WRN gene humanized vector and preparation method of non-human animal model
By using CRISPR/Cas9 technology to knock out and insert the human WRN gene sequence in non-human animals, the complexity of preparing the humanized WRN gene mouse model was solved, precise WRN protein expression in animals was achieved, and an efficient disease research and treatment model was provided.
Patent Information
- Application Number
- CN202510517092.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-23
- Publication Date
- 2025-09-05
AI Technical Summary
Existing technologies make it difficult to efficiently prepare humanized mouse models of the WRN gene. There are challenges such as gene length and structural complexity, functional expression fidelity, and genetic background influences, which lead to inaccurate research results.
A WRN gene knockout vector and a human WRN gene homologous recombination vector were designed. The WRN gene was knocked out in non-human animals using CRISPR/Cas9 technology and the human WRN gene sequence was inserted at a targeted site. A humanized model was constructed through ES cell culture and embryo injection.
It has achieved the precise expression of human WRN protein in non-human animals, avoiding mutations and ectopic expression caused by random gene insertion, providing a more accurate research model for aging-related diseases, and providing a testing platform for drug therapy and gene therapy.
Smart Images

Figure CN120591340A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of genetic engineering technology, and in particular to a method for preparing a WRN gene humanized vector and a non-human animal model. Background Art
[0002] Mouse models are important experimental tools in life science research, and genetic manipulation techniques play a key role in studying disease mechanisms, drug development, and gene function. In recent years, the rapid development of gene editing technologies (such as CRISPR / Cas9) has enabled researchers to efficiently and precisely edit the mouse genome, generating a variety of gene knockout, knockin, or humanized mouse models.
[0003] The WRN gene encodes a DNA helicase belonging to the RecQ helicase family, which is crucial for maintaining genome stability and repairing DNA damage. Mutations in the WRN gene are closely associated with Werner syndrome (WS), a rare autosomal recessive disorder characterized by premature aging and associated pathologies such as cancer, metabolic disorders, and cardiovascular disease. To investigate the function of the WRN gene and its associated disease mechanisms, the development of humanized WRN mouse models suitable for in vivo studies is crucial. In humanized knock-in models, human gene fragments are replaced with the endogenous mouse gene, allowing for a more realistic simulation of the physiological functions and pathological processes of specific human genes. The advantages of such models include: first, cross-species functional validation (by comparing the differences between human and mouse WRN genes, the conservation and specificity of their functions can be explored); second, disease modeling (humanized mice more closely resemble human pathological conditions and can be used to study disease mechanisms, screen drug targets, and conduct therapeutic research); and third, enhanced translational medical value (humanized models can better predict human response to treatment regimens). However, there are certain technical challenges in the preparation of WRN gene knock-in mice. The first is the length and structural complexity of the gene (the WRN gene is large, contains multiple exons and complex regulatory regions, and accurate knock-in requires efficient gene editing tools and precise design); the second is the fidelity of functional expression (it is necessary to ensure that the knocked-in human gene has normal expression and functional activity in the mouse body, and does not cause misregulation due to species differences); the third is the influence of genetic background (the knock-in gene may produce unknown interactions with other regions of the mouse genome, thereby affecting the reliability of the research results). Based on this, the development of an efficient and stable preparation method for constructing a humanized WRN gene knock-in mouse model is of great significance for studying aging-related diseases and exploring new treatment methods.
[0004] In view of this, the present invention is proposed. Summary of the Invention
[0005] The purpose of the present invention is to provide a WRN gene humanized vector and a method for preparing a non-human animal model, which can be used to prepare a WRN gene humanized non-human animal model.
[0006] In the first aspect of the present invention, a WRN gene humanization vector is provided, comprising: a WRN gene knockout vector and a human WRN gene homologous recombination vector, wherein the WRN gene knockout vector comprises an sgRNA sequence, and the sgRNA comprises a nucleotide sequence that is partially complementary to the WRN gene of a non-human animal; the human WRN gene homologous recombination vector comprises a nucleotide sequence encoding the entire human WRN protein.
[0007] Specifically, the complete human WRN protein sequence is shown in SEQ ID NO: 6.
[0008] Preferably, the sgRNA is shown as SEQ ID NO: 1 and / or SEQ ID NO: 2.
[0009] Preferably, the human WRN gene homologous recombination vector includes a nucleotide sequence encoding the entire human WRN protein.
[0010] Preferably, the nucleotide sequence encoding the entire human WRN protein is the cDNA of the human WRN gene, and the cDNA of the human WRN gene is shown in SEQ ID NO: 3.
[0011] Preferably, the human WRN gene homologous recombination vector further comprises a 5' homology arm and a 3' homology arm, the 5' homology arm sequence is shown in SEQ ID NO: 4, and the 3' homology arm sequence is shown in SEQ ID NO: 5.
