Purification method of label-free A53T mutant alpha-synuclein

Abstract

The invention relates to the technical field of protein purification, in particular to a purification method of label-free A53T mutant alpha-synuclein. The purification method disclosed by the invention is a purification method which is more efficient and economical and can maintain protein functions, 20mg of protein can be obtained by inducing 1L of bacterial liquid for 4 hours through IPTG, and the method can improve the overall effect and experimental accuracy of preparation of the label-free A53T alpha mutant-synuclein monomer.

Description

Technical Field

[0001] The present invention relates to the technical field of protein purification, and in particular to a method for purifying tag-free A53T α-synuclein. Background Art

[0002] Misaligned aggregation and folding of α-synuclein are key pathogenic factors in neurodegenerative diseases such as Parkinson's disease (PD) and dementia with Lewy bodies. The A53T mutation (Ala53Thr) is one of the most common pathogenic mutations in α-synuclein (α-syn) and is closely associated with familial Parkinson's disease (PD). The A53T mutation accelerates the formation of β-sheet structures, increasing the rate of fibrosis by 3-5 times, making it a key target for disease mechanism research and therapeutic target development. In vitro expression and purification of highly purified A53T mutant α-syn protein provides highly controlled, pathologically relevant protein samples, making it invaluable in disease-specific research and targeted therapy development. In particular, in clinical diagnostics, measuring the concentration of A53T mutant α-syn protein in patient peripheral blood and cerebrospinal fluid requires the use of a monoclonal antibody targeting the A53T mutant epitope, which requires high antigenicity. Furthermore, the detection of wild-type α-syn in cerebrospinal fluid using the real-time oscillation-induced conversion technique requires a substrate purity >98%. Using the same method to detect A53T mutant α-syn in cerebrospinal fluid requires the purity of the in vitro purified A53T mutant protein to be >98%. In drug development, maintaining the native conformation of the protein can enhance the accuracy of drug screening. However, the introduction of traditional His / GST tags can block some drug binding sites through steric hindrance (increasing molecular weight by 26-52 kDa), leading to false negative screening rates. Furthermore, α-syn is a naturally disordered protein, and its conformational flexibility is crucial for its abnormal aggregation and binding to cell membranes. Exogenous tags may disrupt its dynamic conformational equilibrium, affecting aggregation kinetics or biological activity.

[0003] Existing purification technologies have significant limitations: affinity chromatography achieves precise and specific binding through, for example, His tag-Ni-NTA columns or antigen-antibody, but affinity fillers (such as metal chelate media, protein A / G) are expensive and have a limited lifespan. A single operation takes up to 48 hours and the cost of consumables exceeds 3,000 yuan, making it difficult to meet the large-scale production needs of scientific research or even clinical testing. Anion exchange chromatography; although the cost of anion exchange chromatography is significantly lower than affinity chromatography, the pH and ionic strength need to be precisely controlled during the chromatography process to elute the target. If the charge properties of the coexisting impurities are similar to those of the target, multiple steps of optimization are required. Summary of the Invention

[0004] The present invention addresses the problems of label interference, high cost, and complex operation in the prior art, and provides a method for purifying the A53T mutant α-synuclein without a label. This method is more efficient and economical, and can maintain the native conformation of the protein, does not change the aggregation dynamics of the protein, and maintains the function of the protein. This method can improve the overall effect and experimental accuracy of the preparation of α-synuclein monomers.

[0005] In order to overcome the deficiencies of the prior art, the present invention provides a method for purifying a tag-free A53T mutant α-synuclein.

[0006] The present invention is achieved through the following technical solutions: A method for purifying A53T α-synuclein comprises the following steps: (1) Construct a recombinant expression vector containing the α-synuclein gene encoding the A53T point mutation; (2) Transform the recombinant expression vector into the host bacteria, induce expression, and collect the bacteria after centrifugation; (3) Ultrasonic pulverization and centrifugation are performed on the bacteria in sequence, and the supernatant after centrifugation is collected and acid precipitation and alkali neutralization are performed in sequence; (4) treating the supernatant obtained in step (3) with streptomycin sulfate and glacial acetic acid, and then subjecting it to saturated ammonium sulfate precipitation for separation; the ammonium sulfate precipitation includes primary precipitation and secondary precipitation; (5) treating the supernatant obtained in step (4) with ammonium acetate and ethanol in sequence, then dissolving the protein precipitate with ammonium sulfate to obtain a protein solution to be purified, and verifying it by SDS-PAGE gel electrophoresis; the ammonium acetate and ethanol treatment includes a primary treatment and a secondary treatment; (6) The protein solution to be purified is dialyzed in an ice bath and freeze-dried to obtain A53T α-synuclein.

