of the GhCASPL1F1 gene to improve the fertility of the cotton at high temperature.

[0009] Furthermore, the agent for reducing the expression level of the GhCASPL1F1 gene is selected from one of the following (A)-(D):

[0010] (A) sgRNA for knocking out the GhCASPL1F1 gene, the nucleotide sequence of the sgRNA is shown in SEQ ID NO. 4;

[0011] (B) a nucleic acid molecule comprising the sgRNA described in (A);

[0012] (C) an editing vector comprising the sgRNA described in (A) or the nucleic acid molecule described in (B);

[0013] (D) A recombinant microorganism comprising the editing vector described in (C).

[0014] Furthermore, the nucleotide sequence of the nucleic acid molecule comprising the sgRNA described in (A) is shown as SEQ ID NO.5; or, the editing vector comprising the sgRNA described in (A) or the nucleic acid molecule described in (B) is pRGEB32-GhU6.9-NPT II; or, the recombinant microorganism comprising the editing vector described in (C) is Agrobacterium.

[0015] Furthermore, reducing the expression level of the GhCASPL1F1 gene in cotton includes the following steps: preparing an editing vector targeting the GhCASPL1F1 gene, transforming wild-type cotton plants, and cultivating transgenic cotton plants with reduced expression level of the GhCASPL1F1 gene.

[0016] Furthermore, the preparation method of the editing vector includes the following steps: connecting the sgRNA shown in SEQ ID NO.4 or the nucleic acid molecule shown in SEQ ID NO.5 to the pRGEB32-GhU6.9-NPT II expression vector through an in-fusion seamless cloning reaction to obtain the editing vector.

[0017] Furthermore, the cotton is upland cotton.

[0018] A second aspect of the present invention provides a method for preparing high-temperature resistant cotton germplasm, comprising the following steps:

[0019] An editing vector targeting the GhCASPL1F1 gene is prepared, and wild-type cotton plants are transformed to obtain transgenic cotton plants with reduced expression levels of the GhCASPL1F1 gene. The editing vector comprises the sgRNA shown in SEQ ID NO.4 or the nucleic acid molecule shown in SEQ ID NO.5.

[0020] A third aspect of the present invention provides use of a reagent for reducing the expression level of the GhCASPL1F1 gene in cultivating high-temperature-resistant cotton germplasm, wherein the reagent for reducing the expression level of the GhCASPL1F1 gene is selected from one of the following (A) to (D):

[0021] (A) sgRNA for knocking out the GhCASPL1F1 gene, the nucleotide sequence of the sgRNA is shown in SEQ ID NO. 4;

[0022] (B) a nucleic acid molecule comprising the sgRNA described in (A);

[0023] (C) an editing vector comprising the sgRNA described in (A) or the nucleic acid molecule described in (B);

[0024] (D) A recombinant microorganism comprising the editing vector described in (C).

[0025] The advantages and positive effects of the present invention are:

[0026] The GhCASPL1F1 gene provided by the present invention is a negative regulatory factor for high temperature resistance of cotton, providing a new high-quality gene resource and effective means for cultivating new crop germplasms with strong tolerance to high temperature stress. The GhCASPL1F1 gene is applied to plant genetic engineering breeding. By negatively regulating the expression of the gene, the adaptability of plants to high temperatures and the tolerance to high temperature stress can be improved, male fertility under high temperature environments can be maintained and improved, and the problem of male sterility of cotton caused by high temperature and the resulting substantial reduction in cotton production can be significantly alleviated. It has important theoretical value and practical significance as well as good economic benefits for improving the high temperature resistance of economic crops and increasing crop yield and quality in high temperature frequent environments. In addition, the genetic engineering breeding method based on the heat-responsive gene of the present invention is simple to operate, accurate and efficient, can greatly shorten the breeding cycle of high temperature resistant varieties, improve breeding efficiency, and has a wide application prospect in the breeding of new high temperature resistant cotton varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0028] Figure 1 This is a sequence editing diagram of a single T1 transgenic cotton plant in which the GhCASPL1F1 gene was edited in an embodiment of the present invention;

[0029] Figure 2 This is a sequence alignment diagram downloaded from the third-generation and second-generation genomes of GhCASPL1F1 in the embodiment of the present invention. The large red box indicates the sgRNA targeting sequence, and the small red box indicates the position of the homologous sequence corresponding to the gene variant sequence in the transgenic strain;

[0030] Figure 3 Figures 1 and 2 are graphs showing the anther and pollen activity phenotypes of individual plants of T1 transgenic cotton and wild-type Jin 668 cotton in which the GhCASPL1F1 gene was edited, respectively, in accordance with an embodiment of the present invention; Figures A and C are graphs showing the anthers of individual plants of wild-type Jin 668 under normal temperature and high temperature treatments, respectively; Figures B and D are graphs showing the anthers of individual plants of GhCASPL1F1-edited T1 transgenic cotton under normal temperature and high temperature treatments, respectively; Figures a and c are graphs showing the pollen activity staining of individual plants of wild-type Jin 668 under normal temperature and high temperature treatments, respectively; and Figures b and d are graphs showing the pollen activity staining of individual plants of GhCASPL1F1-edited T1 transgenic cotton under normal temperature and high temperature treatments, respectively.

[0031] Figure 4Figures stained with toluidine blue show anther tissue sections of T1 transgenic cotton with the GhCASPL1F1 gene edited and wild-type Jin 668 cotton under room temperature treatment according to an embodiment of the present invention. Figures AC show anther tissue sections of wild-type Jin 668 cotton anthers at the tetrad stage, tapetum degradation stage, and anther dehiscence stage, respectively; and Figures DF show anther tissue sections of T1 transgenic cotton anthers with the GhCASPL1F1 gene edited at the tetrad stage, tapetum degradation stage, and anther dehiscence stage, respectively.