[0012] Preferably, the human WRN gene homologous recombination vector further comprises a resistance gene expression cassette, and the drug selected by the resistance gene comprises any one of puromycin, hygromycin, blasticidin, and G418, more preferably puromycin.
[0013] Preferably, the human WRN gene homologous recombination vector comprises a 5' homology arm, a nucleotide sequence encoding the entire human WRN protein, a resistance gene expression cassette and a 3' homology arm arranged in sequence from the 5' end to the 3' end.
[0014] More preferably, the human WRN gene homologous recombination vector includes a 5' homologous arm, human WRN gene cDNA, bGH poly (A) signal, f1 ori, SV40 promoter, HygR, SV40 poly (A) signal and 3' homologous arm arranged in sequence from 5' end to 3' end.
[0015] Specifically, the bGH poly(A) signal sequence is shown in SEQ ID NO: 7, the f1 ori sequence is shown in SEQ ID NO: 8, the SV40 promoter sequence is shown in SEQ ID NO: 9, the HygR sequence is shown in SEQ ID NO: 10, and the SV40 poly(A) signal sequence is shown in SEQ ID NO: 11.
[0016] Preferably, the WRN gene knockout vector further comprises a vector backbone, and the vector backbone comprises any one of PX459, PX330, PX260, PX334, PX335, PX458, PX461, PX462, PX551 and PX552; more preferably, the vector backbone is PX459.
[0017] Preferably, the vector backbone PX459 sequence is SEQ ID NO: 12.
[0018] The second aspect of the present invention provides a method for preparing a WRN gene humanized non-human animal model, using the above-mentioned WRN gene humanization vector to introduce the nucleotide sequence encoding the entire human WRN protein into the endogenous WRN locus of the non-human animal.
[0019] In this section, the specific content of the WRN gene humanization vector is consistent with the above-mentioned WRN gene humanization vector, that is, the content of the WRN gene humanization vector in the first aspect of the present invention can be undoubtedly introduced into the preparation method of the WRN gene humanized non-human animal model in this section, and will not be repeated in this section.
[0020] Preferably, the nucleotide sequence encoding all the human WRN proteins is introduced into the endogenous WRN locus of non-human animals, and gene editing technology can be used to knock out the non-human animal WRN gene and simultaneously knock in the nucleotide sequence encoding all the human WRN proteins in situ. It will be appreciated by those skilled in the art that after knowing the efficient gene editing region (in this application for the non-human animal WRN gene), those skilled in the art can use any gene editing method, such as gene editing technology based on zinc finger nuclease, TALEN gene editing technology and CRISPR / Cas (such as CRISPR / Cas9) gene editing technology, as well as other gene editing methods discovered in the future, to edit the known efficient gene editing region, optimize gene editing conditions, and achieve the purpose of efficient editing. Therefore, the present application covers the technical solution of knocking out the non-human animal WRN gene identified in this application by any available gene editing method.
[0021] Preferably, the method for preparing a humanized non-human animal model of the WRN gene comprises the following steps:
[0022] The above-mentioned WRN gene humanization vector was introduced into ES cells;
[0023] Identify WRN gene humanization positive cells in ES cells;
[0024] The positive cells were monoclonally cultured, the monoclonal cells were collected for identification and screening, and the positive monoclonal cells were expanded and cultured to obtain the WRN gene humanized ES cell line;
[0025] The WRN gene humanized ES cells are injected into recipient embryos, and after the recipient embryos develop into blastocysts, they are transplanted into pseudo-pregnant mice to obtain a WRN gene humanized non-human animal model.
[0026] Preferably, the method further comprises the following step: mating the WRN gene humanized non-human animal model to obtain heterozygous or homozygous offspring.
[0027] Preferably, the non-human animal is a mouse.
[0028] The third aspect of the present invention provides a WRN gene humanized non-human animal model, which is obtained using the above-mentioned method for preparing the WRN gene humanized non-human animal model.
[0029] In a fourth aspect, the present invention provides a WRN gene humanized cell line and a preparation method thereof, comprising the following steps: introducing the above-mentioned WRN gene humanization vector into ES cells; identifying WN gene humanization-positive cells in the ES cells; monoclonal culture of the positive cells, collecting the monoclonal cells for identification and screening of positive monoclonal cells, and expanding the culture of the positive monoclonal cells to obtain the WRN gene humanized cell line.
[0030] The fifth aspect of the present invention provides a method for preparing a WRN gene humanized mouse model, using the above-mentioned WRN gene humanization vector to introduce the nucleotide sequence encoding the entire human WRN protein into the mouse endogenous WRN locus.
