Sheep TBXT gene editing method based on electrotransfection delivery pilot editing

Abstract

The invention discloses a sheep TBXT gene editing method based on electrotransfection delivery pilot editing, and belongs to the technical field of biology. The method comprises the following steps: delivering a substance for editing the TBXT gene into a fertilized egg of an animal by using an electroporation method, wherein the substance for editing the TBXT gene is a ribonucleic acid protein complex formed by a leading editing protein and RNA; the RNA is used for targeting the TBXT gene, and the RNA comprises pegRNA and / or sgRNA; the coding sequence of the TBXT gene is SEQ ID NO: 4. According to the method, the timeliness limitation that traditional microinjection depends on intracellular transcription translation is overcome, meanwhile, the exogenous DNA integration risk is eliminated, and the editing safety is remarkably improved.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to a sheep TBXT gene editing method based on electroporation-delivered lead editing. Background Art

[0002] As a core tool in modern molecular breeding and biomedical research, gene editing technology has undergone a significant transformation from extensive to precision. Traditional gene editing tools, such as the CRISPR-Cas9 system, trigger homologous recombination repair by inducing DNA double-strand breaks (DSBs). However, due to the stochastic nature of host cell repair pathways, these tools often suffer from technical bottlenecks such as insufficient editing precision and significant off-target effects. To overcome these limitations, base editing (BaseEditing) has emerged. By fusing the Cas9 nickase with a deaminase, BaseEditing enables specific base conversions, such as C→T or A→G, increasing editing precision to over 90%. However, this technology still has fundamental flaws: it can only cover four base substitution types and cannot achieve base transversions (e.g., G→C / T) or insertions / deletions. PrimeEditing, proposed in 2019, marked a paradigm shift in the field of gene editing: by integrating the Cas9 nickase (nCas9) with an engineered reverse transcriptase and leveraging the precise guidance of pegRNA (prime editing guide RNA), it enables arbitrary targeted base substitutions and small insertions and deletions without relying on DSBs. However, the practical application of this technology in large mammalian embryos (such as sheep) is still limited by key issues such as low delivery efficiency and insufficient embryonic developmental compatibility. The development of adaptable delivery systems and systematic optimization solutions is urgently needed.

[0003] As an important agricultural economic species and biomedical model, the genetic improvement of sheep has significant application value. Long-tailed sheep have many problems, including but not limited to: reduced mating success rate during the breeding season, hygienic problems such as maggot disease, and waste of feed resources due to excessive deposition of tail fat. Although the mechanical tail docking technique currently used in production can achieve phenotypic improvement, it faces problems such as postoperative infection, high labor and medical costs, and violations of animal welfare. Therefore, the development of a safer, more efficient and ethical sheep tail shape improvement technology is of great practical significance.

[0004] Currently, gene editing in sheep embryos primarily relies on microinjection or viral vector delivery of the CRISPR system, but these methods have significant drawbacks: microinjection is characterized by high operational complexity, high instrument costs, and a high risk of mechanical damage to the embryo, limiting its widespread application. While viral vectors (such as lentiviruses) can improve delivery efficiency, they carry safety risks such as the risk of random genomic integration and uncontrollable expression persistence. Furthermore, the large size and poor cell membrane permeability of sheep fertilized eggs result in extremely low transfection efficiency using traditional liposomes, severely limiting the application of complex systems such as prime editing. Therefore, developing an efficient, safe, and suitable gene editing technology for sheep embryos is crucial to rapidly improve tail shape and cultivate new strains with stable genetics. To address these technical challenges, the present invention explores a novel application of the PE system: using optimized electroporation technology to precisely deliver a complex of prime editor protein, precisely designed pegRNA, and nicking sgRNA into sheep fertilized eggs. Using embryo transfer, sheep strains with improved short-tail traits can be rapidly obtained. The standardized operation of this method significantly reduces dependence on technicians, lays an important foundation for the study of gene function and potential genetic improvement of sheep embryos, and demonstrates broad application potential. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a method for editing the TBXT gene in sheep based on electroporation of a lead editor. The technical problem to be solved is not limited to the technical subject matter described herein, and those skilled in the art will clearly understand other technical subjects not mentioned herein through the following description.

[0006] The TBXT gene (T-box transcription factor T) is a core regulator of vertebrate body axis development, and its expression directly influences embryonic somite formation and vertebra number. In sheep, specific single nucleotide polymorphisms (SNPs) in this gene are significantly positively correlated with caudal vertebra number.