[0032] Figure 5 These are toluidine blue-stained images of anther tissue sections of T1 transgenic cotton with the GhCASPL1F1 gene edited and wild-type Jin 668 cotton under high-temperature treatment in an embodiment of the present invention. Figures AC are anther tissue sections of wild-type Jin 668 cotton anthers at the tetrad stage, tapetum degradation stage, and anther dehiscence stage, respectively; and Figures DF are anther tissue sections of GhCASPL1F1 gene-edited T1 transgenic cotton anthers at the tetrad stage, tapetum degradation stage, and anther dehiscence stage, respectively. DETAILED DESCRIPTION

[0033] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below with reference to the embodiments. The embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0034] Given the information contained herein, it will be readily apparent to those skilled in the art that various modifications may be made to the precise description of the present invention without departing from the spirit and scope of the appended claims. It should be understood that the scope of the present invention is not limited to the processes, properties, or components defined herein, as these embodiments and other descriptions are intended only to illustrate specific aspects of the present invention. Indeed, various modifications to the embodiments of the present invention that are apparent to those skilled in the art or related fields are intended to be within the scope of the appended claims.

[0035] For a better understanding of the present invention and not to limit the scope of the present invention, all numerals and other numerical values ​​used in the present invention to express amounts, percentages, etc. should be understood as modified by the word "about" in all cases. Therefore, unless otherwise specified, the numerical parameters listed in the specification and the appended claims are approximate values, which may be changed according to the different ideal properties to be obtained. Each numerical parameter should at least be regarded as obtained based on the reported significant digits and by conventional rounding methods.

[0036] In addition, it should be noted that, unless otherwise defined, in the context of the present invention, the scientific and technical terms used should have the meanings commonly understood by those skilled in the art.

[0037] The terms "include", "comprising", "containing", "having" and the like are non-limiting in meaning, that is, other steps and other components that do not affect the results may be added.

[0038] The term "and / or" should be considered as a specific disclosure of each of the two specified features or components with or without the other. For example, "A and / or B" is considered to include the following situations: (i) A, (ii) B, and (iii) A and B.

[0039] The term "gene" is the entire nucleotide sequence required to produce a polypeptide chain or functional RNA. Thus, gene expression includes transcription and the stable accumulation of coding RNA (mRNA) or functional RNA derived from the gene, and can also refer to the translation of mRNA into a polypeptide or protein.

[0040] The term "vector" refers to a self-replicating DNA molecule that transfers an exogenous gene of interest into a host organism, often in the form of a circular double-stranded DNA molecule. A vector containing a gene of interest is a recombinant vector. Typical vectors include plasmids, viruses, bacteriophages, cosmids, and minichromosomes. Plasmids are the most common form of vector; therefore, in the context of this invention, the terms plasmid and vector are used interchangeably.

[0041] The term "expression vector" allows an exogenous target gene inserted into the vector to be expressed in a host organism. When the expression vector is introduced into a suitable host organism, the inserted target gene can be expressed.

[0042] The term "introduction" or "transfer" refers to the transfer of a target gene or nucleic acid molecule (e.g., an editing vector targeting the GhCASPL1F1 gene) into a host organism, resulting in genetically stable inheritance. The introduced nucleic acid molecule can be in the form of a plasmid retained in the host organism, or can be integrated into the host organism's genome. A host organism containing the introduced gene is referred to as a "transgenic," "recombinant," "transformed," or "engineered" organism. Introduction of an expression vector into a host organism can be performed using conventional techniques well known to those skilled in the art.

[0043] The terms "knockout," "silencing," or "inhibition" and similar expressions have the same meaning, referring to the reduction of gene expression below normal levels or the inability to express a gene normally. This is often achieved by inserting or deleting a portion of a nucleic acid sequence, causing a frameshift mutation, which in turn inhibits target gene expression and leads to phenotypic changes in the organism. Common methods for gene knockout include homologous recombination, CRISPR / Cas9, zinc finger nucleases (ZFNs), and transcription activator-like effector nucleases (TALENs).

[0044] The term "high temperature stress" refers to high temperatures that are detrimental to plant growth and development, and may even inhibit plant life. When ambient temperatures exceed a plant's acclimated temperature range and persist for a period of time, irreversible damage to plant growth and development occurs, also known as heat injury or heat damage. High temperature is a major abiotic stress factor, generally defined as temperatures where the daily maximum temperature reaches or exceeds the optimum growth temperature by 3-5°C. The optimum temperature for cotton from sowing to emergence is 25-30°C, while the optimum temperature from emergence to bud formation, bud formation to flowering, and flowering to boll opening is 30°C, with 35°C considered high. The optimum temperature range for sexual reproduction in cotton is 28-30°C, with temperatures above 33°C generally considered high for sexual reproduction. The optimum temperature for boll growth and development is 25-26°C, with temperatures above 30°C considered high for boll development. Temperatures above 35°C generally cause significant damage to cotton.

[0045] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, specific embodiments of the present invention are described in detail below with reference to the accompanying drawings.

[0046] High temperatures typically occur during the cotton growing season in July and August, when cotton is at peak flowering and boll setting. Cotton typically blooms in early July and reaches peak flowering from mid-July to early August. Periodic heat damage during this period is a major factor affecting anther development, reproductive processes, and flowering and boll setting. High temperatures above 35°C can reduce pollen viability, leading to reduced pollen numbers, difficulty in anther dehiscence, an increase in deformed pollen grains, a reduced pollen germination rate, and pollen abortion. Ultimately, these adverse consequences affect normal pollination, fertilization, flowering, and fruiting. Therefore, pollen viability under high-temperature stress is often used as a key indicator for screening and evaluating heat-tolerant cotton varieties.