[0031] In this section, the specific content of the WRN gene humanization vector is consistent with the above-mentioned WRN gene humanization vector, that is, the content of the WRN gene humanization vector in the first aspect of the present invention can be undoubtedly introduced into the preparation method of the WRN gene humanized mouse model in this section, and will not be repeated in this section.
[0032] Preferably, the mouse WRN gene is disrupted by CRISPR / Cas9 technology, wherein the sgRNA used in the CRISPR / Cas9 technology targets the mouse WRN gene.
[0033] Preferably, the sgRNA used to target the mouse WRN gene is an sgRNA of the WRN gene obtained by screening and confirming the knockout efficiency using mouse cells. Specifically, the sgRNA used to target the mouse WRN gene is sgRNA1 shown in SEQ ID NO: 1 and / or sgRNA2 shown in SEQ ID NO: 2.
[0034] Preferably, screening the knockout efficiency using mouse cells includes the following steps: constructing the designed sgRNA into the PX459 vector and delivering it to mouse cells; screening with puromycin to obtain an sgRNA with high knockout efficiency as the sgRNA of the WRN gene obtained after screening and confirmation.
[0035] Preferably, the delivery is by liposome transfection. The specific operation of liposome transfection is known in the art.
[0036] Specifically, the method for preparing a WRN gene humanized mouse model includes the following steps:
[0037] (1) PX459-sgRNA1 and PX459-sgRNA2 were transfected into mouse cells, respectively. The sgRNA efficiency was identified by PCR, and the sgRNA with the highest knockout efficiency was selected.
[0038] (2) The mouse WRN gene knockout vector constructed with the sgRNA with the highest knockout efficiency and the human WRN gene homologous recombination vector were introduced into mouse ES cells, and after transfection, they were screened based on resistance gene drugs;
[0039] (3) Collect cells and identify the presence of WRN gene humanized positive cells through PCR;
[0040] (4) The positive cells were monoclonally cultured, the monoclonal cells were collected for PCR identification and screening of positive monoclonal ES cells, and the positive monoclonal cells were expanded and cultured to obtain WRN gene humanized ES cell lines;
[0041] (5) Injecting WRN gene humanized ES cells into recipient embryos of another strain of mice to obtain F0 generation chimeric mice;
[0042] (6) Crossbreeding F0 generation mice with wild mice from stem cell donors to obtain F1 generation heterozygous mice;
[0043] (7) The positive F1 generation mice were mated to obtain the F2 generation homozygous WRN gene humanized mouse model.
[0044] Preferably, the mouse cells are B16 cells (mouse melanoma cells).
[0045] Preferably, the mouse ES cells are derived from C57BL / 6N.
[0046] Preferably, the recipient embryo is a mouse eight-cell embryo.
[0047] Preferably, the injection is microinjection.
[0048] Preferably, the number of injected ES cells is 8-10.
[0049] In a sixth aspect, the present invention provides a WRN gene humanized mouse model, which is obtained using the above-mentioned method for preparing the WRN gene humanized mouse model.
[0050] In the seventh aspect of the present invention, a WRN gene humanized mouse cell line and a preparation method thereof are provided, comprising the following steps: introducing a mouse WRN gene knockout vector constructed with the sgRNA with the highest knockout efficiency and a human WRN gene homologous recombination vector into mouse ES cells, and screening according to resistance gene drugs after transfection; collecting cells and identifying by PCR whether there are WRN gene humanized positive cells; monoclonal culture of the positive cells, collecting monoclonal cells for PCR identification and screening of positive monoclonal ES cells, and expanding the culture of the positive monoclonal cells to obtain a WRN gene humanized mouse cell line.
[0051] In an eighth aspect, the present invention provides a cell, tissue or organ, wherein the cell, tissue or organ is derived from a non-human animal model obtained by the above-mentioned preparation method.
[0052] The ninth aspect of the present invention provides the use of the above-mentioned non-human animal models, WRN gene humanized cell lines, and cells, tissues or organs in model systems for pharmacology, neurology, immunology, microbiology and medical research.
[0053] The present invention has at least the following beneficial effects:
[0054] The technical solution of the present invention achieves the purpose of genetic humanization of non-human animals by designing two sgRNAs that specifically target the WRN gene of non-human animals, using Cas9 protein to knock out the non-human animal WRN gene, and then knocking in the nucleotide sequence encoding the entire human WRN protein through homology-directed repair. The non-human animal model constructed using this method can express human WRN protein in non-human animals, which can better simulate the physiological effects of human WRN protein and avoid mutations, ectopic expression and artificial overexpression caused by random insertion of exogenous genes. This is very important for studying the functions of certain dose-sensitive proteins. The WRN gene humanized non-human animal model provides a more accurate model for human aging-related biology and pathology, and provides a more accurate test model for the study of methods for slowing aging such as small molecule drug therapy, antibody therapy and gene therapy, which has great practical significance. BRIEF DESCRIPTION OF THE DRAWINGS
[0055] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the specific embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0056] Figure 1 These are the binding site and cleavage site of the BPiI enzyme provided by the present invention.