[0007] In order to solve the above technical problems, the present invention provides the following technical solutions: The present invention provides a method for delivering a substance for editing a gene encoding a TBXT protein, comprising the following steps: delivering the substance for editing a gene encoding a TBXT protein into an animal fertilized egg by electroporation, wherein the substance for editing a gene encoding a TBXT protein is a ribonucleic acid-protein complex formed by a lead editing protein and RNA; the RNA targets the gene encoding the TBXT protein, and the RNA comprises pegRNA and / or sgRNA; and the TBXT protein is any one of the following proteins: A1) a protein having an amino acid sequence of SEQ ID NO: 4; A2) a protein obtained by substituting and / or deleting and / or adding amino acid residues from the amino acid sequence of A1) and having at least 85% identity with the protein and having the same function; A3) A fusion protein having the same function is obtained by connecting a tag to the N-terminus and / or C-terminus of the amino acids shown in A1) or A2).

[0008] The sequence of the coding gene of the TBXT gene is SEQ ID NO: 5.

[0009] In the above method, the lead editing protein is a prime editor protein, or abbreviated as PE protein.

[0010] The fertilized egg may be an in vitro fertilized egg.

[0011] In the above method, the reverse transcription template of the pegRNA includes a primer binding site and a reverse transcription template containing a target site editing sequence; In the above method, the primer binding site is nucleotides 108 to 119 of SEQ ID NO: 2; the nucleotide sequence of the target site editing sequence in the reverse transcription template is nucleotides 97 to 107 of SEQ ID NO: 2.

[0012] In the above method, the nucleotide sequence of the pegRNA is SEQ ID NO: 2.

[0013] In the above method, the sgRNA contains a single-guide RNA, and the nucleotide sequence of the single-guide RNA is positions 1 to 20 in SEQ ID NO: 3.

[0014] In the above method, the nucleotide sequence of the sgRNA is SEQ ID NO: 3.

[0015] In the above method, the mass ratio of the lead editing protein, pegRNA and sgRNA is (3.5-14):1:0.2.

[0016] In the above method, the ribonucleic acid-protein complex is obtained by mixing a lead editing protein solution, a pegRNA solution and an sgRNA solution, wherein the content of the lead editing protein in the lead editing protein solution is 5600-6000 ng / μl, the content of the pegRNA in the pegRNA solution used is 8000-12000 ng / μl, and the content of the NickingsgRNA in the sgRNA solution used is 8000-12000 ng / μl.

[0017] In the above method, the pegRNA solution consists of pegRNA and DEPC water. The nicking sgRNA solution consists of nicking sgRNA and DEPC water.

[0018] Lead editing protein solution: composed of lead editing protein and protein concentration buffer, the pH of the protein concentration buffer is 7.5, the solvent is water, and the composition of the protein concentration buffer is 50 mM Tris HCl, 300 mM KCl, and 10% glycerol.

[0019] In the above method, the lead editing protein is any of the following proteins: A1) a protein having an amino acid sequence of SEQ ID NO: 1; A2) a protein obtained by substituting and / or deleting and / or adding amino acid residues from the amino acid sequence of A1) and having at least 85% identity with the protein and having the same function; A3) A fusion protein having the same function is obtained by connecting a tag to the N-terminus and / or C-terminus of the amino acids shown in A1) or A2).

[0020] The tag protein includes but is not limited to: GST (glutathione sulfhydryltransferase) tag protein, His6 tag protein (His-tag), MBP (maltose binding protein) tag protein, Flag tag protein, SUMO tag protein, HA tag protein, Myc tag protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomeric red fluorescent protein) or AviTag tag protein.

[0021] Those skilled in the art can readily mutate the nucleotide sequences encoding the aforementioned proteins of the present invention using known methods, such as directed evolution or point mutagenesis. Artificially modified nucleotide sequences that are 75% or more identical to the nucleotide sequences of the aforementioned proteins isolated and prepared according to the present invention are derived from and are equivalent to the nucleotide sequences of the present invention, as long as they encode the aforementioned proteins and possess the aforementioned protein functions.

[0022] The aforementioned 75% or greater identity may be 80%, 85%, 90% or 95% or greater identity.

[0023] As used herein, identity refers to amino acid sequence or nucleotide sequence identity. Amino acid sequence identity can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, amino acid sequence identity can be calculated using Advanced BLAST 2.1 by using blastp as the program, setting the Expect value to 10, all filters to OFF, using BLOSUM62 as the matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values), respectively. The identity value (%) can then be obtained.

[0024] Herein, the greater than 80% identity may be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0025] The present invention also provides the use of the substance in the aforementioned method in any of the following: K1) Application in making animals with short or docked tails; K2) Use in the preparation of substances for making animals with short or docked tails.

[0026] In the above application, the animal is an animal containing the TBXT gene, and the animal may specifically be a sheep.

[0027] The present invention also provides a method for preparing a gene-edited fertilized egg, wherein the gene-edited fertilized egg is obtained by delivering a gene-editing substance into an animal's fertilized egg using electroporation. The gene-editing substance is a ribonucleic acid-protein complex formed by a lead editing protein and RNA; the RNA includes pegRNA and / or sgRNA, and the lead editing protein, pegRNA, or sgRNA is the aforementioned lead editing protein, pegRNA, or sgRNA. The sequence of the gene encoding the TBXT gene is SEQ ID NO: 5.

