Composition for promoting tissue regeneration and injury repair and application thereof

Abstract

The invention discloses a composition for promoting tissue regeneration and injury repair and application thereof. Experiments find that macrophages are more easily polarized to M2 under mechanical stimulation, meanwhile, molecules CCM3 on adhesion spots are reduced, further molecular dynamics simulation finds that combination of CCM3 protein and paxilin protein is reduced and combination of FAK protein and paxilin protein is increased under certain mechanical stimulation, and meanwhile, cytoskeleton rearrangement is obvious. The invention clarifies the molecular mechanism of the influence of mechanical stimulation on cell behavior, and thus can be used for developing a novel regeneration treatment method.

Description

Technical Field

[0001] The present invention relates to the field of tissue repair, and in particular to a composition for promoting tissue regeneration and damage repair and its use. Background Art

[0002] Macrophages are crucial cells involved in immune regulation. They possess significant heterogeneity and can differentiate into either anti-inflammatory or pro-inflammatory pathways in response to environmental and material changes. Pro-inflammatory differentiation is known as M1 polarization, while anti-inflammatory differentiation is known as M2 polarization. M2-polarized macrophages have been used in areas such as tissue regeneration and injury repair.

[0003] Several technologies exist to manipulate macrophage behavior to promote tissue repair and regeneration, but these technologies suffer from high costs and inconsistent results. Furthermore, cells grow in three dimensions within the body, and studies have shown that the self-renewal and differentiation abilities of cells cultured in three dimensions differ from those in two-dimensional cultures.

[0004] The information in the background technology is only intended to illustrate the general background of the invention and should not be regarded as an admission or any form of suggestion that this information constitutes the prior art known to a person skilled in the art. Summary of the Invention

[0005] To address at least some of the technical problems in the prior art, the present invention, through in-depth research, has discovered that macrophages activated through specific methods can be advantageously used to promote tissue repair and regeneration. In particular, macrophages activated through specific mechanical stimulation exhibit M2 polarization and are capable of promoting bone repair and regeneration in vivo. Specifically, the present invention encompasses the following.

[0006] In a first aspect, the present invention provides a composition for promoting tissue regeneration and injury repair, comprising activated macrophages obtained by treating the macrophages in a three-dimensional culture environment with a Young's modulus of 105-120 kPa.

[0007] In certain embodiments, according to the composition for promoting tissue regeneration and injury repair of the present invention, the three-dimensional culture environment includes a gelatin-based hydrogel, which is modified to increase its Young's modulus to 105-120 kPa.

[0008] In certain embodiments, according to the composition for promoting tissue regeneration and injury repair of the present invention, the modification comprises modification using alkyl acrylic acid.

[0009] In certain embodiments, according to the composition for promoting tissue regeneration and injury repair of the present invention, the three-dimensional culture environment further comprises FAK or an activator thereof.

[0010] In certain embodiments, according to the composition for promoting tissue regeneration and injury repair of the present invention, the three-dimensional culture environment further comprises a CCM3 inhibitor.

[0011] In certain embodiments, according to the composition for promoting tissue regeneration and injury repair of the present invention, the expression or amount of IL-10, Arg-1 and / or CD206 in activated macrophages is increased.

[0012] In a second aspect, the present invention provides the use of macrophages in preparing a drug for promoting tissue regeneration and injury repair, wherein the macrophages are activated macrophages obtained by treating the macrophages in a three-dimensional culture environment with a Young's modulus of 105-120 kPa.

[0013] In certain embodiments, according to the use of the present invention, the activated macrophages have their cytoskeleton rearranged and undergo M2 polarization.

[0014] In certain embodiments, according to the use of the present invention, the macrophages have a reduced amount of CCM3 or decreased gene expression thereof.

[0015] In certain embodiments, according to the use of the present invention, the macrophages have an increased amount of FAK or elevated gene expression thereof.

[0016] In another aspect of the present invention, a method for regulating macrophage polarization in vitro is provided, comprising the step of applying mechanical stimulation to the macrophages.

[0017] In certain embodiments, according to the method for regulating macrophage polarization in vitro of the present invention, the mechanical stimulation is provided by a material with a fixed Young's modulus.

[0018] In certain embodiments, according to the method for regulating macrophage polarization in vitro of the present invention, the material comprises a gel.