[0057] Figure 2 This is a diagram of the mouse WRN gene sgRNA knockout efficiency provided by the present invention.
[0058] Figure 3 Schematic diagram of the vector provided by the present invention.
[0059] Figure 4 This is the positive monoclonal identification of mouse ES cells provided by the present invention.
[0060] Figure 5 The present invention provides F0 and F1 generation mice.
[0061] Figure 6 This is the sequencing diagram of the F1 generation sperm of the WRN gene knock-in chimeric mouse provided by the present invention. DETAILED DESCRIPTION
[0062] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present application belongs.
[0063] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the present application. As used herein, unless the context clearly indicates otherwise, the singular also includes the plural. In addition, it should be understood that when the terms "comprise" and / or "include" are used in this specification, they indicate the presence of features, steps, operations, devices, components and / or combinations thereof.
[0064] Unless otherwise defined, technical and scientific terms used in this specification have the same meaning as those commonly understood by those skilled in the art. Although methods and materials similar or identical to those described herein may be used in experiments or practical applications, the materials and methods are described herein below. In the event of a conflict, the present specification, including definitions, will prevail. In addition, the materials, methods, and examples are provided for illustrative purposes only and are not intended to be limiting. The present application is further described below with reference to specific examples, which are not intended to limit the scope of this application.
[0065] definition
[0066] As used herein, the terms "polynucleotide," "nucleotide," "nucleotide sequence," "nucleic acid," and "oligonucleotide" are used interchangeably. They refer to a polymeric form of nucleotides (deoxyribonucleotides or ribonucleotides) of any length or their analogs. Examples of polynucleotides include, but are not limited to, coding or non-coding regions of genes or gene fragments, exons, introns, messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), short interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, DNA isolated from any sequence, RNA isolated from any sequence, nucleic acid probes, and primers. One or more nucleotides in a polynucleotide may be further modified. The sequence of nucleotides may be interrupted by non-nucleotide components. Polynucleotides may also be modified after polymerization, for example, by coupling with a labeling agent.
[0067] The term "CRISPR / Cas9" used in this article refers to an adaptive immune defense developed by bacteria and archaea over a long period of evolution to combat invading viruses and foreign DNA. CRISPR / Cas9 gene editing technology is a technique for making specific DNA modifications to targeted genes. CRISPR / Cas9-based gene editing technology has shown great promise in a range of gene therapy applications, such as blood disorders, tumors, and other genetic diseases. This technology has been applied to the precise modification of the genomes of human cells, zebrafish, mice, and bacteria.
[0068] As used herein, the terms "gRNA," "guide RNA," and "CRISPR guide sequence" are used interchangeably throughout and refer to nucleic acids comprising a sequence that determines the specificity of the Cas binding protein of the CRISPR / Cas system. The gRNA hybridizes (partially or fully complementary) to a target nucleic acid sequence in the genome of the host cell. The length of the gRNA or portion thereof that hybridizes to the target nucleic acid may be between 15-25 nucleotides, 18-22 nucleotides, or 19-21 nucleotides. In some embodiments, the length of the gRNA sequence that hybridizes to the target nucleic acid may be 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides. In some embodiments, the length of the gRNA sequence that hybridizes to the target nucleic acid is between 10-30 or 15-25 nucleotides.
[0069] The term "gRNA" as used herein generally refers to a single-molecule guide RNA or single-stranded guide RNA in the artificial CRISPR / Cas9 system, which refers to the RNA that guides the Cas protein to specifically bind to the target DNA sequence and is an important component of the CRISPR gene knockout / knock-in system. The gRNA of the present application comprises a guide sequence that targets the target sequence. In a preferred embodiment, the sgRNA of the present application further comprises a tracrRNA sequence and a crRNA sequence.
[0070] The term "guide sequence" as used herein refers to a sequence of approximately 17-20 bp that specifies a target site and is used interchangeably with "guide sequence" or "spacer." In the context of forming a CRISPR complex, a "target sequence" is a sequence to which a guide sequence is designed to be complementary, wherein hybridization between the target sequence and the guide sequence promotes the formation of a CRISPR complex. The hybridization requires that the "target sequence" and the "guide sequence" or "guide sequence" have sufficient complementarity to cause hybridization and promote the formation of a CRISPR complex; complete complementarity is not required.