[0007] Preferably, in step (1), primers are designed for the α-synuclein sequence for amplifying the α-synuclein sequence; the forward primer sequence is shown in SEQ ID NO.1; the reverse primer sequence is shown in SEQ ID NO.2; A53T point mutation primers are designed for the α-synuclein sequence for amplifying the α-synuclein sequence carrying the A53T mutation site, the point mutation forward primer sequence is shown in SEQ ID NO.3, and the reverse primer sequence is shown in SEQ ID NO.4; specifically as follows: The forward primer sequence was: CATATGGATGTATTCATGAAAGGACTT; The reverse primer sequence was: GTCGACTTAGGCTTCAGGTTCGTAG; A53T point mutation primers were designed for the α-synuclein sequence to amplify the α-synuclein sequence carrying the A53T mutation site; The forward primer sequence for point mutation was: 5′-CATGGTGTGACAACAGTGGCTGAGAAGACCAA-3′; The reverse primer sequence is: 5'GCCACTGTTGTCACACCATGCACCACTCCCT-3'.

[0008] Preferably, in step (3), in the acid precipitation step, the supernatant obtained by centrifugation is mixed with hydrochloric acid until the pH value reaches 3.5, and the mixture is allowed to stand for 60 minutes to allow stratification to occur; in the alkali neutralization step, the supernatant obtained by centrifugation is mixed with sodium hydroxide until the pH value reaches 7.0; and the ultrasonic pulverization condition parameters are: ice bath, intensity 30%; ultrasonication with an interval of 3 seconds on and 3 seconds off, and continuous operation for 15 minutes.

[0009] Preferably, in step (3), the centrifugation condition parameters are 4°C, 8228g centrifugation for 10 min.

[0010] Preferably, in step (4), in the primary precipitation step, the supernatant is mixed with a saturated ammonium sulfate solution in a volume ratio of 1:1, and the mixture is centrifuged at 4°C and 8228g for 5 minutes to collect the precipitate to obtain a protein precipitate; in the secondary precipitation step, the protein precipitate is mixed with 5 ml of a saturated ammonium sulfate solution and the mixture is centrifuged at 4°C and 3214g for 5 minutes to obtain a protein precipitate.

[0011] Preferably, in step (4), the streptomycin sulfate and glacial acetic acid treatments include adding 136 μL of 10% w / v streptomycin sulfate per 1 mL of sample and adding 228 μL of glacial acetic acid per 1 mL of sample, respectively. After thorough mixing, the mixture is centrifuged at 4°C and 8228 g for 5 min, and the supernatant is collected.

[0012] Preferably, in step (5), the first ammonium acetate and ethanol treatment step is: adding 4.5 mL of 0.77% w / v ammonium acetate solution to fully dissolve the precipitate, then adding 4.5 mL of ethanol, centrifuging at 4°C and 8228g for 5 minutes, and collecting the precipitate.

[0013] Preferably, in step (5), the ammonium sulfate-dissolved protein precipitate is prepared by adding 2.5 mL of 1.32% w / v ammonium sulfate-dissolved protein precipitate and centrifuging at 4°C and 3214 g for 5 min; The second ammonium acetate and ethanol treatment was as follows: the collected precipitate was dissolved with 1 mL of 0.77% w / v ammonium acetate, 1 mL of ethanol was added and mixed thoroughly, and then centrifuged at 4°C and 3214 g for 5 minutes to obtain the second ammonium acetate and ethanol treatment product.

[0014] Preferably, in step (6), the ice bath dialysis step is: adding the sample to a dialysis bag, dialysis in an ice bath for 2 hours, replacing the deionized water and dialysis again for 2 hours to obtain an A53T α-synuclein sample.