[0019] In certain embodiments, according to the method for regulating macrophage polarization in vitro of the present invention, applying mechanical stimulation causes the amount of CCM3 or its gene expression to decrease, the amount of FAK or its gene expression to increase, and promotes the binding of FAK protein and Paxillin protein.

[0020] In certain embodiments, according to the method for regulating macrophage polarization in vitro of the present invention, the macrophage cell skeleton is further rearranged to promote the polarization of macrophages toward M2.

[0021] In another aspect of the present invention, there is provided use of an agent for preparing a product for promoting macrophage polarization, wherein the agent comprises an agent capable of promoting overexpression of FAK protein.

[0022] In certain embodiments, according to the use of the present invention, the agent further comprises an agent capable of inhibiting the expression of CCM3 protein.

[0023] In another aspect of the present invention, an M2-polarized macrophage is provided, wherein the macrophage has a decreased amount of CCM3 or a decreased gene expression thereof, and an increased amount of FAK or a decreased gene expression thereof.

[0024] In another aspect of the present invention, a composition for promoting tissue regeneration and injury repair is provided, which comprises the M2 polarized macrophages described in the present invention.

[0025] In another aspect of the present invention, there is provided use of a reagent for preparing a medicament for promoting tissue regeneration and injury repair, wherein the reagent comprises the M2 polarized macrophages described in the present invention.

[0026] The present invention has found that macrophages can be greatly promoted to polarize toward M2 in an enhanced mechanical environment, while in a traditional culture medium environment, the mechanical strength is generally below 100kPa, and macrophages cannot effectively polarize toward M2. The macrophages obtained by the present invention can further be used to promote tissue regeneration and damage repair, with excellent results. In addition, the present invention further found that the mechanism by which a specific mechanical environment promotes macrophage polarization toward M2 is that under certain mechanical stimulation, the binding of CCM3 protein to paxillin protein is reduced, while the binding of FAK protein to paxillin protein is increased, and the cytoskeleton is significantly rearranged. Therefore, applying mechanical stimulation to macrophages can reduce CCM3 expression, so that force can be transmitted to the cells through FAK-Paxillin, resulting in rearrangement of the macrophage cytoskeleton, thereby causing the macrophage to polarize toward M2. Based on this, in certain embodiments of the present invention, FAK or its activator and / or CCM3 inhibitor are further included in the three-dimensional culture environment or intracellularly of the macrophages, or the macrophages are provided with an increased amount of FAK and / or a reduced amount of CCM3. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1-2 It shows that when a certain mechanical stimulus is applied to macrophages, the macrophages polarize toward M2.

[0028] Figure 3 It was shown that when certain mechanical stimuli were applied to macrophages, cytoskeleton rearrangement was enhanced.

[0029] Figure 4It shows that when certain mechanical stimulation is applied to macrophages, the expression of molecular signals related to cytoskeleton rearrangement is reduced.

[0030] Figure 5 The figure shows the expression of FAK molecules when certain mechanical stimulation is applied to macrophages.

[0031] Figure 6 Shown are the effects of FAK inhibitors on CCM3 expression.

[0032] Figure 7-8 The interaction between FAK and PAXI is shown when certain mechanical stimuli are applied to macrophages.

[0033] Figure 9-10 The interaction between FAK and PAXI is shown when certain mechanical stimuli are applied to macrophages.

[0034] Figure 11 The results of macrophage polarization detection in macrophages with FAK overexpression, CCM3 knockdown, and simultaneous FAK overexpression and CCM3 knockdown are shown. DETAILED DESCRIPTION

[0035] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0036] It should be understood that the terms described in the present invention are only for describing particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges in the present invention, it should be understood that the upper and lower limits of the ranges and each intermediate value therebetween are specifically disclosed. Each smaller range between any stated value or intermediate value within a stated range and any other stated value or intermediate value within the stated range is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0037] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0038] Methods for regulating macrophage polarization in vitro The present invention provides an in vitro method for regulating macrophage polarization, comprising the steps of applying mechanical stimulation to the macrophages and culturing the macrophages. Macrophages are highly heterogeneous, and different hardnesses have different effects on macrophages, resulting in different polarization directions of macrophages. In the present invention, regulating macrophage polarization refers to the cellular behavior of macrophages polarizing toward M2 under certain mechanical or mechanical stimulation.