[0028] The above method specifically includes the following steps: S1. Construction of a prokaryotic expression vector for the PE protein: Using molecular cloning methods, appropriate double restriction enzyme sites were introduced into the pCMV-PE2 plasmid (Addgene, 132775) via circular polymerase chain reaction (PCR). Both the pET-28a vector and the pCMV-PE2 plasmid were then treated with the same double restriction enzyme sites, and the PE2 fragment was cloned into the pET-28a vector using T4 ligase. Following optimization of the purification steps, a 10x-his tag was added to the 3' end of the expression vector. This vector, named pET-PE-10his, was used for subsequent protein purification.

[0029] S2. Purification of PE Protein: The pET-PE-10his vector was transformed into the E. coli expression strain Rosetta (DE3) via heat shock. Protein was enriched and purified using an optimized nickel column to obtain a high-concentration, high-purity final PE protein.

[0030] S3. In vitro transcription and synthesis of pegRNA: Specific pegRNA was designed using the pegFinder online website. Subsequently, a pegRNA expression vector was constructed through molecular cloning, specifically designed to fully match the target gene. Using the previously constructed pegRNA expression vector as a template, a linearized in vitro transcription template was amplified by PCR. RNA synthesis was performed using the T7 RNA polymerase in vitro transcription system (Novozymes, TR101-01 / 02). After DNase I digestion to remove the DNA template, the transcript was extracted with acidic phenol-chloroform and precipitated with isopropanol to obtain a high-purity pegRNA product.

[0031] S4. Electroporation of Sheep Embryos with RNP Complexes: Add the room-temperature co-incubated RNP complexes to an equal volume of Opti-MEM to form the electroporation material. The final concentration of PE protein is 1400-1500 ng / μl, and the pegRNA concentration is 200-300 ng / μl. Optimized electroporation parameters are used to deliver the electroporation material into the sheep embryo. After electroporation, the cleavage rate and blastocyst rate of the electroporated and embryo groups are monitored to determine the optimal voltage intensity.

[0032] Preferably, the distance between electrodes used for electroporation is 2 mm.

[0033] Preferably, the electroporation parameters are: 60 V perforation voltage, 2-3 ms duration, 3 pulses, 100 ms interval, and unipolarity.

[0034] Preferably, the number of sheep fertilized eggs used for each electroporation is 50 or less.

[0035] S5. Characterization of gene editing efficiency: Electroporated sheep embryos were cultured in IVC medium for 7 days. Individual embryos were collected as independent samples, and the target gene fragments were amplified by nested PCR. The gene editing efficiency of the sheep embryos was characterized by Sanger sequencing.

[0036] Compared with the prior art, the present invention has the following beneficial effects: First, the electroporation-based PE protein direct delivery mechanism enables transient activation of the gene editing reaction, overcoming the time-sensitive nature of traditional microinjection, which relies on intracellular transcription and translation. It also eliminates the risk of exogenous DNA integration, significantly improving editing safety. Second, the specific pegRNA (SEQ ID NO. 2) and nicking sgRNA (SEQ ID NO. 3) designed in this invention efficiently mediate dual-site editing at c.333G>C and c.334G>T in the TBXT gene, inducing embryonic tail vertebrae developmental arrest and providing a molecular basis for establishing a novel short-tailed sheep breeding system. This standardized operational process (less than 15 minutes) is particularly suitable for livestock production. It not only establishes a technical paradigm for gene function analysis and trait improvement in sheep, but also provides a scalable solution for precision breeding of large commercial animals such as cattle and pigs. This molecularly designed breeding strategy not only reduces breeding costs but also provides an ethical and sustainable improvement solution for the livestock industry by preventing the vertical transmission of the long-tail trait. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 This is the map of the PE protein prokaryotic expression vector.

[0038] Figure 2 To detect the expression level of each PE protein expression vector.

[0039] Figure 3 Solubility assays for various PE protein expression vectors. Figures a, b, c, and d show preliminary solubility assays for proteins expressed using the pET-his-PE-his, pET-his-PE, pET-PE-6his, and pET-PE-10his vectors, respectively.

[0040] Figure 4 To optimize the induction expression conditions. Figure a shows the effect of different temperatures on PE protein expression, and Figure b shows the effect of different induction times on PE protein expression at induction temperatures of 25°C and 30°C.

[0041] Figure 5Figures a, b, and c show nickel column enrichment of PE protein expression. Figures a, b, and c show nickel column enrichment of soluble proteins from pET-his-PE-his, pET-PE-6his, and pET-PE-10his vectors after induction at 20°C for 18 hours.

[0042] Figure 6 Figure a is the map of the pET-PE-10his vector, and figure b is the SDS-PAGE gel image of the PE protein after final purification.

[0043] Figure 7 The figure shows the agarose gel electrophoresis results of in vitro transcribed pegRNA and nicking sgRNA.