[0071] "Complementary" means that the "guide sequence" or "guide sequence" and the target nucleotide sequence (the target knockout mouse WRN gene in this application) can hybridize through the nucleotide pairing principle discovered by Watson and Crick. It will be understood by those skilled in the art that as long as there is sufficient complementarity, the "guide sequence" can hybridize with the target nucleotide sequence without the need for 100% complete complementarity between them. In some embodiments, when optimally aligned using an appropriate alignment algorithm, the degree of complementarity between the guide sequence and its corresponding target sequence may be about or greater than about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more. Optimal alignment can be determined using any appropriate algorithm for aligning sequences, including the Smith-Waterman algorithm, the Needleman-Wimsch algorithm, an algorithm based on the Burrows-Wheeler Transform, and the like.
[0072] Typically, in the context of an endogenous CRISPR system, formation of a CRISPR complex (including hybridization of a guide sequence to a target sequence and complexing with one or more Cas proteins) results in cleavage of one or both strands in or near the target sequence (e.g., within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or more base pairs from the target sequence). Without wishing to be bound by theory, a tracr sequence that can comprise all or a portion of a wild-type tracr sequence (e.g., about or greater than about 20, 23, 26, 29, 32, 35, 38, 41, 44, 47, 50, 53, 56, 59, 62, 65, 70, 75, 80, 85, or more nucleotides of a wild-type tracr sequence) or consisting of the above can also form part of a CRISPR complex, for example, by hybridizing along at least a portion of the tracr sequence to all or a portion of a crRNA sequence operably linked to a guide sequence.
[0073] In some embodiments, the tracr sequence has sufficient complementarity with the crRNA sequence to hybridize and participate in the formation of the CRISPR complex. Similar to the hybridization of a "target sequence" and a "guide sequence" or "guide sequence", complete complementarity is not required, as long as it is sufficient to perform its function. In some embodiments, under optimal alignment, the tracr sequence has at least 50%, 60%, 70%, 80%, 90%, 95% or 99% complementarity along the length of the crRNA sequence.
[0074] As used herein, the term "gene knockout" or "knockout" refers to editing the gene in the cell (for example, inserting, replacing, and / or deleting the gene) so that the gene loses its original function (for example, it cannot express a functional protein). Various known molecular biology techniques can be used (for example, using gene editing technology based on zinc finger nucleases, TALEN gene editing technology, and CRISPR / Cas (such as CRISPR / Cas9) gene editing technology) to edit the gene in the cell genome. Gene knockout is not limited to the complete deletion or removal of the entire gene, as long as the gene loses its original function. For example, by inserting an exogenous DNA fragment in the gene, the gene cannot express a functional protein, or by inserting or deleting one or more bases in the gene, the gene is subjected to a frameshift mutation to achieve the knockout of the gene. For example, CRISPR / Cas9 gene editing technology can be used in the gene knockout of the present application.
[0075] The term "gene knock-in" or "knock-in" as used herein refers to the replacement of one gene with another gene by homologous recombination so as to determine in vivo whether they have the same function, or the introduction of normal genes into the genome to replace mutant genes in order to achieve the purpose of targeted gene therapy. Gene knock-in can be based on various known molecular biology techniques (for example, using zinc finger nuclease-based gene editing technology, TALEN gene editing technology and CRISPR / Cas (such as CRISPR / Cas9) gene editing technology) to change the gene sequence. For example, the gene knockout in the present application can use CRISPR / Cas9 gene editing technology. There are two types of gene knock-in, one is in situ knock-in, that is, inserting a new gene at the site of the original gene knockout, which is the reverse process of gene knockout; the other is site-directed knock-in, that is, no matter where the site of the knockout gene is, the knocked-in gene is under a specific promoter and transposed in the form of a transfer vector, so the insertion site is certain. For example, the gene knock-in in the present application can use in situ knock-in.
[0076] As used herein, the term "vector" refers to a nucleic acid delivery vehicle into which a polynucleotide can be inserted. When a vector is capable of expressing a protein encoded by the inserted polynucleotide, it is referred to as an expression vector. A vector can be introduced into a host cell via transformation, transduction, or transfection, allowing the genetic material it carries to be expressed in the host cell. Vectors are well known to those skilled in the art and include, but are not limited to, plasmids; phagemids; artificial chromosomes, such as yeast artificial chromosomes (YACs), bacterial artificial chromosomes (BACs), or P1-derived artificial chromosomes (PACs); bacteriophages, such as lambda phage or M13 phage, and animal viruses. Animal viruses that can be used as vectors include, but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpes viruses (such as herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, and papillomas (such as SV40). A vector can contain a variety of elements that control expression, including, but not limited to, promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. Additionally, a vector may contain an origin of replication.