[0015] Preferably, in step (6), the freeze-drying step is: the dialyzed protein sample is divided into centrifuge tubes, placed in a -80°C refrigerator and frozen until completely solidified, and then transferred to a freeze dryer for freeze-drying to obtain A53T α-synuclein.

[0016] The present invention discloses the following technical effects: 1. High purity and high yield The present invention adopts a tag-independent purification method, overcoming the limitations of tags on purification effects in traditional affinity chromatography. By optimizing the purification steps, the purity and yield of A53T α-synuclein are effectively improved. This is crucial for subsequent experiments and applications. High-purity protein can reduce the risk of nonspecific aggregation and improve the sensitivity and accuracy of detection. The tag-independent efficient purification method provided by the present invention can overcome the problems of limited separation of tagged proteins and high cost in affinity chromatography, while significantly increasing the yield of α-synuclein, and mg-level protein expression can be extracted per 1L of bacterial liquid.

[0017] 2. Avoid label interference Many conventional purification methods rely on the addition of tags (such as His or GST), which can alter the conformation of the target protein, thereby affecting its biological activity and the accuracy of experimental results. The purification technology provided by the present invention does not require tagging and can maintain the protein's original conformation and biological function during the purification process. This method not only ensures that the activity of A53T α-synuclein remains unchanged during experiments, but also ensures the reliability and consistency of experimental results. This property of maintaining biological activity is particularly important for subsequent biological research and applications.

[0018] 3. Economical and efficient Traditional protein purification methods, such as affinity chromatography and molecular sieve chromatography, are often costly and time-consuming. The purification technology developed in this paper reduces material costs and processing time, making it suitable for large-scale production and effectively meeting the needs of both laboratory and industrial applications. This economic benefit makes the technology more feasible for practical applications.

[0019] 4. Reduce the impact of impurities During the purification process, insufficiently purified α-synuclein may carry with it some impurity proteins that interact with it. These impurities can easily induce nonspecific aggregation, and the presence of impurity proteins can interfere with experimental results and affect experimental accuracy. The present invention utilizes the physicochemical properties of α-synuclein to remove impurities, ensuring the high purity of the target protein, rather than relying on traditional molecular weight differences for molecular sieve chromatography. This process significantly reduces the incidence of nonspecific aggregation and enhances experimental reliability. Furthermore, this method ensures the high purity of α-synuclein monomers, providing a more accurate and reliable foundation for subsequent experiments.

[0020] 5. Simplify the operation process The present invention optimizes the traditional purification process in its technical solution, eliminating unnecessary steps and making the operation more convenient. This improvement not only improves experimental efficiency but also reduces the dependence on the operator's technical level, making the method more accessible to a wider range of researchers and technicians.

[0021] In summary, the present invention provides a more efficient, economical purification method that can maintain protein function, which can improve the overall effect and experimental accuracy of α-synuclein monomer preparation. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0023] Figure 1 Flow chart of the method for purifying untagged A53T mutant α-synuclein; Figure 2 It is the white protein precipitate after secondary precipitation; Figure 3 A53T mutant α-synuclein obtained after freeze-drying; Figure 4 This is the SDS-PAGE Coomassie blue staining image of the purified A53T mutant α-syn protein; Figure 5 The figure is the SDS-PAGE electrophoresis of purified A53T mutant and wild-type α-syn proteins; Figure 6 The fluorescence change of Thioflavin T during the incubation of 20 μM A53T α-syn and 20 μM WT α-syn alone indicates the protein aggregation process; Figure 7CD spectra of 20 μM A53T α-syn and 20 μM WT α-syn during incubation, indicating the changes in secondary structure during protein aggregation. DETAILED DESCRIPTION

[0024] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0025] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0026] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0027] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.