[0039] In certain embodiments, mechanical stimulation is provided by a material having a fixed Young's modulus. Although a gel having a certain Young's modulus is shown in the embodiments as the material for providing mechanical stimulation, those skilled in the art will appreciate that any other biocompatible material can also be used as long as it can provide a certain Young's modulus.

[0040] The present invention discovered that materials with a certain Young's modulus, when loaded with macrophages and cultured in three dimensions, can provide mechanical stimulation to the loaded macrophages, resulting in a decrease in the expression of molecular signals related to cytoskeletal rearrangement within the macrophages, specifically a decrease in the amount of CCM3 or its gene expression, while an increase in the amount of FAK or its gene expression. Experiments further verified that these changes can promote the binding of FAK and Paxillin proteins, allowing mechanical stimulation to be transmitted to the cells through FAK-Paxillin, leading to macrophage cytoskeletal rearrangement and subsequent polarization toward M2. This anti-inflammatory differentiation is beneficial for tissue regeneration, injury repair, fracture repair, and reconstruction of damaged tissue.

[0041] In the present invention, the material providing mechanical stimulation has a Young's modulus of 50-200 kPa, preferably 50-150 kPa, more preferably 100-150 kPa, and further preferably 106-120 kPa, particularly, for example, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, or 120 kPa. A Young's modulus should be neither too large nor too small. A too small Young's modulus (e.g., less than 106 kPa, such as 105, 104, 103, or 102 kPa) has a minimal effect on molecular signals related to cytoskeletal rearrangement, such as CCM3 and FAK expression, and results in a lack of significant macrophage polarization toward M2. On the other hand, an excessively large Young's modulus is detrimental to cell culture and growth.

[0042] The method for measuring Young's modulus is known in the art. An exemplary measurement step includes: cutting the material into specimens of the same size, placing them under a platen probe, and using total texture analysis (TPA) to measure the material's hardness, elasticity, resilience, and cohesion.

[0043] In the present invention, the cytoskeleton rearrangement can be determined by methods known in the art, such as detecting the cytoskeleton arrangement by immunofluorescence.

[0044] In the present invention, macrophage M2 polarization can be determined by methods known in the art, such as immunofluorescence detection of relevant marker molecule expression. In a preferred embodiment, the expression or amount of marker molecules IL-10, Arg-1, and CD206 is significantly increased.

[0045] Unless otherwise specified, the "amount" used in the present invention to describe gene expression or protein includes both relative and absolute amounts.

[0046] M2 polarized macrophages The present invention further provides a modified macrophage (also referred to herein as an "M2-polarized macrophage") in which CCM3 expression is suppressed and FAK is overexpressed, causing the macrophage to polarize toward the M2 phase or the macrophage to be already in the M2 phase and maintained in the M2 phase (i.e., an M2 macrophage). In addition, the modified macrophage of the present invention can be used as seed cells for tissue repair.

[0047] In the present invention, the source of macrophages is not particularly limited, and can be macrophages derived from any tissue, including but not limited to macrophages derived from connective tissue, blood tissue, hematopoietic tissue (such as bone marrow), etc.

[0048] Composition for promoting tissue regeneration and damage repair The present invention also provides a composition for promoting tissue regeneration and injury repair, comprising the M2 polarized macrophages described herein and an optional pharmaceutically acceptable carrier. It is understood that the composition of the present invention may further include other suitable therapeutic agents for tissue repair, without particular limitation.

[0049] The composition of the present invention can be administered to a subject / patient in any suitable dosage form, and the administration method is not particularly limited. In the present invention, examples of the dosage form of the composition include, but are not limited to, creams, gels, and the like.

[0050] use The present invention also provides a use of a reagent for preparing a product for promoting macrophage polarization, wherein the reagent includes a reagent capable of promoting FAK protein overexpression. The reagent capable of promoting FAK protein overexpression can be a FAK agonist, FAK activator, or FAK inducer known in the art.

[0051] In a preferred embodiment, the reagent also includes a reagent capable of inhibiting the expression of CCM3 protein. The reagent capable of inhibiting the expression of CCM3 protein can be a CCM3 antagonist, a CCM3 knockout agent, etc. known in the art.

