Application of OsIQD gene in regulation and control of grain shape, grain weight and drought resistance of rice

Abstract

The invention belongs to the technical field of plant genetic engineering, and discloses application of an OsIQD gene in regulation and control of rice grain shape, grain weight and drought resistance. The gene OsIQD for regulating and controlling the rice grain shape and the rice drought resistance is cloned by adopting a candidate gene correlation analysis method, and the result shows that the gene OsIQD is a positive regulation factor for regulating and controlling the grain shape, the grain weight and the drought resistance at the same time through seed size statistics and a seedling stage drought experiment of a mutant and an over-expression material of the gene OsIQD, so that the gene OsIQD is a positive regulation factor for regulating and controlling the grain shape, the grain weight and the drought resistance at the same time. Meanwhile, the application value of the gene in regulation and control of the rice grain shape and improvement of the rice yield and the rice drought resistance is also proved.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and specifically relates to the application of the OsIQD gene in regulating rice grain shape, grain weight and drought resistance. Background Art

[0002] Rice is a major food crop, and increasing rice yield remains a primary goal of rice improvement. Rice yield is a complex trait influenced by numerous other agronomic traits, such as the number of panicles per plant, the number of grains per panicle, grain weight, and grain filling ratio. Rice seed size is one of the most important factors determining grain yield, and understanding the complex genetic basis of grain shape variation, which is controlled by multiple genes, is crucial for improving rice yield. To date, a series of quantitative trait genes related to grain shape and weight have been identified and cloned, including OsGSK2, OsSGL, TGW6, GS3, GW2, GS5, qSW5 / GW5, GW8 / SPL16, GL3.1 / qGL3 / qGL3-1, DEP1, DEP2, SRS3, and SRS5. These genes regulate grain size by regulating cell proliferation and expansion, involving plant hormones, G protein signaling, MAPK signaling, transcriptional regulatory factors, and the ubiquitin-proteasome pathway (Li N, Xu R, Duan P, et al. Control of grain size in rice. Plant reproduction, 2018, 31: 237-251). Among them, GW5 / qSW5 / GSE5 (IQ), a major quantitative trait gene that regulates grain shape and grain weight, has been reported. It is a plasma membrane protein with an IQ-domain that regulates grain shape and weight by inhibiting GSK2 kinase activity and autophosphorylation, resulting in reduced phosphorylation levels of the substrates OsBZR1 and DLT. Loss of function in GW5 / qSW5 activates and promotes lemma cell division, leading to increased grain width and 1000-grain weight, thereby increasing yield (Liu J, Chen J, Zheng X, et al. GW5 acts in the brassinosteroid signaling pathway to regulate grain width and weight in rice. Nat Plants, 2017, 3:17043). Therefore, the cloning of grain shape genes provides genetic resources for molecular design breeding in rice and is of great significance for guiding high-yield rice breeding.

[0003] Rice yield is also affected by many external environmental factors during its growth process, such as drought, high temperature, cold damage and pests and diseases. Especially in the context of global climate change and growing demand for agricultural water, drought and high temperature have become the main factors limiting rice yield (Gupta A, Andrés Rico-Medina, Cao-Delgado A I. The physiology of plant responses to drought. Science, 2020, 368: 266-269). Drought stress is a key factor limiting plant growth, not only affecting photosynthesis and respiration, but also directly affecting cell expansion and division (Hilty J., Muller B., Pantin F., Leuzinger S. Plant growth: The What, the How, and the Why. New Phytologist, 2021, 232: 25-41). At the same time, insufficient water supply can also lead to a decrease in cellular water potential, causing dehydration and impairing cellular metabolism, increasing oxidative stress levels, leading to the generation of ROS, disrupting the normal redox balance, and ultimately causing large-scale rice yield reductions (Vinocur B., Altman A. Recent advances in engineering plant tolerance to abiotic stress: Achievements and limitations. Curr Opin Biotechnol, 2005, 16: 123-132). Therefore, screening and identifying genes involved in regulating rice drought-related factors from rice populations, while also regulating rice yield, will be of great significance for breeding new drought-resistant rice varieties. Summary of the Invention

[0004] The purpose of the present invention relates to the application of an IQ-Domain-containing protein family gene OsIQD in regulating rice grain shape, grain weight and drought resistance.