[0047] High-temperature-resistant cotton is a key breeding direction to ensure the stable development of the cotton industry in response to global warming and frequent extreme high temperatures. Exploring the key genes that affect pollen development under high temperatures is crucial for breeding for high-temperature resistance. The present invention utilizes the CRISPR-Cas9 gene editing system and uses upland cotton Jin 668 as a receptor to construct a loss-of-function mutant of the upland cotton GhCASPL1F1 gene (CottonMD ID No.: Ghir_D09G025390). It was found that the transgenic upland cotton plants were basically the same as the wild-type phenotype at room temperature, with no significant differences in anther dehiscence rate and pollen viability; however, after 5 days of high-temperature stress treatment at 35°C, the anther dehiscence rate and pollen viability of the transgenic upland cotton plants were significantly higher than those of the wild-type control. Toluidine blue staining was used to observe the microscopic morphology of pollen at different stages of development. Under high temperature stress, wild-type plants exhibited poor anther development and abnormal microspore morphology, leading to an increased rate of malformed pollen grains, anther failure, abortion, and reduced pollen germination potential. However, inhibiting GhCASPL1F1 expression reduced the extent to which these adverse developmental processes, such as pollen viability, malformation, and abortion, were affected by high temperature stress. Furthermore, anthers in transgenic upland cotton plants maintained a certain degree of fertility even after high temperature stress. These results suggest that the GhCASPL1F1 gene negatively regulates heat resistance in cotton. Inhibiting GhCASPL1F1 expression in cotton can improve the heat stress tolerance of transgenic cotton plants, providing technical support for the development of heat-resistant germplasm.

[0048] On this basis, an embodiment of the present invention provides a GhCASPL1F1 gene, and the amino acid sequence of the protein encoded by the GhCASPL1F1 gene is shown in SEQ ID NO.3.

[0049] The nucleotide sequence of a gene can usually be deduced based on the amino acid sequence of the protein through conventional means such as codon encoding rules.

[0050] Optionally, the nucleotide sequence of the GhCASPL1F1 gene is shown as SEQ ID NO.1 or SEQ ID NO.2.

[0051] Those skilled in the art will appreciate that, due to the degeneracy of the genetic code, nucleotide sequences other than the above examples can also encode the GhCASPL1F1 protein of the present invention. Therefore, the above examples of nucleotide sequences should not be used to limit the scope of protection of the present invention.

[0052] The embodiment of the present invention also provides the use of the GhCASPL1F1 gene in cultivating high-temperature-resistant cotton germplasm.

[0053] The GhCASPL1F1 gene provided by the present invention is a negative regulatory factor for high temperature resistance of cotton, and the gene is analyzed to affect physiological processes such as cotton anther dehiscence and anther development, providing a new excellent gene resource and effective means for cultivating new crop germplasms with strong tolerance to high temperature stress, and is an important gene resource available for cotton high temperature stress breeding. The GhCASPL1F1 gene is applied to plant genetic engineering breeding, and by negatively regulating the expression of the gene, the adaptability of the plant to high temperature and the ability to tolerate high temperature stress can be improved, male fertility under high temperature environment can be maintained and improved, and the male sterility of cotton caused by high temperature and the resulting substantial reduction in cotton production can be significantly alleviated. It has important theoretical value and practical significance as well as good economic benefits for improving the high temperature resistance of economic crops and improving crop yield and quality under high temperature frequent environments. In addition, the genetic engineering breeding method based on the heat response gene of the present invention is simple to operate, accurate and efficient, can greatly shorten the breeding cycle of high temperature resistant varieties, improve breeding efficiency, and has a wide application prospect in the cultivation of new varieties of cotton high temperature resistance.

[0054] The application includes: reducing the expression level of the GhCASPL1F1 gene to improve the fertility of the cotton under high temperature; wherein, reducing the expression level of the GhCASPL1F1 gene includes knocking out the GhCASPL1F1 gene in the cotton or reducing the content of the GhCASPL1F1 protein in the cotton.

[0055] In a preferred embodiment of the present invention, gene editing technology based on the CRISPR / Cas9 system is used to knock out or inhibit the expression of the GhCASPL1F1 gene, thereby reducing the expression level of the GhCASPL1F1 gene. Optionally, the reagents used to reduce the expression level of the GhCASPL1F1 gene include but are not limited to: (A) an sgRNA for knocking out the GhCASPL1F1 gene, the nucleotide sequence of the sgRNA being shown in SEQ ID NO. 4; (B) a nucleic acid molecule comprising the sgRNA described in (A); (C) an editing vector comprising the sgRNA described in (A) or the nucleic acid molecule described in (B); and (D) a recombinant microorganism comprising the editing vector described in (C).

[0056] Preferably, the nucleotide sequence of the nucleic acid molecule comprising the sgRNA described in (A) is shown as SEQ ID NO.5, the editing vector comprising the sgRNA described in (A) or the nucleic acid molecule described in (B) is pRGEB32-GhU6.9-NPT II, ​​and the recombinant microorganism comprising the editing vector described in (C) is Agrobacterium.

[0057] Specifically, reducing the expression level of the GhCASPL1F1 gene in cotton includes the following steps: preparing an editing vector targeting the GhCASPL1F1 gene, transforming wild-type cotton plants, and cultivating transgenic cotton plants with reduced expression level of the GhCASPL1F1 gene.

[0058] More specifically, the method for preparing the editing vector includes the following steps: connecting the sgRNA shown in SEQ ID NO.4 or the nucleic acid molecule shown in SEQ ID NO.5 to the pRGEB32-GhU6.9-NPT II expression vector through an in-fusion seamless cloning reaction to obtain the editing vector.

[0059] The sgRNA shown in SEQ ID NO. 4 or the nucleic acid molecule shown in SEQ ID NO. 5 can be obtained by artificial synthesis or PCR amplification. The sequences of the primer pairs for amplifying the nucleic acid molecule shown in SEQ ID NO. 5 are shown in SEQ ID NOs. 6-7.