[0044] Figure 8 It is a flow chart of the present invention.

[0045] Figure 9 The real-time status of sheep embryos in the electroporation groups at different voltages and the control group.

[0046] Figure 10 Figures of embryos after electric shocks at different voltages.

[0047] Figure 11 This is a bar graph showing the effect of the ratio of PE protein to pegRNA mass concentration on editing efficiency. Figure 12 The figure shows the Sanger sequencing graph and gene editing efficiency statistics of site-specific gene editing in sheep embryos using the present invention. DETAILED DESCRIPTION

[0048] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0049] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0050] The quantitative experiments in the following examples were all performed with three independent biological replicates, and the experimental data were expressed as mean ± standard error (mean ± SEM).

[0051] The data in the following examples were processed using GraphPad Prism 8 statistical software. The experimental results were expressed as mean ± standard deviation and tested using One-way ANOVA. P < 0.05 (*) indicated a significant difference.

[0052] Example 1: Gene Editing Method Using Purified PE Protein to Electroporate Sheep Embryos 1. Construction of PE protein prokaryotic expression vector Considering the large molecular weight of PE protein (about 260 kDa), the following problems exist during the purification process: fewer His tags may not ensure its effective binding on the Ni column, while too many His tags may affect the soluble expression of the protein. In addition, the positioning of the His tag at the N-terminus or C-terminus may also have different effects on the expression level and solubility of the protein. In order to systematically evaluate these factors, this study constructed multiple recombinant plasmids, named pET-his-PE, pET-PE-8his, pET-PE-10his, pET-PE-16his and pET-his-PE-his, to test the effects of different His tag numbers and positions on the expression level and soluble expression of PE protein. The plasmid maps of each plasmid are shown in Figure 2. Figure 1 shown.

[0053] The preparation method of pET-PE-10his is as follows: using pET28a vector as the backbone, the pCMV-PE2 vector (Addgene: 132775) was constructed into the pET28a vector by molecular cloning: the molecular cloning conjugate was transformed into DH5α competent cells, cultured at 37°C overnight, and a single clone was picked for sequencing the next day. The bacterial liquid with the correct sequencing results was expanded and the plasmid was extracted to obtain the final PE2 protein prokaryotic expression vector: pET-PE-10his (the vector results are as shown in Figure 1 (As shown in the left figure in the figure), its sequence is shown in the nucleotide sequence of pET-PE-10his in the "Sequences in the Examples Above" below. Nucleotides 443 to 6715 in the nucleotide sequence of pET-PE-10his are the gene encoding the PE protein, and the amino acid sequence encoded by this gene is the protein of SEQ ID NO: 1. Nucleotides 6770 to 6799 in the nucleotide sequence of pET-PE-10his encode 10his.

[0054] The construction methods of pET-his-PE, pET-PE-8his, pET-PE-16his and pET-his-PE-his plasmids refer to the pET-PE-10his plasmid.

[0055] After the constructed plasmids were transformed, single clones were selected and colony PCR was performed. After the ligation was correct, they were sent to the company for sequencing. The vectors with correct sequencing were transformed into the E. coli expression strain Rosetta (DE3) by heat shock method. Then, the transformed clones of each vector were subjected to preliminary induced expression experiments. The experimental results showed that ( Figure 2 All recombinant vectors successfully expressed the target protein under the conditions of 37°C, 190 rpm, and 1 mM IPTG induction for 4 hours. However, the protein expression level of the pET-PE-16his vector was significantly lower than that of the other vectors. Therefore, this vector was excluded from subsequent protein purification experiments.

[0056] Subsequently, a preliminary solubility analysis was performed on the proteins expressed by the four vectors pET-his-PE, pET-PE-8his, pET-PE-10his, and pET-his-PE-his. The induced bacterial solution was disrupted by ultrasonication and then subjected to ultracentrifugation to separate the supernatant and precipitate. The resulting samples were analyzed by SDS-PAGE. The results showed (see Figure 3 ), all recombinant vectors expressed target proteins that were soluble. However, the expression level of soluble protein in the supernatant of the pET-his-PE vector was significantly lower than that of the other groups, so this vector was not used for subsequent protein purification experiments. The remaining vectors will be further purified to identify the highest-quality PE protein expression vectors.

[0057] Since the protein expression in the supernatant was insufficient, the induction temperature and induction time were optimized to increase the expression. The induction temperature was set at 16°C, 18°C, 20°C, 30°C, and 37°C, and the concentration of the inducer IPTG was fixed at 0.5mM. After 8 hours of induction, the whole cell culture samples before and after induction were collected for SDS-PAGE analysis. The results show (see Figure 3-3 a) The protein expression levels at 20°C and 30°C were significantly higher than those at other temperature groups. Therefore, the cells were further induced with 0.5 mM IPTG at 20°C and 30°C for 8, 10, 14, and 18 hours, respectively. The whole cell suspension samples after induction were analyzed by SDS-PAGE. The results showed that (see Figure 4 ), when induced at 20°C for 18 hours, the protein expression level was significantly higher than that of the other condition groups. Ultimately, 20°C and 18 hours of induction time were determined to be the optimal induction conditions for PE protein expression.