[0005] In order to achieve the above object, the present invention adopts the following technical measures:

[0006] The present invention uses candidate gene association analysis to screen for IQ-Domain protein family members highly expressed in rice panicles and conducts association analysis with drought-resistant candidate genes. Corresponding mutants were obtained using CRISPR-Gas9 gene editing technology. One of the gene-edited mutants exhibited elongated seeds and drought-sensitive plants. Overexpression of this gene resulted in short, plump rice grains, conferring enhanced drought tolerance. This gene was named OsIQD. The nucleotide sequence of the OsIQD gene is shown in the sequence listing as SEQ ID NO. 1, which is 1395 bp long. Its corresponding amino acid sequence is shown in SEQ ID NO. 2, which is 464 AA long. Seed size statistics of the mutants and overexpressing materials, as well as seedling drought experiments on the mutants and overexpressing plants, indicate that the gene is a positive regulator of grain shape and drought resistance, demonstrating its potential application in regulating rice grain shape, increasing rice yield, and enhancing rice drought resistance.

[0007] The protection scope of the present invention includes:

[0008] Application of the OsIQD gene in regulating rice grain shape, grain weight and / or drought resistance, wherein the protein encoded by the OsIQD gene is represented by SEQ ID NO. 2; the above application is specifically:

[0009] Increasing the expression of OsIQD genes in rice to reduce the length-to-width ratio of rice grains, increase rice grain weight, and / or enhance rice drought resistance;

[0010] Reducing the expression of OsIQD genes in rice can increase the length-to-width ratio of rice grains, reduce rice grain weight, and / or weaken rice drought resistance;

[0011] Knocking out, inhibiting or silencing the OsIQD gene in rice can increase the length-to-width ratio of rice grains, reduce rice grain weight and / or weaken rice drought resistance.

[0012] In the above application, preferably, the knockout adopts the CRISPR / Cas9 system, and the target sites of gRNA in the system are GC TGCTCGTCAGCCGCACCA and ATACTCCTCCCGCTTGGCGG.

[0013] In the above-mentioned application, the rice edited by the CRISPR / Cas9 system with an increased aspect ratio of grain shape, reduced grain weight, or / and weakened drought resistance has the polynucleotide shown by SEQ ID NO.3 or SEQ ID NO.4.

[0014] The use of the OsIQD gene in rice for creating rice with a reduced length-to-width ratio of grains, increased grain weight, and / or enhanced drought resistance, wherein the use comprises introducing a substance that increases the expression of the OsIQD gene in rice into the rice;

[0015] In the above application, preferably, the substance is a nucleic acid molecule containing the OsIQD gene, or its expression cassette, recombinant vector, or recombinant microorganism;

[0016] The OsIQD gene is shown in SEQ ID NO.1.

[0017] Compared with the prior art, the present invention has the following advantages:

[0018] 1. A gene regulating rice drought tolerance, OsIQD, was identified through candidate gene association analysis.

[0019] 2. Using CRISPR-Cas9 knockout technology to target and edit the OsIQD gene, we obtained osiqd mutant seeds and found that OsIQD is also involved in regulating rice grain shape.

[0020] 3. The expression vector of the OsIQD gene of the present invention can be transformed into various plant hosts such as rice and used to cultivate new varieties of drought-resistant crops. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is the grain phenotype of the osiqd mutant;

[0022] Among them: A, gene editing status of rice osiqd CRISPR mutant; B, phenotypic photography of osiqd mutant seeds and ZH11 seeds (Bar = 5 mm); CD, statistics of osiqd mutant seed length and width; E, statistics of 1000-grain weight of osiqd mutant seeds and ZH11 seeds; it was observed that the seeds of the two mutant families were significantly longer in length than ZH11 (n = 30), significantly smaller in width than ZH11 (n = 30), and significantly smaller in 1000-grain weight than ZH11 (n = 3); data were statistically analyzed using t-test, * indicates P < 0.05; ** indicates P < 0.01; *** indicates P < 0.001; **** indicates P < 0.0001.

[0023] Figure 2 The gene expression and granule phenotype after overexpression of OsIQD;

[0024] A, Real-time fluorescence quantitative PCR detection of OsIQD expression in overexpressing lines, using the rice Actin1 gene as an internal reference gene. Data are the mean of three replicates plus the standard error. B, Detection of OsIQD protein content in overexpressing plants. Because overexpressed IQD is fused with a GFP tag, detection of the GFP tag revealed that IQD protein is indeed highly expressed in rice. Plant ACTIN was used as an internal reference protein. C, Length and width of seeds overexpressing OsIQD were photographed (Bar = 5 mm). D, E, Statistical analysis of the length and width of seeds from the two OsIQD overexpressing families. F, 1000-grain weight of seeds from the two OsIQD overexpressing families and ZH11. Statistical analysis showed that grain width was significantly increased, grain length was significantly decreased (n = 30), and 1000-grain weight was significantly greater in seeds from the OsIQD overexpressing families than in seeds from ZH11 (n = 3). Data were statistically analyzed using t-tests. * indicates P < 0.05; ** indicates P < 0.01; *** indicates P < 0.001; **** indicates P < 0.0001.