[0060] The above-mentioned editing vector is used to transform wild-type cotton plants using conventional techniques well known to those skilled in the art. Specifically, it can be introduced into cotton cells or tissues by using the following DNA transfection methods: calcium phosphate co-precipitation method, Ti plasmid method, Ri plasmid method, viral vector method, gene gun method, microinjection method, electroporation method or Agrobacterium-mediated method, etc.

[0061] In a preferred embodiment of the present invention, the editing vector is used to transform wild-type cotton plants using Agrobacterium-mediated method.

[0062] Another embodiment of the present invention provides a method for preparing high-temperature resistant cotton germplasm, comprising the following steps:

[0063] An editing vector targeting the GhCASPL1F1 gene is prepared, and wild-type cotton plants are transformed to obtain transgenic cotton plants with reduced expression levels of the GhCASPL1F1 gene. The editing vector comprises the sgRNA shown in SEQ ID NO.4 or the nucleic acid molecule shown in SEQ ID NO.5.

[0064] Yet another embodiment of the present invention provides the use of a reagent for reducing the expression level of the GhCASPL1F1 gene in cultivating high-temperature-resistant cotton germplasm, wherein the reagent for reducing the expression level of the GhCASPL1F1 gene includes but is not limited to: (A) sgRNA for knocking out the GhCASPL1F1 gene, the nucleotide sequence of the sgRNA being shown as SEQ ID NO.4; (B) a nucleic acid molecule comprising the sgRNA in (A); (C) an editing vector comprising the sgRNA in (A) or the nucleic acid molecule in (B); and (D) a recombinant microorganism comprising the editing vector in (C).

[0065] Preferably, the nucleotide sequence of the nucleic acid molecule comprising the sgRNA described in (A) is shown as SEQ ID NO.5, the editing vector comprising the sgRNA described in (A) or the nucleic acid molecule described in (B) is pRGEB32-GhU6.9-NPT II, ​​and the recombinant microorganism comprising the editing vector described in (C) is Agrobacterium.

[0066] In the present invention, the cotton variety is Gosspyium hirsutum, and the high temperature is a temperature 25-30°C higher than the suitable growth temperature of cotton, for example, 35°C.

[0067] The present invention will be further described below with reference to specific examples. Experimental methods in the following examples where specific conditions are not specified were generally performed under conventional conditions, such as those described in the Molecular Cloning Laboratory Manual (4th Edition) published by Cold Spring Harbor Laboratory, or under conditions recommended by the manufacturer.

[0068] Example

[0069] Plant Materials: The cotton material used for the transformation and editing vector is Gossypium hirsutum Jin668, a heat-resistant germplasm resource. See the reference "Jin Shuangxia. Optimization of Cotton Genetic Transformation System and Mutant Generation [D]. Huazhong Agricultural University, 2006." The public may obtain relevant germplasm resources from the applicant for use solely in replicating the experiments described in this invention and for no other purpose.

[0070] Genes and primers: The GhCASPL1F1 gene (gene ID number Ghir_D09G025390 in the Cotton Multi-Omics Database (CottonMD)), the encoded protein, and the related primer sequences used in the construction of the gene editing vector are shown in Table 1. gDNA indicates genomic DNA, and ORF indicates open reading frame.

[0071] Table 1 Sequences of the GhCASPL1F1 gene and related primers in the embodiment of the present invention

[0072]

[0073]

[0074] 1. GhCASPL1F1 gene is a potential heat-resistant gene

[0075] Based on the expression data of cotton tapetum-specific expression genes at normal and high temperatures (provided by the cotton genetic improvement team of Huazhong Agricultural University), the present invention showed that under high temperature stress conditions, the Ghir_D09G025390 gene was concentratedly expressed at the anther dehiscence stage (ADS) and the expression level was relatively high. Therefore, it is speculated that the Ghir_D09G025390 gene may respond to high temperature stress.

[0076] In the Cotton Multi-Omics Database (CottonMD), the GhCASPL1F1 gene ID is Ghir_D09G025390, its corresponding nucleotide sequence is shown in SEQ ID NO. 1, and its open reading frame sequence is shown in SEQ ID NO. 2. An amino acid sequence alignment at the National Center for Biotechnology Information (NCBI) revealed a 100% similarity with protein XP_016718857. The 178-aa sequence is most similar in function to the protein translated from the Ghir D09G025390 gene, which is annotated as CASP-like protein 1F1 (CASPL1F1) in upland cotton (Gossypium hirsutum). Therefore, the Ghir_D09G025390 gene was named GhCASPL1F1.

[0077] 2. Design of sgRNA targeting GhCASPL1F1 gene

[0078] The conserved region of the GhCASPL1F1 gene in upland cotton was selected to design the target site sgRNA. The sgRNA design principles based on CRISPR / Cas9 gene editing technology are as follows: 1) the PAM sequence is NGG; 2) the sgRNA length is 23bp; 3) the GC content of the sgRNA is 40%-60%; 4) the Tm value is between 55-65°C; 5) secondary structures and repetitive sequences are avoided.

[0079] The nucleotide sequence of the sgRNA designed in this example is CCGCATGGGTGATTTTCACT (shown in SEQ ID NO. 4), and the bases in bold are the protospacer adjacent motifs (PAM).

[0080] The designed sgRNA was sent to GenScript Biotech Co., Ltd. for synthesis and stored at 4°C for future use.

[0081] 3. Construction of CRISPR / Cas9 editing vector targeting the GhCASPL1F1 gene

[0082] The aforementioned sgRNA is linked to an expression vector via a polycistronic tRNA-gRNA arrangement to create an editing vector carrying the tRNA-gRNA fusion fragment (nucleotide sequence shown in SEQ ID NO. 5). This editing vector is then co-transformed with the Cas9-encoding gene into host cells to achieve gene editing. The experimental principle of CRISPR / Cas9 gene editing technology is that after the CRISPR system cuts the target, the organism initiates its own repair mechanism, generating mutations that silence the target gene function. In this process, the gRNA guides the Cas9 protein to any DNA site containing the residues 5'-N20-NGG-3' (N=A, T, G, C) or 5'-CCN-N20-3', where NGG is the PAM required for Cas9 recognition. The Cas9 / gRNA precisely cuts the target DNA double strand approximately 3 bp before the PAM. However, gRNA cannot recognize the target gene that needs to be silenced. Therefore, it is necessary to design an sgRNA sequence on the ORF sequence of the target gene that can guide the gRNA to specifically recognize the target gene. That is, the role of sgRNA is to guide the gRNA to specifically recognize the target gene.