[0028] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0029] Example 1 The specific steps of the tag-free α-synuclein purification method are as follows Figure 1 As shown, the details are as follows: 1. Construction of recombinant expression plasmid and recombinant bacteria 1. Gene sequence acquisition Visit the NCBI Gene database and enter "α-synuclein" or its gene identifier (such as SNCA (human)) in the search box to find information about the α-synuclein gene. Once you are on the gene page, look for the "CDS" sequence (coding sequence) and copy it. The CDS sequence of the human α-synuclein gene is as follows: The CDS sequence of the human α-synuclein gene, the sequence number is SEQ ID Shown in NO.5; specifically: ATGGATGTATTCATGAAAGGACTTTCAAAGGCCAAGGAGGGAGTTGTGGCTGCTGCTGAGAAAACCAAACAGGGTGTGGCAGAAGCAGCAGGAAAGACAAAAGAGGGTGTTCTCTATGTAGGCTCCAAAACCAAGGAGGGAGTGGTGCATGGTGTGGCAACAGTGGCTGAGAAGACCAAAGAGCAAGTGACAAATGTTGGAGGAGC AGTGGTGACGGGTGTGACAGCAGTAGCCCAGAAGACAGTGGAGGGAGCAGGGAGCATTGCAGCAGCCACTGGCTTTGTCAAAAAGGACCAGTTGGGCAAGAATGAAGAAGGAGCCCCACAGGAAGGAATTCTGGAAGATATGCCTGTGGATCCTGACAATGAGGCTTATGAAATGCCTTCTGAGGAAGGGTATCAAGACTACGAACCTGAAGCCTAA; Designing primers for amplifying the α-synuclein sequence; The forward primer sequence was: CATATGGATGTATTCATGAAAGGACTT; The reverse primer sequence was: GTCGACTTAGGCTTCAGGTTCGTAG; Among them, the restriction enzyme cutting sites are CATATG and GTCGAC respectively.

[0030] A53T point mutation primers were designed for the α-synuclein sequence to amplify the α-synuclein sequence carrying the A53T mutation site; The forward primer sequence for point mutation was: 5′-CATGGTGTGACAACAGTGGCTGAGAAGACCAA-3′; The reverse primer sequence is: 5'GCCACTGTTGTCACACCATGCACCACTCCCT-3'.

[0031] The CDS sequence of the human α-synuclein gene containing the A53T point mutation amplified by point mutation PCR is shown in SEQ ID NO. 6, specifically: CATATGATGGATGTATTCATGAAAGGACTTTCAAAGGCCAAGGAGGGAGTTGTGGCTGCTGCTGAGAAAACCAAACAGGGTGTGGCAGAAGCAGCAGGAAAGACAAAAGAGGGTGTTCTCTATGTAGGCTCCAAAACCAAGGAGGGAGTGGTGCATGGTGTGACAACAGTGGCTGAGAAGACCAAAGAGCAAGTGACAAATGTTGGAGGAGCAGTGGTGACGGGTGTGACA GCAGTAGCCCAGAAGACAGTGGAGGGAGCAGGGAGCATTGCAGCAGCCACTGGCTTTGTCAAAAAGGACCAGTTGGGCAAGAATGAAGAAGGAGCCCCACAGGAAGGAATTCTGGAAGATATGCCTGTGGATCCTGACAATGAGGCTTATGAAATGCCTTCTGAGGAAGGGTATCAAGACTACGAACCTGAAGCCTAAGTCGAC; wherein, the restriction enzyme cleavage sites of this sequence are CATATG and GTCGAC.

[0032] 2. Plasmid selection The pT7-7(+) plasmid was selected as the expression vector. This plasmid contains the T7 promoter, which allows for inducible expression of the target protein in E. coli BL21(DE3) and carries an ampicillin-resistance gene for resistance screening. This plasmid can be induced in E. coli by IPTG, resulting in high expression of the target protein. Furthermore, this plasmid is relatively small and has a high copy number.

[0033] 3. Restriction enzyme digestion Double enzyme digestion reaction was performed using NdeI and SalI as restriction endonucleases to digest the pT7-7(+) plasmid and the target gene, i.e., the α-synuclein encoding gene containing the A53T point mutation, respectively.

[0034] The pT7-7(+) plasmid (1 μg) and the α-synuclein gene fragment containing the A53T point mutation (500 ng, the sequence is shown in SEQ ID NO. 6) were added to the enzyme digestion reaction tubes respectively. Then, the following reagents were added to the reaction tubes: 10× enzyme digestion buffer: 2 μL, NdeI (10 U / μL): 1 μL, SalI (10 U / μL): 1 μL, and the balance is distilled water, for a total reaction system of 20 μL.

[0035] Incubate in a 37°C water bath for 4 h to ensure complete cleavage of the plasmid and gene fragment, thereby obtaining the cleaved pT7-7(+) plasmid and the cleaved human α-synuclein gene fragment containing the A53T point mutation.