[0058] Final purification of PE protein: After determining the optimal induction conditions, the three selected recombinant vectors were transformed into the Rosatte (DE3) strain and protein expression was performed under the same induction expression conditions. The cultured bacterial liquid was ultrasonically disrupted and ultracentrifuged, and the supernatant was collected and purified using a nickel affinity column. First, the pET-his-PE-his vector had the highest protein expression level in the supernatant, so it was purified first. However, the results showed (e.g. Figure 4 ), although the supernatant expression level of this vector is the highest, due to the structural instability of the linker region of the PE protein, it is easy to break during the expression process. In addition, the protein is designed to retain the His tag at both the N-terminus and the C-terminus, resulting in the nCas9 fragment (carrying the N-terminal His tag) and the MLV reverse transcriptase fragment (carrying the C-terminal His tag) generated by the breakage being able to bind to the nickel column, and thus the complete PE protein cannot be obtained by gradient elution separation. Therefore, considering that the protein bound to the nickel column with the C-terminal His tag is a complete protein, the pET-PE-6his vector with a higher expression level in the supernatant was purified next. The results show (as shown in Figure 4 Although the protein expressed in this vector was high in the supernatant, the large molecular weight of the PE protein resulted in a weak binding affinity between the 6xHis tag and the nickel column, leading to significant loss of the target protein during the wash process. Based on this, the pET-PE-10his vector was further purified. The addition of the C-terminal His tag significantly enhanced the protein's binding to the nickel column. The final results (e.g., Figure 5 ), after washing steps, pure and high-yield PE protein was obtained.

[0059] 2. Purification of PE protein The pET-PE-10his vector was transformed into the E. coli expression strain Rosetta (DE3). Through multiple experimental trials, the induction expression conditions for the PE protein were optimized: 20°C induction temperature, 18 hours induction time, and 0.5 mM IPTG concentration. Subsequently, the bacterial strain was expanded for induction and purification. A high-concentration, high-purity PE final protein was obtained (test results are shown in Figure 2). Figure 6 The protein is shown in the middle right figure, with a size of approximately 250 kDa) and stored at -80°C.

[0060] 3. In vitro transcription of PegRNA For the gene selected in this example, the TBXT gene, the corresponding pegRNA was designed, and the primers for each part were synthesized. The DNA fragment (SEQ ID NO: 2) obtained after annealing was inserted into the BsaI restriction site of the PegRNA expression vector (Addgene, 132777). Subsequently, high-concentration and high-purity pegRNA was obtained by in vitro transcription (T7 RNA polymerase in vitro transcription system (Novozymes, TR101-01 / 02)) and stored at -80°C.

[0061] The sequence of the pegRNA used in the present invention (SEQ ID NO: 2) is: 5'-AACGGGGAGTGGGTGCCGGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCGCTTGCCCCAGGGCACCCACTCCGAATAAATCGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAA-3', (the corresponding RNA sequence is 5'-AACGGGGAGUGGGUGCCGGGGUUUU AGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCGCUUGCCCCAGGGCACCCACUCCGAAUAAAUCGCGGUUCUAUCUAGUUACGCGUUAAACCAACUAGAA-3'), wherein nucleotides 97 to 107 are the reverse transcription template (RTT) containing the target site editing sequence, which is used to replace nucleotides 1125 to 1135 of the nucleotide sequence of the TBXT gene (i.e., Gene ID: 101114280 (https: / / www.ncbi.nlm.nih.gov / gene / 101114280) (nucleotides 8882068 to 88882078)); positions 108 to 119 are the sequence of the primer binding site (PBS), which is identical to nucleotides 88882079 to 88882090 of the TBXT gene (Gene ID: 101114280 (https: / / www.ncbi.nlm.nih.gov / gene / 101114280) and is reverse complementary to nucleotides 312 to 332 of SEQ ID NO: 5; A corresponding nicking sgRNA was designed for the sheep TBXT gene. The primers for each part were synthesized and the resulting DNA fragment (SEQ ID NO: 3) was annealed and inserted into the BbsI restriction site of an expression vector (Addgene, 51133). Subsequently, high-concentration and high-purity pegRNA and nicking sgRNA were obtained by in vitro transcription using the T7 RNA polymerase in vitro transcription system (Novozymes, TR101-01 / 02) and stored at -80°C.