[0083] The present invention preferably constructs the tRNA-gRNA fusion fragment into the pRGEB32-GhU6.7-NPT II vector containing the Cas9 encoding gene to obtain an editing vector. The construction method of the expression vector pRGEB32-GhU6.9-NPT II is described in the literature "Wang P, Zhang J, Sun L, et al. High efficiency multisites genome editing in allotetraploid cotton (Gossypium hirsutum) using CRISPR / Cas9 system [J]. Plant Biotechnology Journal, 2018, 16 (1): 137-150" and the patent "CN108203714A A cotton gene editing method (publication date: 2018-06-26)". Of course, those skilled in the art can also construct the sequence shown in SEQ ID NO.5 into other expression vectors.

[0084] First, the tRNA-gRNA product was amplified using the overlap extension PCR method using the forward primer P1-F and the reverse primer P2-R (nucleotide sequence shown in SEQ ID NO. 6-7). The amplification primer sequences and tRNA-gRNA product are shown below:

[0085] P1-F:5'-AAGCATCAGATGGGCAAACAAAGCACCAGTGGTCTAG-3' (see SEQ ID NO.6);

[0086] P2-R: 5'-TTCTAGCTCTAAAACAGTGAAAATCACCCATGCGG-3' (see SEQ ID NO. 7);

[0087] tRNA-gRNA product:

[0088] AAGCATCAGATGGGCA AACAAAGCACCAGTGGTCTAGTGGTAGAATAGTACCCTGC CACGGTACAGACCCGGGTTCGATTCCCGGCTGGTGCACCGCATGGGTGATTTTCACTGT TTTAGAGCTAGAA, the underlined bases are sequences homologous to the vector pRGEB32-GhU6.7-NPT II.

[0089] The PCR amplification system consisted of 16.1 μL of ddH2O, 10× Buffer 2, dNTPs, 0.2 μL of forward primer (P1-F), 0.2 μL of reverse primer (P2-R), and 1 μL of pGTR4 plasmid. PCR conditions included three cycles of initial denaturation at 95°C for 5 min, followed by denaturation at 95°C for 30 sec, annealing at 55°C for 30 sec, and extension at 72°C for 20 sec. The following cycles were followed by 27 cycles of denaturation at 95°C for 30 sec, annealing at 60°C for 30 sec, and extension at 72°C for 20 sec, followed by extension at 72°C for 5 min. The PCR product was stored at 4°C. The relevant research results of PGTR plasmid were published in the document "Xie K, Minkenberg B, Yang Y. Boosting CRISPR / Cas9 multiplex editing capability with the endogenous tRNA-processing system[J]. Proceedings of the National Academy of Sciences of the United States of America, 2015, 112(11): 3570-3575."

[0090] The tRNA-gRNA amplified product was then ligated into the pRGEB32-GhU6.9-NPT II expression vector using an in-fusion seamless cloning reaction. The expression vector was digested with BsaI (purchased from Beijing NEB, Cat. No. R3733L) at 37°C overnight. The linearized pRGEB32-GhU6.9-NPT II expression vector and the tRNA-gRNA amplified product were then ligated using the ClonExpress Entry Step Cloning Kit (purchased from Nanjing Novozymes Biotechnology Co., Ltd.) to generate the GhCASPL1F1 gene editing vector. The ligation system consisted of 100 ng of the tRNA-gRNA fusion fragment, 100 ng of the linearized pRGEB32-GhU6.9-NPT II expression vector, 0.5 μL of Exnase enzyme, and 1.0 μL of CE buffer. The cells were incubated at 37°C for 30 min and placed on ice for 5 min to obtain the ligated editing vector.

[0091] The editing vector was electroporated into Agrobacterium GV3101 competent cells, and positive clones were identified through kanamycin resistance screening and PCR. Finally, sequencing was performed using U6-7-F as the forward primer and P2-R as the reverse primer to verify the correct construction of the vector. The sequencing work was commissioned to Qingke Biotechnology Co., Ltd.

[0092] U6-7-F: 5'-TGTGCCACTCCAAAGACATCAG-3' (see SEQ ID NO. 8).

[0093] 4. Agrobacterium-mediated transformation of cotton cells with the editing vector targeting the GhCASPL1F1 gene

[0094] The constructed editing vector was introduced into the host cells of upland cotton Jin 668 through Agrobacterium-mediated transformation. The specific transformation steps are as follows: (1) Select plump and healthy seeds of upland cotton Jin 668, peel off the seed coat, soak them in 0.1% HgCl2 for 10 minutes, and then wash them with sterile water three times. The sterilized cotton seeds are inoculated on sterile seedling germination medium and cultured in a 28°C constant temperature box under dark conditions for 4-6 days; (2) Take the hypocotyls of sterile seedlings, cut them into 0.5-0.8 cm small segments, and inoculate them in Agrobacterium liquid with an OD value of 0.5. After infection for 10 minutes, use sterile filter paper to dry the liquid on the surface of the hypocotyls; (3) Inoculate the hypocotyls in co-cultivation medium and co-cultivate them at 21°C for 48 hours; transfer them to selection medium and subculture them once every month until embryonic callus tissue is obtained; transfer the embryonic callus tissue to differentiation medium to obtain a large number of embryoids; (4) Transfer the obtained embryoids to embryo germination and seedling culture medium until transgenic plant seedlings are obtained.