[0036] 4. Purification of enzyme digestion products After the enzyme digestion reaction is complete, use 1% agarose gel electrophoresis to separate the DNA fragments. Load the digestion products onto the agarose gel and verify the success of the digestion by agarose gel electrophoresis. Use a blue light transilluminator to observe the electrophoresis results and cut out the plasmid and gene fragment bands of corresponding sizes.

[0037] The target DNA fragment was recovered from the gel using a gel recovery kit and DNA purification was performed according to the kit instructions to obtain the cleaved and purified pT7-7(+) plasmid (1 μg) and the purified α-synuclein gene fragment containing the A53T point mutation.

[0038] 5. Ligation reaction The purified plasmid and the α-synuclein gene containing the A53T point mutation were ligated using T4 DNA ligase.

[0039] Add the following reagents to the ligation reaction tube: The purified pT7-7(+) plasmid was prepared as follows: 5 ng; α-synuclein gene containing the A53T point mutation was prepared as follows: 50 ng; 10×T4 DNA ligation buffer was prepared as follows: 1 μL; 0.5 μL of T4 DNA ligase (350 U / μL); and the remainder was distilled water. The total reaction system was 10 μL.

[0040] The ligation was carried out overnight at 16° C. to allow a full ligation reaction between the plasmid and the gene fragment, thereby obtaining a recombinant prokaryotic expression plasmid of the α-synuclein gene containing the A53T point mutation.

[0041] 6. Transformed cells The constructed α-synuclein gene recombinant prokaryotic expression plasmid containing the A53T point mutation was introduced into BL21 (DE3) competent cells by chemical transformation; the transformation steps are as follows: Take 50 μL of BL21 (DE3) competent cells, place them on ice, and add 5 μL of the recombinant prokaryotic expression plasmid of the α-synuclein gene containing the A53T point mutation.

[0042] The mixture was placed on ice for 30 min to facilitate full contact between the recombinant plasmid DNA and the E. coli cells.

[0043] After heat shock at 42°C for 90 seconds, the cells were immediately returned to ice for 2 minutes.

[0044] Add 500 μL of LB medium without antibiotics to the reaction tube and culture at 37°C in a shaking incubator for 0.5-1 h to promote cell recovery and expansion.

[0045] 7. Screening and Verification Prepare solid culture medium: Add 0.5g sodium chloride, 0.25g yeast extract, 0.5g tryptone, and 1g agar powder to 50mL of double-distilled water. Autoclave at 121°C for 20 minutes. After cooling the sterilized medium to approximately 55°C, add ampicillin to a final concentration of 50μg / mL. Mix thoroughly, then pour into a sterile Petri dish and let it solidify.

[0046] Centrifuge at 1000g for 5 minutes at room temperature to pellet the bacteria. Discard approximately 400 μL of supernatant, leaving approximately 100 μL. Gently pipette to resuspend the cells. Using a triangular-tipped glass spreader, spread the transformed cells evenly onto LB agar plates containing ampicillin (Amp+ 50 μg / mL).

[0047] Incubate the plate in a 37°C incubator overnight.

[0048] On the second day, a single colony was selected and transferred into LB culture medium containing Amp+ to verify by sequencing whether the recombinant plasmid in the colony contained the correct α-synuclein insertion fragment carrying the A53T mutation site, and a positive recombinant bacterium was obtained.

[0049] 800 μL of positive recombinant bacteria and 200 μL of sterile glycerol were thoroughly mixed and stored in a -80°C refrigerator for subsequent prokaryotic expression and purification.

[0050] 2. Prokaryotic Expression and Crude Purification 1. Take out the frozen bacteria from the -80℃ refrigerator, burn the inoculation loop with the flame of an alcohol lamp, dip it in the bacterial solution after cooling, inoculate the bacterial solution into the culture dish by streaking, and invert it in a 37℃ incubator for overnight culture.

[0051] 2. After 18 hours of overnight culture, when colonies are formed in the bacterial culture plate, seal the culture dish with sealing film and store in a 4°C refrigerator for 2 weeks.

[0052] 3. Bacterial culture medium: Weigh 10 g of sodium chloride, 5 g of yeast extract, and 10 g of tryptone and add double-distilled water to make 1 L of culture medium solution. Autoclave at 121°C for 20 min. After the culture medium cools, add ampicillin to a final concentration of 50 μg / mL.