[0077] As used herein, the term "delivery" refers to the introduction of biomacromolecules such as nucleic acids and proteins from outside the cell membrane into the cell membrane through certain pathways. Examples of "delivery" include electrofection, lipofection, lipid-nanoparticle delivery, viral delivery, and exosome delivery.
[0078] As used herein, the term "homologous arm" refers to a region on one DNA molecule where a gene sequence shares structural similarity with a gene sequence on another DNA molecule. Homologous arm design involves aligning the two endpoints of a target gene in an exogenous genome with the two endpoints of a plasmid vector for gene cloning.
[0079] As used herein, the term "expression cassette" is a vector used to express a specific gene, typically comprising components such as a promoter, a target gene, and a terminator. In genetic engineering, expression cassettes are widely used to construct expression vectors to achieve efficient expression of the target gene in recipient cells.
[0080] The following will clearly and completely describe the technical solutions of the present invention in conjunction with the embodiments. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.
[0081] Example
[0082] Instruments used in the experiment:
[0083] The equipment included a stereoscope (Olympus, SZX7), a 37°C 5% CO2 incubator (Sanyo, MCO15A), an inverted fluorescence microscope (Olympus, IX73), a hot stage (THERMOPLATE), an electroporator (BEX, CUY21 EDIT II), a ProFlex PCR System (Thermo Fisher, ProFlex 3×32well PCR system), a gel imager (BiO-RAD, Universal Hood II), an electrophoresis apparatus (BiO-RAD, PowerPacTM Basic), a CO2 constant temperature incubator (Rayward, D180-P), a constant temperature low-speed centrifuge (Eppendorf, 5702R), an inverted fluorescence microscope (Olympus, IX51), a constant temperature water bath (Shanghai Senxin, DKS24), a cell counter (Rayward, C100), and a double-person biological safety cabinet (Shandong Boco, BSC-1360IIA2).
[0084] Reagents used in the experiment:
[0085] BPiI (Thermo Fisher Scientific, ER0291), MinElute PCR Purification Kit (QIAGEN, 2084), T4 DNA Liaase kit (Solarbio, T1410), Phanta Max Super-Fidelity DNA Polymerase (Novozymes, P505), MinElute PCR Purification Kit (QIAGEN, Germany, 28004), AgeI (Western enzyme, SE1464S), Hyaluronidase (Nanjing Aibei, M2215), M2 culture medium (Sigma, M7167), Tissue culture oil (SAGE, ARF4008P-5P), Pregnant mare serum hormone PMSG (Ningbo Sansheng Biological), Human chorionic gonadotropin hCG (Ningbo Sansheng Biological), PBS solution (Solarbio, P1010), TSINGKE TSE030 T3 Super PCR Mix (TSINGKE, TSE030), Mini-prep Kit (TIANGEN, DP118), Agarose Rapid Gel Extraction Kit (Generay, GK7045-200), PCR Product Purification Kit (Generay, GK2052-100), 5 min TA / Blunt-Zero Cloning Kit (Novagene, C601), DMEM (Gibico, C11995500BT), Serum (Anwei, F0601), Penicillin-Streptomycin (Pusitang, PS0526), Transfection Reagent (Biyuntian, C0533), Puromycin (Gibico, A11138), Trypsin-EDTA (0.25%) (Thermo, 25200056), SpyCas9 NLS (NEB, M0646T).
[0086] 1. Construction of sgRNA expression plasmid
[0087] sgRNA design
[0088] Two sgRNAs were designed for knockout of the mouse WRN gene, namely sgRNA1 and sgRNA2.
[0089] The sequence of sgRNA1 is: TGGTTTAAGCCTTGTCCTTG (SEQ ID NO: 1);
[0090] The sequence of sgRNA2 is: CTTCACTACAGCGGAAATTT (SEQ ID NO: 2).
[0091] Using NCBI Primer-BLAST, a pair of primers was designed to amplify all sgRNAs. No non-specific bands were generated after amplifying the genome to be edited using these primers. The amplified products were subjected to 1% agarose gel electrophoresis and sequencing. No specific bands were detected by agarose gel electrophoresis. The PCR stock solution containing the target bands was sent to the company for sequencing. The test results showed that there were no single nucleotide mutations at the position of the sgRNA. The following sgRNA-F and sgRNA-R synthesized by Ruibo Company were mixed and annealed according to the procedure in Table 1 to form double-stranded sgRNAs with sticky ends; the PX459 vector was linearized using BPiI enzyme to generate sticky ends. The restriction sites and binding sites are as follows: Figure 1 The enzyme digestion system is shown in Table 2. The linearized PX459 vector with sticky ends and the double-stranded sgRNA with sticky ends were ligated according to the enzyme ligation system in Table 3. The ligation products were transformed, plated, and single clones were picked. Finally, bacterial liquid PCR was used to confirm that the vectors PX459-sgRNA1 and PX459-sgRNA2 were successfully constructed.