[0095] Transformation medium components and preparation methods: (1) Sterile seedling germination medium: (1) Sterile seedling germination medium: 1 / 2 Murashige, Skoog and Medium (MS medium), 15g / L glucose, 2.5g / L Phytagel; pH value is 6.1-6.2; (2) Callus induction medium: Murashige and Skoog B5 modified medium (Murashige and Skoog B5 modified medium (MSB medium), 2,4-dichlorophenoxyacetic acid (2,4-D) 0.1 mg / L, kinetin (KT) 0.1 mg / L, 3% glucose, 0.3% Phytagel; pH value is 5.85-5.95; (3) Agrobacterium activation medium: tryptone 5 g / L, sodium chloride 5 g / L, magnesium sulfate heptahydrate 0.1 g / L, potassium dihydrogen phosphate 0.25 g / L, mannitol 5 g / L, glycine 1.0 g / L; pH value is 5.85-5.95; (4) co-culture medium: MSB medium, 2,4-D 0.1 mg / L, KT 0.1 mg / L, 50 mg / L acetosyringone, 3% glucose, 0.25% Phytagel, pH value is 5.8; (5) selection medium: MSB medium, 2,4-D 0.1 mg / L, KT 0.1 mg / L, 3% glucose, 0.3% Phytagel, 50 mg / L kanamycin, 400 mg / L cephalosporin; pH 5.85-5.95; (6) Differentiation medium: remove ammonium nitrate from MS medium, double the amount of potassium nitrate, 1.0 g / L glutamine, 0.5 g / L asparagine, 0.5 mg / L indolebutyric acid, 0.15 mg / L KT, 3% glucose, 0.25% Phytagel; pH 6.1-6.2; (7) Rooting medium: 1 / 2 MS medium, organic components of MSB medium (inositol 100 mg / L, nicotinic acid 1.0 mg / L and pyridoxine hydrochloride 1.0 mg / L), 15 g / L glucose, 2.5 g / L Phytagel; pH 5.90-5.95.

[0096] 5. Detection of GhCASPL1F1 gene editing in T1 transgenic cotton plants

[0097] After the above transformation process, transgenic T0 generation plants were obtained. The T0 generation was strictly self-pollinated, and the T1 generation seeds were harvested and planted at the experimental base of Huazhong Agricultural University in Wuhan, Hubei Province. The leaves of the T1 generation plants were taken when they grew to 30 cm, and the DNA was extracted using the plant DNA quick extraction kit of Magen Biological Company. Using the DNA of each individual plant as a template, PCR amplification was performed using the detection primers Cas9-F (forward primer) and Cas9-R (reverse primer) of the Cas9 gene. The PCR product was electrophoresed on a 1.0% TAE agarose gel (sample volume 5 μL). When a band of about 600 bp could be amplified, it indicated that the individual plant was an edited plant.

[0098] Cas9-F: 5'-GCTTGTGCGTTTCGATTTGA-3' (see SEQ ID NO. 9);

[0099] Cas9-R: 5'-CCGCTCGTGCTTCTTATCCT-3' (see SEQ ID NO. 10).

[0100] In addition, to detect the specific gene editing status of T1 transgenic plants, the forward primer P3-F and reverse primer P4-R were used to amplify the flanking sequence of the sgRNA. The amplified PCR products were mixed and purified, and then high-throughput sequencing was performed. After the high-throughput sequencing data was returned, the data was split and the editing efficiency was tested, and visualization was performed in R language. The relevant primer sequences used for sequencing are shown below:

[0101] P3-F: 5'-TTGAGAATTGCGGCGAC-3' (see SEQ ID NO. 11);

[0102] P4-R: 5'-TACTTGAAAGCAGGTGAATAGC-3' (SEQ ID NO. 12).

[0103] Sequencing analysis showed that 15 individual plants had an editing efficiency >80%; 8 individual plants had an editing efficiency of 30%-80%; and 3 individual plants had a mutation rate <30%. Cas9 positive detection showed that 50% of the T1 generation plants still had Cas9 protein. The edited sequence of one of the GhCASPL1F1 transgenic lines with an editing efficiency exceeding 90% was selected for display (see Figure 1, where Substitutions represents substitution, Insertions represents insertion, Deletions represents deletion, and Predicted cleavagepositions represents predicted cleavage positions). The results showed that the main type of gene editing was single-base T insertion. Considering the rigor of the experiment, the Cas9 positive test was combined with the third-generation and second-generation genome extraction sequences of GhCASPL1F1 for comparison. The results showed that in the strains confirmed by Cas9 positive test, there was a specific single-base T insertion gene variant sequence, which did not match the corresponding homologous sequence in the second-generation and third-generation genome extraction sequences ( Figure 2 , where Ghir_D09G025390.1 is the third-generation sequencing genome, Gh_09G2396.1 is the second-generation sequencing genome, the large red box is the sgRNA targeting sequence, and the small red box is the homologous sequence position corresponding to the gene mutation sequence in the transgenic line), ensuring that the mutation of the GhCASPL1F1 transgenic T1 generation line is caused by gene editing.

[0104] 6. Phenotypic changes of T1 transgenic cotton plants under high temperature stress

[0105] The male fertility of the T1 generation of the GhCASPL1F1 transgenic lines was investigated under both normal and high temperature conditions. Pollen development primarily proceeds through the following process: the stamen primordium first differentiates into archesporial cells, which undergo periclinal divisions to produce inner and outer layers of cells. The outer layer, called the peritrichous cells, divides and differentiates to form the fibrous layer of the anther wall and the tapetum surrounding the pollen sac. The inner layer, called the sporogenous cells, then undergoes mitosis to form pollen mother cells, which in turn form microspores and ultimately mature pollen grains. Continuous exposure to high temperature during these periods can lead to abnormal microspore development, resulting in anther failure, pollen grain abortion or deformity, reduced pollen quantity, and decreased pollen viability.