[0062] The sequence of the nicking sgRNA used in the present invention (SEQ ID NO: 3) is: 5'-CCCCGAAGTTGGGGGAGTCGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC-3' (the corresponding RNA sequence is as follows: 5'-CCCCGAAGUUGGGGGAGUCGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC-3'). Positions 1 to 20 are the target sequence of the single-guide RNA (sgRNA) (reverse complementary to nucleotides 381-400 of SEQ ID NO: 5), which is identical to nucleotides 88882011 to 88882030 of the TBXT gene Gene ID: 101114280 (https: / / www.ncbi.nlm.nih.gov / gene / 101114280).

[0063] The electrophoresis results of pegRNA and Nicking sgRNA are as follows Figure 7 As shown, the marker is a full-strength gold 100bp DNA ladder (Cat. No. BM301-01).

[0064] IV. Production Methods of Sheep Fertilized Eggs The oocyte in vitro maturation medium (IVM medium) contained Medium 199 (10X) 10 mL (Gibco, 11825015), 0.4 g / L NaHCO3, 0.1 g / L glutamine, 0.03 g / L sodium pyruvate, 0.15 IU FSH (follicle-stimulating hormone, CAS number: 9002-68-0), 0.15 IU LH (luteinizing hormone, CAS number: 39341-83-8), 1 μg / mL E2 (estradiol), 100 mL / L fetal bovine serum (purchased from Cellmax, product number SA211.02), and 10 mL / L penicillin-streptomycin (purchased from Gibco, product number 15140122).

[0065] The composition of each 100 mL of in vitro fertilization fluid (IVF fluid) is as follows: NaCl 0.6542 g, KCl 0.0555 g, KH2PO4 0.0168 g, MgSO4·7H2O 0.0189 g, sodium pyruvate 0.0036 g, CaCl2·2H2O 0.0374 g, sodium lactate 0.0128 mL, 2% estrus sheep serum and 1% penicillin-streptomycin, and the rest is ultrapure water.

[0066] First, fresh adult ewe ovaries were obtained from a sheep slaughterhouse, placed in 37°C saline, and brought back to the laboratory in a thermos. Upon arrival, the ovaries were sterilized by spraying the surface with 75% alcohol and then rinsed three times with warm saline for further cleaning. The cleaned ovaries were then immersed in 37°C saline until ready for use. Subsequently, 2 mL of oocyte aspiration fluid was drawn up using a 10 mL syringe, and cumulus ovarian-oocyte complexes (COCs) were obtained by aspirating follicles. COCs with good morphology were selected under a microscope and washed three times with oocyte washing solution and then with in vitro fertilization (IVM) solution. After washing, the COCs were randomly transferred into a four-well plate containing maturation medium and incubated in a 5% CO2, 38.5°C incubator for 22–26 hours to complete in vitro maturation.

[0067] Sperm Capacitation: Remove the frozen semen from the liquid nitrogen and thaw rapidly in a 39°C water bath. Then, aspirate the semen and slowly add it to the bottom of the sperm upstream tube containing the fertilization solution. Place the sperm upstream tube in a 5% CO2, 38.5°C incubator for 25 minutes. Then, use a pipette to slowly aspirate the clear semen on top for later use.

[0068] In vitro fertilization: After in vitro maturation, COCs are removed and the cumulus granulosa cells are digested with 2% hyaluronidase to ensure complete detachment. Subsequently, the COCs are washed three times with in vitro fertilization solution and transferred to a four-well plate containing fertilization solution. Based on semen density and motility, an appropriate amount of upstream semen is added to the four-well plate. Sperm motility is assessed under a stereomicroscope by observing whether the oocytes can be gently pushed by sperm. Finally, the four-well plate containing the oocytes and semen is placed in a 5% CO2, 38.5°C incubator for in vitro fertilization.

[0069] 5. Electroporation of RNP Complexes in Sheep Embryos pegRNA solution: Consists of pegRNA and DEPC water, with a pegRNA concentration of 8000-12000 ng / μl. DEPC water was purchased from Beyotime (Cat. No. R0022).

[0070] Prime editing protein solution: Prepared by ultrafiltration and concentration of the PE protein prepared in "II. Purification of PE Protein" into a protein concentration buffer. The prime editing protein concentration is 4500-6000 ng / μl. The pH of the protein concentration buffer is 7.5, and the solvent is water. The composition of the protein concentration buffer is 50 mM Tris HCl, 300 mM KCl, and 10% glycerol.

[0071] Nicking sgRNA solution: This solution consists of pegRNA and DEPC water, with a pegRNA concentration of 8,000–12,000 ng / μl. DEPC water was purchased from Beyotime (Cat. No. R0022).

[0072] IVC medium: The composition of each liter of embryonic in vitro culture medium (IVC medium) is as follows: NaCl 6.542 g, KCl 0.555 g, KH2PO4 0.168 g, MgSO4·7H2O 0.189 g, sodium pyruvate 0.036 g, CaCl2·2H2O 0.374 g, sodium lactate 0.128 mL, 2% essential amino acids (Sigma, B6766), 1% nonessential amino acids (Sigma, M7145), 8 mg / mL BSA and 1% penicillin-streptomycin (purchased from Gibco, product number 15140122). The remainder is ultrapure water.