[0092] mWRN-sgRNA1F: CACCGTGGTTTAAGCCTTGTCCTTG (SEQ ID NO: 17); mWRN-sgRNA1R: AAACCAAGGACAAGGCTTAAACCAC (SEQ ID NO: 18).
[0093] mWRN-sgRNA2F: CACCGCTTCACTACAGCGGAAATTT (SEQ ID NO: 19); mWRN-sgRNA2R: AAACAAATTTCCGCTGTAGTGAAGC (SEQ ID NO: 20).
[0094] Table 1 sgRNA annealing program
[0095]
[0096] Table 2 PX459 vector enzyme digestion system
[0097]
[0098] Table 3 Enzyme-linked system
[0099]
[0100] 2. Efficiency evaluation of sgRNA expression plasmid
[0101] The PX459-sgRNA1 vector and the PX459-sgRNA2 vector were transfected into mouse melanoma cells (B16) respectively. After 48 hours, puromycin was added for selection and culture. After another 48 hours, the cells were extracted for PCR amplification and the PCR products were identified by 1% agarose gel electrophoresis. The results of vector efficiency identification are shown in Figure 2. Figure 2 As shown, sgRNA1 has higher knockout efficiency.
[0102] 3. Construction of linear donor for WRN gene targeting
[0103] First, the 5' and 3' homology arms for targeting were directly cloned from the mESCs genome, and the cDNA of the human WRN gene was cloned from the vector purchased by the company. The 5' homology arm (SEQ ID NO: 4), Human cDNA (SEQ ID NO: 3), bGH poly (A) signal (SEQ ID NO: 7), F1 ori (SEQ ID NO: 8), SV40 promoter (SEQ ID NO: 9), HygR (SEQ ID NO: 10), SV40 poly (A) signal (SEQ ID NO: 11) and 3' homology arm (SEQ ID NO: 5) were connected in the 5'-3' direction to form a linear donor for targeting ( Figure 3 ), the DNA was sequenced and identified, and the identification results showed that the WRN gene targeting linear donor was successfully constructed.
[0104] 4. Co-transfection of sgRNA expression plasmid and WRN gene targeting linear donor
[0105] sgRNA expression plasmids and a WRN gene-targeting linear donor were transiently transfected into ES cells via electroporation. The sgRNA expression plasmid guided Cas9 protein to cleave near the mouse WRN gene locus. The resulting double-strand break was repaired with high fidelity using the WRN gene-targeting linear donor plasmid as a template, replacing the mouse WRN gene cDNA with the human WRN gene cDNA to construct WRN gene-humanized ES cells. Hygromycin selection was added 48 hours after electroporation, and the cells were cultured for another 3 days. The selected cells maintained normal growth due to drug resistance, while the majority of cells in the control group died. Surviving transfected cells were identified by PCR. If they were correct WRN gene-humanized ES cells, agarose gel electrophoresis after PCR amplification showed that primer 1 amplified a portion of the left homology arm and a portion of the cDNA, a 1500-bp fragment, while primer 2 amplified a portion of the right homology arm and a portion of the cDNA, a 1500-bp fragment. Further sequencing confirmed the successful construction of WRN gene-humanized ES cells.
[0106] The upstream sequence of primer 1 is 5'-TACTGGGGATGGCAGGGCTCAA--3' (SEQ ID NO: 13), and the downstream sequence is 5'-CAGCACATCTTTTATTCTGC-3' (SEQ ID NO: 14); the upstream sequence of primer 2 is 5'-TAGCTAGAGCTTGGCGTAATC-3' (SEQ ID NO: 15), and the downstream sequence is 5'-CCCTTACCTAATGTCTTCAG-3' (SEQ ID NO: 16).
[0107] 5. Identification of positive monoclonal ES cells
[0108] The surviving transfected cells were seeded into 96-well plates by limiting dilution, and the monoclonal cells were propagated by passage and the genomic DNA of each clone was collected. If it was a positive monoclonal ES cell, when agarose gel electrophoresis was performed after PCR amplification, the fragment amplified by primer 1 was 1500 bp, and the fragment amplified by primer 2 was 1500 bp. The clones with the correct PCR product size were sequenced again, and 5 (1, 5, 6, 9, 10) positive monoclonal ES cells were obtained ( Figure 4 ).