[0106] The conditions for high temperature stress treatment are as follows: T1 generation plants were planted at the experimental base of Huazhong Agricultural University in Wuhan, Hubei Province. When they grew to the peak bud stage, they were subjected to high temperature stress treatment: 37-39℃ for 12 hours during the day and 29-31℃ for 12 hours at night, and the high temperature treatment cycle was 7 days; the conditions for normal temperature treatment were: when the plants grew to the peak bud stage, 28-35℃ for 12 hours during the day and 20-25℃ for 12 hours at night.

[0107] Under normal temperature and high temperature conditions, the flowers of transgenic cotton that bloomed on the same day were collected at around 8 o'clock in the morning on a clear day, and wild-type cotton was collected for control. Note that the collected flowers should be temporarily placed on ice to keep fresh, to ensure that the pollen vitality is closest to the state when it was just collected. Observe and take photos to record the cracking of the anthers. In order to prevent negative interference from the background, a black curtain was used as the photo background in the experiment. In addition, the pollen activity was determined by the TTC staining method. For specific operations, please refer to the patent "CN109752226A A method for rapid quantification of pollen activity at room temperature or high temperature and its application (publication date: 2019-05-14)". The brief steps are as follows: Take 8 grams of TTC (2,3,5-triphenyltetrazolium chloride, molecular weight 334.8) and dissolve it in 1L phosphate buffer (26.6g dipotassium hydrogen phosphate trihydrate and 10.2g dipotassium hydrogen phosphate) to prepare a 2% working solution and store it at 4°C in the dark. When used, the pollen was divided into 2 mL centrifuge tubes, anthers were inserted, and after dark treatment for 30 min, the pollen was taken out and the morphology and activity of the pollen grains were observed under a stereo microscope.

[0108] The results of anther and pollen viability phenotypes of wild-type and T1 transgenic cotton plants are shown in Figure 3 NT stands for normal temperature, and HT stands for high temperature. Figures A to D show individual anthers from wild-type (WT) Jin 668 and T1 transgenic plants with the GhCASPL1F1 gene edited under normal and high temperature treatments, respectively. Scale bar: 1 cm. Figures A to D show TTC staining of pollen viability from individual WT and transgenic cotton plants under normal and high temperature treatments, respectively. Scale bar: 100 μm. It can be seen that under normal temperature, the anther dehiscence rate and pollen viability of transgenic plants were not significantly different from those of wild-type controls. However, under high temperature conditions (greater than 35°C for 5 days), the anther dehiscence rate and pollen viability of transgenic plants under high temperature stress were significantly higher than those of wild-type controls.

[0109] Further observation was made on anther sections of wild-type and T1 transgenic cotton plants at three important stages of anther development (tetrad stage (TS), tapetum degradation stage (TDS), and anther dehiscence stage (ADS)). The specific steps of paraffin tissue sectioning are as follows: (1) Fixation: Take anthers of transgenic materials at various stages and fix them in FAA prepared with ddH2O (volume ratio of anhydrous ethanol: glacial acetic acid: formaldehyde: distilled water = 10:1:2:7). After fixation, vacuumize three times for 15 minutes each time, replace with new fixative and fix at room temperature for more than 24 hours; (2) Dehydration: Dehydrate the fixed samples in stages with 70% ethanol, 85% ethanol, and 95% ethanol (containing 0.1% eosin), respectively, for 1 hour each stage, and anhydrous ethanol twice each time. 1h, the amount used for each level should not exceed 1 / 2 of the bottle volume; (3) Transparent: the sample is transparentized step by step in the volume ratio of 1 / 4, 1 / 2, and 3 / 4 xylene, each level for 1h, and pure xylene twice, each time for 1h, and the amount used for each level should not exceed 1 / 2 of the bottle volume; (4) Wax immersion: after the transparent process, add about 1 / 4 volume of crushed wax, and continue to add crushed wax after overnight in a 42℃ constant temperature box. After adding crushed wax for 1-2 days, add pure wax 3 times, each time for 3h, and incubate in a 60℃ constant temperature box. The last time can be overnight; (5) Embedding: Pre-fold the appropriate size of the sample according to the sample Paper box, melt fresh paraffin on the induction cooker and put it in a constant temperature box at 60℃ for later use. The temperature of the embedded liquid paraffin should not be too high to avoid burning the tissue. When embedding, first spread a layer of embedding wax about 1 cm thick. If the wax block is too thick, it will be difficult to trim it. Then pour the sample into the paper box and use tweezers to arrange the sample evenly. Let the material cool naturally. The wax block can be stored for a long time; (6) Trimming: Take the wax block out of the paper box and trim the sample wax block into a horizontal or vertical direction as needed. The cut surface of the microtome blade should be rectangular, otherwise it will be difficult to form a wax strip; (7) Slicing: The wax block was trimmed into a trapezoidal shape and cut into 10 μm thick wax strips using a microtome. The strips were then spread on a glass slide coated with 10 μL poly-lysine and 200 μL distilled water. The excess distilled water was removed and the slides were dried on a 37°C slide stand. The slides were then placed in a 37°C incubator overnight. (8) Dewaxing and staining: The basic dewaxing process was to soak the slides in xylene twice for 15 minutes each, followed by rehydration with 100%, 95%, 85%, 70%, 50%, and 30% ethanol in a stepwise manner for 2 minutes each. The slides were then rinsed with distilled water twice for 2 minutes each. Slides were stained with 0.05% toluidine blue for 5 minutes. After staining, the slides were placed in a freshly dewaxed and rehydrated staining jar in the reverse order, with the soaking time remaining unchanged. (9) Mounting: Neutral gum (Chinese medicine) and xylene were mixed in equal volumes to form a mounting medium. The sections were removed from the xylene and 50-80 μL of the mounting medium was added dropwise. A clean cover glass was slowly placed on the slide using tweezers to avoid bubbles. The slides were then air-dried in a fume hood for at least 1 hour and then dried in a 37°C incubator overnight. The slides were then observed and photographed using an optical microscope (Zeiss HAL100).