[0052] Example 1 1. Mixing macrophages with methacrylated gelatin liquids of different hardness 1. After trypsin is used to digest the adherent macrophages, serum-containing culture medium is added to terminate the digestion.

[0053] 2. Centrifuge the digested cells and resuspend them to prepare a cell suspension.

[0054] 3. Mix the cell suspension with methacrylated gelatin solutions with final hardness of 102 kPa and 106 kPa, respectively, in a 1:1 ratio.

[0055] 4. Molecular simulation 102kPa (atmospheric pressure).

[0056] 5. Irradiate the methacrylated gelatin-cell mixture containing photoinitiator with blue light of wavelength 405 for 30 seconds.

[0057] 6. Add culture medium to the top of the colloid to ensure cell nutrition supply and hydrogel moistening.

[0058] Detection of Macrophage M2 Polarization 1. Aspirate the culture medium above the hydrogel and add neutral formaldehyde fixative for 10 minutes.

[0059] 2. Aspirate the fixative, rinse with PBS, and then add 0.5% Triton punching solution and soak for 5 minutes.

[0060] 3. Aspirate the punching solution, rinse with PBS, and then add 5% BSA blocking solution at 4℃ for 20 minutes.

[0061] 4. Add CD206 antibody, incubate overnight, and detect molecular expression by immunofluorescence.

[0062] 5. Simultaneously, RNA of macrophages in the hydrogel was extracted and reverse transcribed before PCR verification.

[0063] The results are as follows Figure 1-2 As shown, the results showed that when a mechanical stimulus with a hardness of 106 kPa was applied to macrophages, the macrophages polarized toward M2.

[0064] 3. Observation of the Cytoskeleton 1. Aspirate the culture medium above the hydrogel and add neutral formaldehyde fixative for 10 minutes.

[0065] 2. Incubate the hydrogel with rhodamine-labeled phalloidin for 1 hour.

[0066] 3. Immunofluorescence detection of cytoskeleton arrangement.

[0067] The results are as follows Figure 3 As shown, the results showed that when a mechanical stimulus with a hardness of 106 kPa was applied to macrophages, cytoskeleton rearrangement was enhanced.

[0068] 4. Detection of the expression of the signaling molecule CCM3 1. Extract RNA from macrophages in hydrogel using Trizol method.

[0069] 2. Reverse transcribe RNA into cDNA.

[0070] 3. PCR verification of the expression of CCM3 molecules in 102kPa and 106kPa hydrogels.

[0071] The results are as follows Figure 4 As shown, when mechanical stimulation with a hardness of 106 kPa was applied to macrophages, the expression of CCM3 was reduced.

[0072] 5. FAK expression detection 1. Extract RNA from macrophages in hydrogel using Trizol method.

[0073] 2. Reverse transcribe RNA into cDNA.

[0074] 3. PCR verification of the expression of FAK molecules in 102kPa and 106kPa hydrogels.

[0075] The results are as follows Figure 5 As shown, when mechanical stimulation with a hardness of 106 kPa was applied to macrophages, the expression of FAK increased.

[0076] VI. Effect of FAK Inhibitors on CCM3 Expression This example further studied the effect of adding FAK inhibitor PF562271 on the expression of CCM3. Figure 6 As shown, the expression of CCM3 increased after the addition of FAK inhibitor, indicating that FAK and CCM3 are in a competitive relationship with each other.

[0077] VII. Molecular dynamics experiments verify changes in molecules CCM3, paxillin, and FAK associated with cytoskeletal rearrangements Molecular dynamics simulations of the complexes of FAK with PAXI and CCM3 with PAXI were performed using GROMACS at pressures of 102 and 106 kPa.

[0078] CCM3 and FAK compete for binding to paxillin, a protein on focal adhesions (mechanical receptors). When CCM3 binds to paxillin, it blocks mechanical signals from entering the cell, weakening cytoskeletal rearrangements. When FAK binds to paxillin, it enhances mechanical signals entering the cell, further enhancing cytoskeletal rearrangements. Molecular dynamics studies have shown that when a mechanical stimulus of 106 kPa is applied to macrophages, the binding of CCM3 to paxillin weakens. Instead, the number of FAK binding sites to paxillin increases, and the binding is most stable. This suggests that as stiffness increases, mechanical signal-mediated CCM3 expression weakens, allowing more mechanical signals to enter the cell and promote cytoskeletal rearrangements.

