Paenibacillus mucilaginosus C1 with salt-tolerant, growth-promoting and water-retaining functions and application thereof
By screening and improving Bacillus subtilis C1, the problems of poor salt tolerance and limited functionality in saline-alkali land improvement were solved. This resulted in an increase in available potassium and phosphorus in saline-alkali soil, improved soil structure and water retention, and enhanced crop resistance.
Patent Information
- Application Number
- CN202511089630.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-05
- Publication Date
- 2026-04-14
- Estimated Expiration
- 2045-08-05
AI Technical Summary
Existing saline-alkali land improvement technologies are costly, prone to causing secondary pollution, or have long improvement cycles. Furthermore, existing microbial strains have poor salt tolerance and limited functions in saline-alkali environments, making it difficult to effectively improve soil structure and enhance crop resistance.
A strain of Bacillus subtilis C1 was provided, which has strong salt tolerance, high growth efficiency, significant water retention function, and high chitin degradation ability. It improves soil structure, enhances soil nutrient utilization, and strengthens the water retention function of sandy soil by secreting extracellular polysaccharides.
It significantly increases the content of available potassium and available phosphorus in saline-alkali soils, improves soil structure, enhances water retention capacity, and improves crop stress resistance. It also has a wide range of salt tolerance and efficient chitin degradation capabilities.
Smart Images

Figure CN120608000B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a mucilaginous Bacillus strain and its applications, particularly to a mucilaginous Bacillus strain C1 with salt tolerance, growth promotion, and water retention functions and its applications, belonging to the field of agricultural microbiology technology. Background Technology
[0002] Soil salinization is a significant global ecological problem, with over 1 billion hectares of saline-alkali land worldwide, including approximately 150 million hectares in China, primarily distributed in major agricultural production areas such as Northeast, North, and Northwest China. Salt stress leads to the deterioration of soil physicochemical properties (such as high osmotic pressure and ion imbalance), inhibiting plant growth and causing reduced crop yields or even crop failure. Traditional methods for improving saline-alkali land include chemical remediation (such as applying gypsum and sulfur), physical remediation (such as leaching and topsoil replacement), and planting salt-tolerant crops, but these methods suffer from drawbacks such as high costs, potential for secondary pollution, and long remediation cycles. Therefore, developing environmentally friendly, efficient, and sustainable biological remediation technologies has become a research hotspot.
[0003] Microbial inoculants, due to their green and environmentally friendly characteristics and diverse functions, have shown great potential in the remediation of saline-alkali land. Bacillus subtilis (…) Paenibacillus mucilaginosus Salt-tolerant microorganisms can dissolve insoluble phosphorus and potassium in the soil by secreting organic acids, thereby improving nutrient utilization. They also produce extracellular polysaccharides (EPS) to improve soil aggregate structure and enhance water retention. However, existing strains generally suffer from poor salt tolerance, limited functionalities, and poor environmental adaptability in saline-alkali environments. In recent years, extensive research has been conducted both domestically and internationally on the screening and application of salt-tolerant microorganisms. Currently, resources of strains simultaneously possessing salt tolerance, growth-promoting, water-retaining, and chitin-degrading properties remain relatively scarce. Summary of the Invention
[0004] Addressing the bottlenecks in existing technologies for microbial improvement of saline-alkali land, this invention aims to provide a strain of Bacillus subtilis C1 with salt tolerance, growth-promoting, and water-retaining functions. This strain exhibits strong salt tolerance, high growth-promoting efficiency, significant water-retaining capacity, and highly efficient chitin degradation ability. Through its synergistic effects, it improves soil structure in saline-alkali land, enhances water retention in sandy soil, increases soil nutrient utilization, and improves crop resistance. This strain overcomes the insufficient adaptability of traditional microbial agents in high-salt environments, providing a new technical solution for ecological restoration of saline-alkali land and sustainable agricultural development.
[0005] Another objective of this invention is to provide the application of the aforementioned Bacillus subtilis C1 in increasing available potassium and available phosphorus in saline-alkali soils and improving soil structure.
[0006] The present invention also provides the application of the above-mentioned gelatinous Bacillus C1 in improving the water retention function of sandy soil.
[0007] The technical solution adopted by the present invention to achieve the above objectives is as follows:
[0008] This invention provides a strain of Bacillus subtilis C1, which has the accession number CGMCC No. 30802 and was deposited at the China General Microbiological Culture Collection Center on May 28, 2024, and is classified and named Bacillus subtilis. Paenibacillus mucilaginosus .
[0009] The nucleotide sequence of the 16S rRNA gene of Bacillus subtilis C1 provided by the present invention is shown in SEQ ID NO.1.
[0010] This invention also provides the application of the above-mentioned Bacillus subtilis C1 in increasing available potassium and available phosphorus in saline-alkali soil under salt stress conditions.
[0011] Preferably, the salt stress refers to saline-alkali soil with a salt concentration mass ratio of not less than 2‰.
[0012] The application process of Bacillus subtilis C1 provided by this invention to increase available potassium and available phosphorus in saline-alkali soil under salt stress includes the following steps:
[0013] (1) The activated Bacillus mucilaginosus C1 seed culture was inoculated into the fermentation liquid culture medium for culture to obtain a suspension containing Bacillus mucilaginosus;
[0014] (2) Dilute the fermented Bacillus spp. suspension and apply the diluted Bacillus spp. suspension to saline-alkali soil.