[0025] Figure 3 This is a drought experiment on osiqd mutant plants;

[0026] A, Photographs of ZH11, iqd-1, and iqd-2 mutant plants before and after drought treatment; B, Survival statistics of iqd-1 mutant plants after drought experiment; C, Survival statistics of iqd-2 mutant plants after drought experiment (n=3); Compared with the wild-type control (ZH11), osiqd15 mutant plants are more sensitive to drought. * indicates P < 0.05; ** indicates P < 0.01; *** indicates P < 0.001; **** indicates P < 0.0001.

[0027] Figure 4 This is a drought experiment in OsIQD overexpressing plants;

[0028] A, Photographs of ZH11, OE-71, and OE-88 overexpressing plants before and after drought treatment; B, Survival statistics of OE-71 overexpressing plants after drought treatment; C, Survival statistics of OE-71 overexpressing plants after drought treatment (n=3); OsIQD overexpressing plants are more drought-tolerant than the wild-type control (ZH11). * indicates P < 0.05; ** indicates P < 0.01; *** indicates P < 0.001; **** indicates P < 0.0001. DETAILED DESCRIPTION

[0029] The following examples define the present invention and describe methods for constructing osiqd CRISPR mutants, cloning DNA fragments containing the complete coding region of the OsIQD gene, and validating OsIQD gene function. Based on the following description and these examples, one skilled in the art will be able to ascertain the essential features of the present invention and, without departing from the spirit and scope of the invention, will be able to make various changes and modifications to adapt the invention to various uses and conditions.

[0030] Example 1:

[0031] Construction of osiqd CRISPR mutants

[0032] The gene sequence of the OsIQD gene was obtained from the Rice Data database (http: / / www.ricedata.cn / gene / ). Two target sites were selected according to CRISPR-P v2.0 (http: / / crispr.hzau.edu.cn / CRISPR2 / ). The vector construction of the CRISPR mutant strain can refer to the relevant literature (Xie Kabin et al. Boosting CRISPR / Cas9 multiplex editing capability with the endogenous tRNA-processing system. PNAS, 2015, 112: 3570-3575). Due to space limitations, this specification will not be described in detail. The target sites selected from the CRISPR-Pv2.0 website are as follows:

[0033] Target site 1: GCTGCTCGTCAGCCGCACCA

[0034] Target site 2: ATACTCCTCCCGCTTGGCGG

[0035] The constructed CRISPR vector OsIQD-CRISPR was introduced into the rice variety "Zhonghua 11" (a publicly available rice variety provided by the China National Rice Research Institute) via Agrobacterium-mediated rice transformation (the specific steps are described below). Transgenic plants were obtained through pre-cultivation, infection, co-cultivation, selection of hygromycin-resistant calli, differentiation, rooting, seedling training, and transplanting. This Agrobacterium-mediated rice (Zhonghua 11) transformation method (system) was modified based on the method reported by Hiei et al. (Hiei et al., Efficient transformation of rice, Oryza sativa L., mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant J, 1994, 6:271-282).

[0036] Based on the above gene editing target sites, primers were designed to detect the editing status of the OsIQD gene in the mutants. The OsIQD gene was specifically amplified by PCR using primers (OsIQ D-CR-F: 5'-GCGTTTCACTGTTTCGGTT-3' and OsIQD-CR-R: 5'-CTTGGCTGGAGATGACACC-3'). The amplified PCR products were sequenced and tested for the presence of Cas9. The sequencing results showed that in the osiqd-1 CRISPR homozygous Cas9-free mutant family, the OsIQD gene had a 47-base deletion within the OsIQD gene, causing a frameshift and premature termination (the strain contains the sequence shown in SEQ ID NO.3). In the osiqd-2 CRISPR homozygous Cas9-free mutant family, the OsIQD gene had a 1-base deletion at the first target site and an 1-base insertion at the second target site, resulting in a frameshift and premature termination before the second target site (the strain contains the sequence shown in SEQ ID NO.4) ( Figure 1 A), indicating that the OsIQD gene in the two mutant families was mutated. The seeds were photographed with a camera, and the seed length and width values ​​were obtained using ImageJ. The thousand-grain weight was obtained by weighing three 1000 seeds. It can be seen that the seed length of the two families was significantly longer than that of ZH11 (n=30), the seed width was significantly smaller than that of ZH11 (n=30), and the thousand-grain weight was significantly smaller than that of ZH11 (n=3) ( Figure 1 (in BE).