[0110] The results of anther tissue section staining under normal temperature (NT) and high temperature (HT) treatments are shown in Figure 4-5 Figures A to F show the TS, TDS, and ADS stages of anther development in wild-type cotton plants and in T1 transgenic cotton plants with the GhCASPL1F1 gene edited, respectively. In the figures, TS denotes the tetrad stage, TDS denotes the tapetum degradation stage, and ADS dehiscence. T denotes tapetum, Msp denotes microspore, En denotes the inner wall of the anther chamber, St denotes the fissure, PG denotes pollen grain, Tds denotes tetrad, ML denotes the middle layer, and E denotes the epidermis. The scale bar is 50 μm. The results showed that at room temperature, there were no significant differences in microspore morphology between wild-type and T1 transgenic cotton plants at the three critical anther stages (TS: tetrad stage; TDS: tapetum degradation stage; ADS: anther dehiscence stage). Under 5-day high temperature stress (greater than 35°C for 5 days), transgenic plants formed tetrads normally during the TS period compared to wild-type plants. During the TDS period, morphologically abnormal microspores appeared in the wild-type plants, but nearly all microspores in the transgenic plants remained round, with normal pollen wall spikes. During the ADS period, pollen grains shrivelled and anthers did not dehisce in the wild-type plants, but pollen grains in the transgenic plants remained normal, with the septum beneath the dehiscence tissue degrading normally. This suggests that the edited loss of function of the GhCASPL1F1 gene can enhance the heat resistance of cotton anthers, ensuring normal anther development in high-temperature environments and improving high-temperature fertility.

[0111] In summary, the GhCASPL1F1 gene in cotton negatively regulates high temperature resistance in cotton anthers. By editing the GhCASPL1F1 gene fragment in cotton to inactivate its expression, cotton plants with high temperature resistance potential can be created and the fertility of cotton under high temperature can be maintained.

[0112] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. Application of the GhCASPL1F1 gene in cultivating high temperature resistant cotton germplasm, characterized in that: The amino acid sequence of the protein encoded by the GhCASPL1F1 gene is shown in SEQ ID NO.

3.

2. The use of the GhCASPL1F1 gene according to claim 1 in cultivating high temperature resistant cotton germplasm, characterized in that: The nucleotide sequence of the GhCASPL1F1 gene is shown in SEQ ID NO.1 or SEQ ID NO.

2.

3. The use of the GhCASPL1F1 gene according to claim 1 in cultivating high temperature resistant cotton germplasm, characterized in that: The application includes: reducing the expression level of the GhCASPL1F1 gene, thereby improving the fertility of the cotton under high temperature.

4. The use of the GhCASPL1F1 gene according to claim 3 in cultivating high temperature resistant cotton germplasm, characterized in that: The agent for reducing the expression level of the GhCASPL1F1 gene is selected from one of the following (A)-(D): (A) sgRNA for knocking out the GhCASPL1F1 gene, the nucleotide sequence of the sgRNA is shown in SEQ ID NO. 4; (B) a nucleic acid molecule comprising the sgRNA described in (A); (C) an editing vector comprising the sgRNA described in (A) or the nucleic acid molecule described in (B); (D) A recombinant microorganism comprising the editing vector described in (C).

5. The use of the GhCASPL1F1 gene according to claim 4 in cultivating high temperature resistant cotton germplasm, characterized in that: The nucleotide sequence of the nucleic acid molecule comprising the sgRNA described in (A) is shown in SEQ ID NO. 5; Or, the editing vector comprising the sgRNA described in (A) or the nucleic acid molecule described in (B) is pRGEB32-GhU6.9-NPTII; Alternatively, the recombinant microorganism comprising the editing vector described in (C) is Agrobacterium.

6. Use of the GhCASPL1F1 gene according to claim 3 in cultivating high temperature resistant cotton germplasm, characterized in that: Reducing the expression level of the GhCASPL1F1 gene in cotton comprises the following steps: An editing vector targeting the GhCASPL1F1 gene is prepared, and the wild-type cotton plant is transformed to cultivate a transgenic cotton plant with a reduced expression level of the GhCASPL1F1 gene.

7. Use of the GhCASPL1F1 gene according to claim 6 in cultivating high temperature resistant cotton germplasm, characterized in that: The preparation method of the editing vector comprises the following steps: The sgRNA shown in SEQ ID NO.4 or the nucleic acid molecule shown in SEQ ID NO.5 was connected to the pRGEB32-GhU6.9-NPT II expression vector through an in-fusion seamless cloning reaction to obtain the editing vector.

8. Use of the GhCASPL1F1 gene according to any one of claims 1 to 7 in cultivating high temperature resistant cotton germplasm, characterized in that: The cotton is upland cotton.

9. A method for preparing high temperature resistant cotton germplasm, characterized in that: The following steps are involved: An editing vector targeting the GhCASPL1F1 gene is prepared, and wild-type cotton plants are transformed to obtain transgenic cotton plants with reduced expression levels of the GhCASPL1F1 gene. The editing vector comprises the sgRNA shown in SEQ ID NO.4 or the nucleic acid molecule shown in SEQ ID NO.

5.

10. Use of a reagent for reducing the expression level of the GhCASPL1F1 gene in cultivating high-temperature resistant cotton germplasm, characterized in that: The agent for reducing the expression level of the GhCASPL1F1 gene is selected from one of the following (A)-(D): (A) sgRNA for knocking out the GhCASPL1F1 gene, the nucleotide sequence of the sgRNA is shown in SEQ ID NO. 4; (B) a nucleic acid molecule comprising the sgRNA described in (A); (C) an editing vector comprising the sgRNA described in (A) or the nucleic acid molecule described in (B); (D) A recombinant microorganism comprising the editing vector described in (C).

Images