[0053] 4. Expand the culture: In a clean bench, pick 2-3 single colonies from a solid culture plate and inoculate them into the same tube of LB culture medium containing ampicillin (1 mL). Incubate the culture on a shaker at 37°C, 200 rpm for 2 h. Add the colonies to 100 mL of culture medium (containing ampicillin) and continue incubating on a shaker at 37°C, 200 rpm overnight (14-16 h). Add the colonies to 1 L of culture medium (containing ampicillin) and continue incubating on a shaker at 37°C, 200 rpm.

[0054] 6. OD value detection: After shaking culture for 1.5 hours, aspirate the culture medium and use Nanodrop to detect the OD value using blank culture medium as a control.

[0055] 7. IPTG-induced α-synuclein expression: When the OD value reaches 0.6, add IPTG to the culture medium at a final concentration of 1 mM and culture on a shaker at 37°C, 200 rpm for 4-6 h.

[0056] 8. Extract bacteria: Centrifuge the induced bacterial solution at 3214g for 5 min to collect the bacterial precipitate.

[0057] 9. Ultrasonic disruption: Add deionized water to the centrifuged bacterial tube (8 mL of deionized water for every 500 mL of bacterial liquid) and sonicate for 15 min (3 s on, 3 s off, 4°C, power 30%).

[0058] 10. Acid precipitation: After ultrasonic disruption, centrifuge at 8228 g for 10 min at 4°C. Collect the supernatant and adjust the pH value of the sample to 3.5 with 3.65% w / v hydrochloric acid. Let it stand for 60 min until stratification occurs.

[0059] 11. Alkali neutralization: Centrifuge the sample at 8228 g for 10 min at 4°C, collect the supernatant, and adjust the sample pH to 7.0 with 1000 mM sodium hydroxide (NaOH).

[0060] 12. Streptomycin sulfate combined with glacial acetic acid treatment: Collect the supernatant sample and add 136 μL of 10% w / v streptomycin sulfate and 228 μL of glacial acetic acid per mL of sample. Mix thoroughly, centrifuge at 8228 g for 5 minutes at 4°C, and collect the supernatant. In this step, streptomycin sulfate binds to negatively charged nucleic acids, forming an insoluble complex precipitate, thus removing nucleic acid contamination during protein extraction. Glacial acetic acid adjusts the pH of the solution, denaturing the protein and causing precipitation. However, alpha syn is an amorphous protein, lacking secondary structure, and can maintain its native conformation under extreme pH conditions without forming aggregates.

[0061] 13. Ammonium sulfate first and second precipitation: Add saturated ammonium sulfate solution to the sample at a ratio of 1:1. Saturated ammonium sulfate effectively destroys the surface hydration layer of alpha-syn, promoting the precipitation of alpha syn. Centrifuge at 8228g for 5 minutes at 4°C to collect the precipitate. Add 5mL of saturated ammonium sulfate solution and centrifuge at 3214g for 5 minutes at 4°C. Discard the supernatant to collect the sample precipitate. In this step, the concentration of saturated ammonium sulfate at 25°C is 76.9g / 100mL water. After the second precipitation, the white protein precipitate is as follows: Figure 2 shown.

[0062] 14. Primary and secondary treatments with ammonium acetate and anhydrous ethanol: Add 4.5 mL of 0.77% w / v ammonium acetate solution to fully dissolve the precipitate, then add 4.5 mL of anhydrous ethanol and centrifuge at 8228 g for 5 min at 4°C. Discard the supernatant, add 1 mL of 0.77% w / v ammonium acetate to dissolve the precipitate, then add 1 mL of anhydrous ethanol to mix thoroughly, and centrifuge at 3214 g for 5 min at 4°C. In this step, ammonium acetate can fine-tune the pH of the protein solution, reduce protein solubility through the "salting-out effect," and cause protein precipitation, further improving the purity of alphasyn purified from saturated ammonium sulfate.

[0063] 15. Ammonium sulfate-dissolved protein precipitate: Add 2.5 mL of 1.32% w / v ammonium sulfate to dissolve the protein precipitate and centrifuge at 3214 g for 5 min at 4°C.