[0037] Example 2:

[0038] Grain phenotype of OsIQD overexpressing plants

[0039] The OsIQD gene sequence was obtained from the Rice Data database (http: / / www.ricedata.cn / gene / ). Primers OE-IQD-F (5'-CCAAGCTTATGGGGTGGGCGTCC-3') and OE-IQD-R (5'-GGACTAGTGTACTTGACG GGCATGCC-3') were designed to amplify the rice OsIQD gene sequence. The amplified fragment was double-digested with HindIII and SpeI and ligated into the overexpression vector pRHV-GFP (UBQ promoter) and fused with a GFP tag. Finally, the correctly sequenced vector was electroporated into Agrobacterium tumefaciens competent cells EHA105, and positive clones were detected and stored.

[0040] The expression of OsIQD in rice seedlings was detected by real-time fluorescence quantitative PCR. Total protein was extracted from the plants and the GFP tag signal intensity was detected by Western blotting. It was found that the expression levels of OsIQD gene and protein in OE-71 and OE-88 lines were significantly increased ( Figure 2 The seeds were photographed with a camera, and the grain length and width values ​​were obtained using Image J. Statistical results showed that OsIQD overexpression significantly increased grain width and significantly shortened grain length. ( Figure 2 CE). By measuring the thousand-grain weight of the seeds using an analytical balance, it can be seen that the thousand-grain weight of the overexpressed rice increased significantly ( Figure 2 Middle F).

[0041] The Q-PCR reaction system was as follows: 2 μL cDNA (50 ng / μL), 5 μL Universal SYBR Green Supermix (Bio-Rad), 0.2 μL forward primer (FP, 10 μmol / L), 0.2 μL reverse primer (RP, 10 μmol / L), and ddH2O added to 10 μL. Using a Bio-Rad CFX96 Real-Time System, the reaction program was as follows: 95°C for 15 seconds, 60°C for 15 seconds, and 72°C for 30 seconds, for 40 cycles. Data were analyzed using the comparative Ct method. Primers for detecting the expression of OsIQD were OsIQD-qF (5'-GGTTCTCTGAAGGGGAGCTC-3') and OsIQD-qR (5'-AGTGGTGGTGATGGCTGC-3'); primers for detecting the internal reference gene actin7 were ACTIN1-QP-F (5'-ATGA GTAACCACGCTCCGTC-3') and ACTIN1-QP-R (5'-TTCAACCCCAAGGCCAATC-3').

[0042] Western blot (WB) analysis was performed as follows: Rice tissue was ground in liquid nitrogen. 0.100 g of powder was weighed using an analytical balance and 500 μL of extraction buffer (50 mmol / L Tris-HCl (pH 7.5), 150 mmol / L NaCl, 0.5% Trition X-100, 1 mmol / L phenyl methylsulfonyl fluoride) was added. The mixture was mixed and centrifuged at 12,000 g for 15 min at 4°C. The supernatant was aspirated into a new tube and centrifuged twice to obtain the total tissue protein. The samples were then stored at -20°C. Protein samples were denatured at high temperature and separated by electrophoresis on a 10%-12% SDS-PAGE gel. Proteins were transferred using a Bio-Rad Mini-Protean 3 electrophoresis tank and a Mini Trans-Blot electrophoresis system (wet transfer for high molecular weight proteins), respectively. For detailed procedures, refer to the product instructions. Western blotting was performed using Hybond-P PVDF (polyvinylidene difluoride membrane) membranes (Amersham) according to the manufacturer's instructions. Background was blocked for 3 hours with prehybridization in PBS containing 0.05% Tween-20 and 2.5% non-fatty milk. The membranes were then incubated with the primary antibody (ABclone GFP-tag) overnight at 4°C. After washing with TBST, the membranes were incubated with a secondary mouse antibody labeled with horseradish peroxidase (HRP) for 1-2 hours at room temperature. After washing with TBST, the membranes were added with developer (ABclone, see the manufacturer's instructions for details) for 30 seconds, exposed to light, developed, and photographed.