[0109] 6. Microinjection of ES cells
[0110] Donor cells: Actively growing second-generation ES cells were digested into a single-cell suspension and placed at 4°C until ready for use. Recipient embryos: Adult female ICR mice were intraperitoneally injected with PMSG at 2:00 PM, followed by hCG 48 hours later. The mice were then cohabitated with male mice that evening. A vaginal plug was detected the next morning, marking the first day of fertilization. Blastocysts were flushed from the uterus and placed in an M2 droplet on day 3.5 of fertilization. Pseudopregnant mice: Adult female ICR mice were cohabitated with castrated male mice in a 1:1 ratio. A vaginal plug was detected the next day, marking the first day of pseudopregnancy. Injection and transplantation: ES cells and embryos were placed in an injection droplet. The embryos were aspirated with a fixed needle, and the ES cells were aspirated with an injection needle. A small hole was opened in the zona pellucida using a piezo. The injection needle was then inserted into the eight-cell droplet and the cells were injected. 8-10 stem cells were injected into each eight-cell droplet. After the eight-cell droplet developed into a blastocyst, the cells were transplanted into the uterus.
[0111] 7. Phenotypic and genotypic identification of chimeric mice
[0112] F0 generation chimeric mice have black and white skin. The F0 generation chimeric mice were mated with C57BL / 6J mice to determine whether the chimeric mice were germline chimeric mice. If the offspring mice were black, they were germline chimeric mice F1 ( Figure 5 ), F1 generation black mouse sperm was taken for PCR identification and gel electrophoresis, and the left part of the homology arm and part of the cDNA were amplified. The sequencing results showed that the F1 generation chimeric mouse sperm was successfully knocked in ( Figure 6 ).
[0113] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the above embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. A WRN gene humanization vector, characterized in that: include: A WRN gene knockout vector and a human WRN gene homologous recombination vector, wherein the WRN gene knockout vector comprises an sgRNA sequence, wherein the sgRNA comprises a nucleotide sequence that is partially complementary to a non-human animal WRN gene; and the human WRN gene homologous recombination vector comprises a nucleotide sequence encoding the entire human WRN protein.
2. The WRN gene humanization vector according to claim 1, characterized in that The sgRNA is shown as SEQ ID NO: 1 and / or SEQ ID NO:
2.
3. The WRN gene humanization vector according to claim 1, characterized in that The nucleotide sequence encoding the complete human WRN protein is shown in SEQ ID NO:
3.
4. The WRN gene humanization vector according to claim 1, characterized in that The human WRN gene homologous recombination vector further includes a 5' homology arm and a 3' homology arm. The sequence of the 5' homology arm is shown in SEQ ID NO: 4, and the sequence of the 3' homology arm is shown in SEQ ID NO:
5.
5. The WRN gene humanization vector according to claim 1, characterized in that The WRN gene knockout vector further includes a vector backbone, and the vector backbone includes any one of PX459, PX330, PX260, PX334, PX335, PX458, PX461, PX462, PX551 and PX552.
6. A method for preparing a humanized non-human animal model of the WRN gene, characterized in that: The WRN gene humanization vector according to any one of claims 1 to 5 is used to introduce the nucleotide sequence encoding the entire human WRN protein into the endogenous WRN locus of a non-human animal.
7. The method for preparing a humanized non-human animal model of the WRN gene according to claim 6, characterized in that: The steps include: Introducing the WRN gene humanization vector according to any one of claims 1 to 5 into ES cells; Identify WRN gene humanization positive cells in ES cells; The positive cells were monoclonally cultured, the monoclonal cells were collected for identification and screening, and the positive monoclonal cells were expanded and cultured to obtain the WRN gene humanized ES cell line; The WRN gene humanized ES cells are injected into recipient embryos, and after the recipient embryos develop into blastocysts, they are transplanted into pseudo-pregnant mice to obtain a WRN gene humanized non-human animal model.
8. The method for preparing a humanized non-human animal model of the WRN gene according to claim 7, characterized in that: The method further includes the following steps: mating the WRN gene humanized non-human animal model to obtain heterozygous or homozygous offspring.
9. A cell, tissue or organ, characterized in that: The cells, tissues or organs are derived from the non-human animal model obtained by the construction method according to any one of claims 6 to 8.
10. Use of the non-human animal model obtained by the method for preparing a WRN gene humanized non-human animal model according to any one of claims 6 to 8, and the cells, tissues or organs according to claim 9 in model systems for pharmacological, neurological, immunological, microbiological and medical research.
Citation Information
Patent Citations
Construction method for PD-1 gene modification humanization animal model and application of construction method
CN109666701A
Preparation method and application of humanized ACE2 gene modified mouse model
CN113355323A
Construction method and application of PSGL-1 humanized non-human animal model
CN114747541A
CCN2 gene humanized non-human animal as well as construction method and application thereof
CN116138217A
ANGPTL3 gene humanized non-human animal as well as construction method and application thereof
CN117384956A