[0073] The experiment was repeated three times, and each repetition was as follows: 3.5:1 group (i.e. Figure 6The 3.5 μg in the figure refers to a 3.5:1 ratio of lead editing protein to pegRNA): First, 10 μg pegRNA, 2 μg Nicking sgRNA, and 35 μg lead editing protein were thoroughly mixed and incubated at room temperature for 10 minutes to form a stable RNP (ribonucleoprotein) complex. Subsequently, an equal volume of Opti-MEM solution was added to the reaction system, mixed well, and the final electroporation material was prepared. The granulosa cells of sheep (fertilized eggs) 6 hours after in vitro fertilization were removed and transferred to the opti-MEM solution. The electroporation material was added to the prepared electroporation cup (BTX, 45-0135, 2 mm spacing), and the embryos were transferred to the electroporation cup, with approximately 50 fertilized eggs placed at a time. Electroporation was performed using a BTX ECM830 electroporator. Electroporation parameters were set to specific perforation voltages (divided into four groups: control (0V), 50V, 60V, and 70V) for each experimental group. All other conditions remained the same (electroporator parameters): pulse duration 2-3 ms; pulse frequency 3; pulse interval 100 ms; unipolar pulses. Following electroporation, embryos were immediately assessed and transferred to IVC medium to observe subsequent cleavage and development.

[0074] After electroporation, embryos were collected and placed in 10 μL of ddH2O. The embryos were lysed by repeated freeze-thaw cycles. Nested PCR amplification was performed using the embryo lysate as a template. Nested PCR involves two rounds of amplification reactions. After completion, the products were detected by agarose gel electrophoresis. Samples with clear bands and no nonspecific amplification were sent to a biotechnology company for Sanger sequencing analysis.

[0075] 5:1 group (i.e. Figure 11 The 5 μg in the above formula refers to a 5:1 ratio of lead editing protein to pegRNA): 50 μg of PE protein was used to replace the 35 μg of PE protein in the 3.5:1 group, and the rest of the procedures were the same as those for the 3.5:1 group.

[0076] 7:1 group (i.e. Figure 11 The 7 μg in the above formula refers to a 7:1 ratio of lead editing protein to pegRNA): 70 μg of PE protein was used to replace the 35 μg of PE protein in the 3.5:1 group, and the rest of the procedures were the same as those for the 3.5:1 group.

[0077] 14:1 group (i.e. Figure 11 The 14 μg in the above formula refers to a 14:1 ratio of lead editing protein to pegRNA): 140 μg of PE protein was used to replace the 35 μg of PE protein in the 3.5:1 group, and the rest of the procedures were the same as those in the 3.5:1 group.

[0078] The results are as follows Figure 9 and Figure 10 As shown in the figure, under the condition of applying 70V voltage, the embryos were significantly damaged, mainly manifested by large-scale loss of embryonic cytoplasm, with only the zona pellucida remaining; in contrast, the embryos applied with 60V and 50V voltages were in relatively good condition during real-time observation.

[0079] Further statistical analysis results (see Table 1) showed that the cleavage rate of embryos subjected to 70 V voltage was significantly decreased compared with the control group ( P <0.05), indicating that 70 V had a significant adverse effect on embryonic development. However, the differences in cleavage and blastocyst rates between embryos subjected to 60 V and 50 V compared to the control group did not reach statistical significance (P>0.05). Based on these results, and the high molecular weight of PE protein, and to ensure the quality of embryo development under experimental conditions and the reliability of subsequent experiments, the present invention selected 60 V as the optimal voltage for electroshock of sheep embryos, assuming the embryos were in good condition after electroshock.

[0080] Table 1. Effects of electroporation conditions on sheep embryo development in vitro

[0081] Cleavage rate = number of cleavage embryos / number of oocytes 48 hours after IVF; blastocyst rate = number of blastocysts / number of cleavage embryos. Results are expressed as (%, means ± SEM). Experiments were performed in triplicate. Results in the same column with different superscript letters (a, b) indicate significant differences (P < 0.05).

[0082] The peak graph obtained by Sanger sequencing is considered to be successful if the expected peak graph characteristics appear within the target base segment. Figure 12 As shown in Table 2, the method provided by the present invention achieved precise base mutations of c.333G>C and c.334G>T in sheep fertilized eggs TBXT. The statistical results are shown in Table 2, with an average gene editing efficiency of 29.94%.

[0083] Table 2. Editing rates of sheep embryos in vitro at different RNP ratios

[0084] Editing rate = number of edited embryos / total number of embryos. Results are expressed as (%, means ± SEM). Experiments were performed in triplicate.