[0043] Example 3:

[0044] Identification of drought stress phenotypes of osiqd15 CRISPR mutants at the seedling stage

[0045] The mutant seeds (osiqd-1, osiqd-1) and wild-type seeds (ZH11: Zhonghua 11) with identified genotypes were germinated on dishes and then planted in small blue buckets. The soil used in the experiment was a mixture of paddy soil from southern China and coarse sand at a volume ratio of 2:3. An equal amount of uniform sand was added to each bucket with an equal volume of water. The water seeped out by itself to ensure the uniform compaction of the soil. The experiment was repeated three times. The healthy plants at the 4-leaf stage were deprived of water and subjected to drought stress for 6-10 days (the degree of drought stress was judged by the change in the hardness of the stems of the plants when pinched by hand during the drought treatment), and then rehydrated for 7-15 days (the surviving plants grew new leaves), and photographed and the survival rate of the osiqd mutant plants (osiqd-1, osiqd-1) was counted ( Figure 3Compared with wild-type controls, osiqd mutant plants showed drought sensitivity. ( Figure 3 Survival rate statistics of B and C: 24 wild-type plants (ZH11) and mutant plants (osiqd) were evenly planted on the left and right sides of the small blue bucket. The number of surviving plants after drought treatment and rewatering was compared with the total number of plants (24 plants). The statistical results showed that the survival rates of the wild-type plants (ZH11) on the left were 65.28% and 70.83%, respectively, and the survival rates of the mutant plants (osiqd) on the right were 38.89% and 40.28%, respectively.

[0046] Example 4:

[0047] Identification of drought stress phenotypes in OsIQD overexpressing plants at the seedling stage

[0048] Reference Example 3 for germination and transplanting of OsIQD overexpressing plants: 25-30 days old rice plants cultured in small blue buckets were photographed with a camera before drought treatment. Water was cut off for 6-10 days (depending on weather conditions), and then water was restored for 7-15 days (depending on the degree of drought stress). The survival rate of the overexpressing plants (OE-71, OE-88) was calculated ( Figure 4 Compared with the wild type, the two OsIQD overexpressing plants were more drought tolerant. Figure 4 Survival rate statistics of B and C: 24 wild-type plants (ZH11) and overexpression plants were evenly planted on the left and right sides of the small blue bucket. The number of surviving plants after drought treatment and rehydration was compared with the total number of plants (24 plants). The statistical results showed that the survival rates of the wild-type plants (ZH11) on the left were 15.28% and 16.67%, respectively, and the survival rates of the overexpression plants on the right were 44.45% and 40.28%, respectively.

Claims

1. QUR Application of genes in regulating rice grain shape, grain weight and / or drought resistance, QUR The protein encoded by the gene is shown in SEQ ID NO.

2.

2. The use according to claim 1, characterized in that: Improve rice QUR The expression level of the gene can be used to reduce the length-to-width ratio of rice grains, increase the thousand-grain weight of rice and / or enhance the drought resistance of rice.

3. The use according to claim 1, characterized in that: Reduce rice QUR The expression level of the gene can be used to increase the length-to-width ratio of rice grains, reduce rice grain weight and / or weaken the drought resistance of rice.

4. The use according to claim 3, characterized in that: Knockout, suppression or silencing in rice QUR Genes are used to increase the length-to-width ratio of rice grains, reduce rice grain weight, and / or weaken rice drought resistance.

5. The use according to claim 4, characterized in that: The knockout was performed using the CRISPR / Cas9 system, in which the target sites of gRNA were GCTGCTCGTCAGCCGCACCA and ATACTCCTCCCGCTTGGCGG.

6. The use according to claim 4, characterized in that: The rice edited by the CRISPR / Cas9 system has an increased length-to-width ratio of rice grains, a reduced 1000-grain weight, and / or weakened drought resistance, and comprises the polynucleotide shown in SEQ ID NO. 3 or SEQ ID NO.

4.

7. Rice QUR The application of genes in creating rice with reduced grain length-to-width ratio, increased grain weight and / or enhanced drought resistance, QUR The protein encoded by the gene is shown in SEQ ID NO.

2.

8. The application according to claim 7, wherein the application process comprises increasing the QUR Gene expression levels of substances are introduced into rice.

9. The use according to claim 8, wherein the substance contains QUR The nucleic acid molecule of the gene, or its expression cassette, recombinant vector, recombinant microorganism.

10. The use according to claim 9, wherein QUR The gene is shown as SEQ ID NO.1.

Images