[0064] 16. Protein verification: Protein samples were collected and verified by SDS-PAGE gel electrophoresis. The SDS-PAGE electrophoresis patterns of the purified A53T mutant and wild-type α-syn proteins are shown in the figure below. Figure 5 shown.

[0065] 3. Dialysis 1. Dialysis bag pretreatment and leak test: Soak the dialysis bag (molecular weight cutoff: 10kDa) in deionized water for 10 minutes to fully wet the dialysis bag. Inject deionized water into the dialysis bag to 80% of its volume, seal both ends, and let it stand for 5 minutes. After confirming that there is no leakage, discard the internal liquid.

[0066] 2. Sample Dialysis: Transfer the protein sample to be purified into a pretreated dialysis bag and seal the bag. Immerse the dialysis bag in a dialysis container containing deionized water, place it in an ice bath (0-4°C), and stir it at a low speed (50-100 rpm) with a magnetic stirrer for 2 hours. Replace with fresh deionized water and continue dialysis for 2 hours, for a total dialysis time of 4 hours.

[0067] 3. Sample post-processing: After dialysis is completed, remove the liquid from the dialysis bag and divide it into sterile centrifuge tubes (volume: 1.5 mL); place the centrifuge tubes in a -80°C ultra-low temperature freezer and freeze for 6-8 hours until the sample is completely solidified; transfer the frozen sample to a freeze dryer (vacuum degree: ≤0.1 mbar, cold trap temperature: -50°C) and freeze-dry for 24-48 hours to obtain dry protein powder. The protein powder obtained after freeze-drying should be stored in a -80°C ultra-low temperature freezer. The A53T mutant α-synuclein obtained after freeze-drying is as follows: Figure 3 As shown, the SDS-PAGE Coomassie Brilliant Blue staining images of the purified A53T mutant α-syn protein are shown in Figure 4 shown.

[0068] 4. Purity verification: The purity can be verified by observing the changes in the fluorescence signal and the absorption peak in the circular dichroism spectrum of the protein obtained after freeze-drying during the static incubation process. If no thioflavin T (ThT) fluorescence absorption is seen at the starting point, and the absorption peak of the circular dichroism spectrum is a negative peak at 197nm (representing random coiling), it means that the sample purity is high and the purified protein is a monomer. In addition, the protein can continue to be incubated in vitro at 37°C and 200rpm in a shaker, and protein samples are collected every 24 hours. The changes in the fluorescence signal and the absorption peak in the circular dichroism spectrum during the incubation process can be observed to verify that the obtained protein is indeed A53T α-synuclein. In this example, the fluorescence value of thioflavin T (ThT) was tracked and detected using a steady-state high-sensitivity fluorescence spectrometer during the incubation of the protein obtained after freeze-drying. The results are as follows: Figure 6 As shown in Figure 2, the aggregation of A53T mutant and wild-type α-synuclein followed a typical S-shaped curve, and the aggregation rate of A53T mutant was significantly faster than that of wild-type. Figure 7 As shown, compared with wild-type α-synuclein, after 72 hours of incubation in vitro, the A53T mutation significantly increased the β-folding content in the aggregates of α-synuclein, indicating that the expressed and purified A53T mutant α-synuclein does not contain other contaminants, and its aggregation tendency and aggregation speed are significantly different from those of wild-type α-synuclein.

[0069] Experimental results show that the purification method of the present invention is a more efficient, economical purification method that can maintain protein function. 20 mg of protein can be obtained from every 1 L of bacterial liquid through IPTG induction for 4 hours. This method can improve the overall effect and experimental accuracy of the preparation of unlabeled A53Tα mutant-synuclein monomers.