[0085] The present invention constructs RNPs of purified PE protein and customized pegRNA / nicking sgRNA to implement electroporation gene editing in sheep embryos, achieving efficient editing. Compared with traditional microinjection methods, this method is simple to operate and significantly improves gene editing efficiency. Through specific sequence design for the TBXT gene, the highest editing efficiency reached 29.94±0.15%, providing an innovative method for breeding new sheep strains with stable hereditary short-tail traits. This technological advancement has promoted the promotion and application of guide editing in large animal gene editing and has broad application prospects.

[0086] The above examples involve the following sequences: SEQ ID NO: 1 (PE protein): The pET-PE-10his vector sequence constructed in the present invention is:

[0087] SEQ ID NO:4 (TBXT amino acid) MTSPGTDSPGKSLQYRVDHLLSAVESELQAGSEKGDPTERELRVGLEESELWLRFKELTNEMIVTKNGRRMFPVLKVNVSGLDPNAMYSFLLDFVAADNHRWKYVNGEWVPGGKPEPQAPSCVYIHPDSPNFGAHWMKAPVSFSKVKLTNKLNGGGQIMLNSLHKYEPRIHIVRVGGPQRMITSHCFPETQFIAVTAYQNEEITALKIKYNPFAKAFLDAKERSDHKEMMEEAGDSQQPGYSQSGGWLIPGTSSLCPPATPHPQFGGPLSLPSTHGCERFPALRSHRPAPYPSPYAHRNSSPTYSDSSSACLSMLQPHDNWSSLGMPAHTSMLPMGPNAGPPAGSSQYPSLWSVSSGAVAPGAQAAGVPSGLGAQFFRGSPAHSTPLAHPVSASSSSGSPLYEGAATATDVADSQYDASAQARLLASWTAVSPPSM。

[0088] SEQ ID NO:5 (TBXT CDS region)

[0089] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that further improvements can be made to the present invention. In short, according to the principles of the present invention, this application is intended to include any changes, uses or improvements to the present invention, including changes that depart from the disclosed scope in this application and are made using conventional techniques known in the art.

Claims

1. A method for delivering a substance encoding a gene for editing a TBXT protein, characterized in that: The method comprises the following steps: delivering a substance for editing the gene encoding the TBXT protein into an animal's fertilized egg by electroporation, wherein the substance for editing the gene encoding the TBXT protein is a ribonucleic acid-protein complex formed by a lead editing protein and RNA; the RNA targets the gene encoding the TBXT protein, and the RNA includes pegRNA and / or sgRNA; and the TBXT protein is any one of the following proteins: A1) a protein having an amino acid sequence of SEQ ID NO: 4; A2) a protein obtained by substituting and / or deleting and / or adding amino acid residues from the amino acid sequence of A1) and having at least 85% identity with the protein and having the same function; A3) A fusion protein having the same function is obtained by connecting a tag to the N-terminus and / or C-terminus of the amino acids shown in A1) or A2).

2. The method according to claim 1, characterized in that The reverse transcription template of the pegRNA includes a primer binding site and a reverse transcription template containing a target site editing sequence; The primer binding site is nucleotides 108 to 119 of SEQ ID NO: 2; the nucleotide sequence of the target site editing sequence in the reverse transcription template is nucleotides 97 to 107 of SEQ ID NO:

2.

3. The method according to claim 2, characterized in that The nucleotide sequence of the pegRNA is SEQ ID NO:

2.

4. The method according to any one of claims 1 to 3, characterized in that The sgRNA contains a single-guide RNA, and the nucleotide sequence of the single-guide RNA is positions 1 to 20 in SEQ ID NO:

3.

5. The method according to claim 4, characterized in that The nucleotide sequence of the sgRNA is SEQ ID NO:

3.

6. The method according to any one of claims 1 to 5, characterized in that The lead editing protein is any of the following proteins: A1) a protein having an amino acid sequence of SEQ ID NO: 1; A2) a protein obtained by substituting and / or deleting and / or adding amino acid residues from the amino acid sequence of A1) and having at least 85% identity with the protein and having the same function; A3) A fusion protein having the same function is obtained by connecting a tag to the N-terminus and / or C-terminus of the amino acids shown in A1) or A2).

7. The method according to any one of claims 1 to 6, characterized in that The animal is a sheep.

8. Use of the substance according to any one of claims 1 to 6 in any of the following: K1) Application in making animals with short or docked tails; K2) Use in the preparation of substances for making animals with short or docked tails.

9. The use according to claim 8, characterized in that The animal is a sheep.

10. A method for preparing a gene-edited fertilized egg, characterized in that: The gene-edited fertilized egg is obtained by delivering a substance for editing the TBXT gene into the fertilized egg of an animal using an electroporation method. The substance for editing the TBXT gene is a ribonucleic acid-protein complex formed by a lead editing protein and RNA; the RNA targets the TBXT gene, and the RNA includes pegRNA and / or sgRNA; the coding sequence of the TBXT gene is SEQ ID NO: 5.

Images