[0079] like Figure 7 Figure 2 shows the interaction between FAK and PAXI at a pressure of 102 kPa. PAXI is colored magenta (dark in the figure) and FAK is colored green (light gray in the figure). Figure 8 The interaction between FAK and PAXI at a pressure of 106 kPa is shown. Figure 9 The interaction between CCM3 and PAXI at a pressure of 102 kPa is shown. Figure 10 The interaction between CCM3 and PAXI at a pressure of 106 kPa is shown. Overall, at a pressure of 102 kPa, the complex CCM3-PAXI is more stable than FAK-PAXI, while at a pressure of 106 kPa, FAK-PAXI is more stable than CCM3-PAXI.

[0080] Example 2 This example shows that macrophage polarization detection was performed by overexpressing FAK, knocking down CCM3, and simultaneously overexpressing FAK and knocking down CCM3 in macrophages. Figure 11 As shown, at 106 kPa, macrophages polarize toward M2.

[0081] The CCM3 knockdown experiment involved designing a CCM3 sgRNA target sequence, synthesizing single-stranded DNA oligos (PAGE-purified) with restriction endonucleases, annealing to form double-stranded DNA, and ligating the resulting product into a Lenti-CAS9-sgRNA-tag vector. The ligated product was transformed using a TOP10 competent cell, and positive clones were identified by colony PCR and sequenced to generate a lentiviral plasmid expressing the correct sgRNA. The sgRNA sequence was: AGGCATAGAAACCATGGAAG, with the element sequence U6-sgRNA-EF1a-Cas9-FLAG-CMV-EGFP-P2A-puro. The plasmid was transfected into 293T cells, and the virus-containing supernatant was harvested, filtered, and stored at -80°C until further use. Bone marrow-derived macrophages (BMDMs) were plated 24 hours in advance. Twenty-four hours later, the CCM3 knockdown virus and viral enhancer were added to the BMDM-attached plates and transfected for 18 hours. After 18 hours, fresh serum-containing culture medium was replaced and culture continued. After 72 hours, cells were observed to exhibit green fluorescence under a microscope, indicating successful lentiviral transfection. PCR verification of the lentiviral knockdown results confirmed successful knockdown of the CCM3 gene.

[0082] Although the present invention has been described with reference to exemplary embodiments, it should be understood that the invention is not limited to the disclosed exemplary embodiments. Various modifications and variations may be made to the exemplary embodiments of the present specification without departing from the scope or spirit of the present invention. The scope of the claims is to be given the broadest interpretation so as to encompass all such modifications and equivalent structures and functions.

Claims

1. A composition for promoting tissue regeneration and damage repair, characterized in that: The activated macrophages are obtained by treating the macrophages in a three-dimensional culture environment with a Young's modulus of 105-120 kPa.

2. The composition for promoting tissue regeneration and damage repair according to claim 1, characterized in that: The three-dimensional culture environment includes a gelatin-based hydrogel that is modified to increase its Young's modulus to 105-120 kPa.

3. The composition for promoting tissue regeneration and damage repair according to claim 1, characterized in that: The modification includes modification with alkyl acrylic acid.

4. The composition for promoting tissue regeneration and damage repair according to claim 1, characterized in that: The three-dimensional culture environment further includes FAK or an activator thereof.

5. The composition for promoting tissue regeneration and damage repair according to claim 1 or 4, characterized in that: The three-dimensional culture environment further includes a CCM3 inhibitor.

6. The composition for promoting tissue regeneration and damage repair according to claim 1 or 2, characterized in that: The expression or amount of IL-10, Arg-1 and / or CD206 in activated macrophages is increased.

7. Use of macrophages in the preparation of a drug for promoting tissue regeneration and damage repair, characterized in that: The macrophages are activated macrophages, which are obtained by treating the macrophages in a three-dimensional culture environment with a Young's modulus of 105-120 kPa.

8. The use according to claim 7, characterized in that The activated macrophages undergo cytoskeleton rearrangement and undergo M2 polarization.

9. The use according to claim 7, characterized in that The macrophages have a reduced amount of CCM3 or decreased gene expression thereof.

10. The use according to claim 7, characterized in that The macrophages have an increased amount of FAK or elevated gene expression thereof.

Images