[0070] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A method for purifying A53T α-synuclein, characterized in that: The following steps are involved: (1) Construct a recombinant expression vector containing the α-synuclein gene encoding the A53T point mutation; (2) Transforming the recombinant expression vector obtained in step (1) into the host bacteria, inducing expression, and collecting the bacteria after centrifugation; (3) The collected bacteria are subjected to ultrasonic pulverization and centrifugation in sequence, and the supernatant after centrifugation is collected, and then the supernatant is subjected to acid precipitation and alkali neutralization in sequence; (4) treating the alkali neutralization solution obtained in step (3) with streptomycin sulfate and glacial acetic acid, then subjecting it to saturated ammonium sulfate precipitation, and centrifuging to obtain a supernatant; the ammonium sulfate precipitation includes primary precipitation and secondary precipitation; (5) The supernatant obtained in step (4) is treated with ammonium acetate and ethanol in sequence, and the protein precipitate is dissolved with ammonium sulfate to obtain a protein solution to be purified, and the solution is verified by SDS-PAGE gel electrophoresis; the ammonium acetate and ethanol treatment includes a primary treatment and a secondary treatment; (6) The purified protein solution was dialyzed in an ice bath and freeze-dried to obtain A53T α-synuclein.

2. The purification method according to claim 1, wherein In step (1), primers are designed for the α-synuclein sequence, including primers for amplifying the α-synuclein sequence, wherein the forward primer sequence is shown in SEQ ID NO. 1; The reverse primer sequence is shown in SEQ ID NO.2; A53T point mutation primers were designed for the α-synuclein sequence to amplify the α-synuclein sequence carrying the A53T mutation site. The point mutation forward primer sequence is shown in SEQ ID NO.3, and the reverse primer sequence is shown in SEQ ID NO.

4.

3. The purification method according to claim 1, wherein In step (3), in the acid precipitation step, the supernatant obtained by centrifugation is mixed with hydrochloric acid until the pH value reaches 3.5, and the mixture is allowed to stand for 60 minutes to allow stratification to occur; in the alkali neutralization step, the supernatant obtained by centrifugation is mixed with sodium hydroxide until the pH value reaches 7.0; the ultrasonic grinding condition parameters are: ice bath, intensity 30%; ultrasonication at intervals of 3 seconds on and 3 seconds off, and continuous operation for 15 minutes.

4. The purification method according to claim 1, wherein In step (3), the centrifugation condition parameters are 4°C, 8228g centrifugation for 10 minutes.

5. The purification method according to claim 1, wherein In step (4), the first precipitation step is: after mixing the supernatant with a saturated ammonium sulfate solution in a volume ratio of 1:1, centrifuging at 4°C and 8228g for 5 minutes, collecting the precipitate to obtain a protein precipitate; the second precipitation step is: after mixing the protein precipitate with 5 ml of a saturated ammonium sulfate solution, centrifuging at 4°C and 3214g for 5 minutes to obtain a protein precipitate.

6. The purification method according to claim 1, wherein In step (4), the streptomycin sulfate and glacial acetic acid treatments were as follows: 136 μL of 10% w / v streptomycin sulfate was added per 1 mL of sample, and 228 μL of glacial acetic acid was added per 1 mL of sample. After thorough mixing, the mixture was centrifuged at 4°C and 8228 g for 5 min, and the supernatant was collected.

7. The purification method according to claim 1, characterized in that In step (5), the first ammonium acetate and ethanol treatment step is as follows: add 4.5 mL of 0.77% w / v ammonium acetate solution to fully dissolve the precipitate, then add 4.5 mL of ethanol, centrifuge at 4°C and 8228g for 5 minutes, and collect the precipitate.

8. The purification method according to claim 1, wherein In step (5), the ammonium sulfate dissolution protein precipitate step is as follows: add 2.5 mL of 1.32% w / v ammonium sulfate to dissolve the protein precipitate, and centrifuge at 4°C and 3214 g for 5 minutes; the second ammonium acetate and ethanol treatment step is as follows: dissolve the collected precipitate with 1 mL of 0.77% w / v ammonium acetate, add 1 mL of ethanol and mix thoroughly, and centrifuge at 4°C and 3214 g for 5 minutes to obtain the product of the second ammonium acetate and ethanol treatment.

9. The purification method according to claim 1, wherein In step (6), the ice bath dialysis step is as follows: the sample is added to the dialysis bag, and after ice bath dialysis for 2 hours, the deionized water is replaced and dialyzed again for 2 hours to obtain the A53T α-synuclein sample.

10. The purification method according to claim 1, characterized in that In step (6), the freeze-drying step is as follows: the dialyzed protein sample is divided into centrifuge tubes, placed in a -80°C refrigerator and frozen until completely solidified, and then transferred to a freeze dryer for freeze-drying to obtain A53T α-synuclein.

Images