[0015] Preferably, in step (1), the inoculation is performed by inoculating the activated Bacillus subtilis seed liquid at a volume ratio of 1 to 2%.
[0016] Preferably, in step (1), the fermentation liquid culture medium consists of: 10 g of sucrose, 0.5 g of dipotassium hydrogen phosphate trihydrate, 10 g of sodium chloride, 0.2 g of magnesium sulfate heptahydrate, 1.0 g of calcium carbonate, 0.5 g of yeast extract, and pH adjusted to 7.5~8.0 per 1000 mL of distilled water.
[0017] Preferably, in step (1), the culture conditions are 28~30℃ and 220 rpm for 24~48 h.
[0018] Preferably, in step (2), the concentration of the diluted Bacillus subtilis suspension is 1×10⁻⁶. 7 cfu / mL ~1×10 8 cfu / mL.
[0019] Another objective of this invention is to provide the application of the aforementioned Bacillus subtilis C1 in improving the water retention function of sandy soil.
[0020] The *Bacillus spp. C1*, a salt-tolerant and growth-promoting bacterium screened in this invention, has the following biological characteristics: its cells are short rod-shaped, produce endospores, and have a size of (0.2 μm ~ 0.5 μm) × (1.0 μm ~ 1.6 μm). When cultured on solid at 30℃, the colonies are small, round, transparent, moist, and oil-drop-shaped. With increasing culture time, the colonies rapidly increase in size and become gelatinous, exhibiting stringy texture and smooth edges when picked up. Its physiological and biochemical characteristics are: Gram-negative, aerobic, with an optimal growth temperature of 25~33℃, an optimal growth pH of 6.5~8.5, and an optimal salt concentration of 1~10%. It exhibits a wide salt tolerance range, able to grow and reproduce even at salt concentrations up to 20%, although its growth rate decreases significantly. It also possesses potassium-solubilizing, phosphorus-solubilizing, phosphorus-dissolving, chitin-degrading, and extracellular polysaccharide-producing properties.
[0021] The results of determining the 16S rRNA gene sequence of Bacillus subtilis C1 described in this invention showed that its gene length is 1402 bp, and the corresponding nucleotide sequence is shown in SEQ ID NO.1.
[0022] By using the BLASTN program from the National Center for Biotechnology Information (NCBI) for comparison and phylogenetic analysis, the strain C1 described in this invention was identified as being related to the model strain *Bacillus mucilaginosus* (…). Paenibacillus mucilaginosus The strain C1 was highly homologous to strain VKPM B-7519, with a 16S rDNA sequence similarity of up to 99.86%. Ten highly homologous 16S rDNA sequences were selected as references, and a phylogenetic tree between strain C1 and the reference strains was constructed using the Neighbour-Joining method and Mega 7 software. In the phylogenetic tree, strain C1 and *Bacillus mucilaginosus* (…) Paenibacillus mucilaginosus VKPM B-7519 forms a separate intracluster evolutionary branch. Figure 8 Therefore, it can be determined that C1 is a mucilaginous Bacillus strain. Paenibacillus mucilaginosus ).
[0023] The basic method for breeding the C1 strain of Bacillus subtilis with salt tolerance, growth promotion, water retention, and chitin degradation functions described in this invention is as follows:
[0024] Soil samples (5-10 cm depth) from saline-alkali land in the Yellow River Delta Nature Reserve were collected, mixed thoroughly in sterile self-sealing bags, and quickly placed in dry ice before being transferred to a laboratory cryopreservation unit. One g of soil was enriched in a medium with colloidal chitin as the sole carbon source and cultured at 28-30℃ and 220 rpm for 48 h. The enriched samples were then serially diluted and plated onto solid culture plates with colloidal chitin as the sole carbon source and incubated statically at 28-30℃. Single colonies with a clearly defined transparent degradation zone were picked and placed on the same culture plate. The resulting bacterial strain was purified twice. The bacteria were then cryopreserved in glycerol.
[0025] The beneficial effects of this invention are as follows:
[0026] (1) This invention discloses a gelatinous Bacillus C1 with salt tolerance and growth promotion function. This strain has the characteristics of high salt tolerance, potassium solubilization, phosphorus solubilization and phosphorus solubilization. It has a wide range of salt tolerance and can maintain good growth under salt concentration conditions of 1~10%. It has great application potential in saline-alkali soil remediation.
[0027] (2) Through multiple rounds of screening, this invention obtained a strain capable of both degrading chitin and secreting extracellular polysaccharides. This strain can efficiently degrade chitin and simultaneously secrete large amounts of extracellular polysaccharides, exhibiting excellent water retention capabilities. This strain has high application prospects and economic value in the control of agricultural pathogenic fungi and water retention in sandy soils.
[0028] Preservation Information
[0029] Preservation date: May 28, 2024;
[0030] Preservation institution: China General Microbiological Culture Collection Center, China Committee on the Preservation and Management of Microbial Culture Collections;
[0031] Accession number: CGMCC NO.30802;
[0032] Address of the depository: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing;
[0033] Postal code: 100101;
[0034] Classification and nomenclature: Gel-like Bacillus Paenibacillus mucilaginosus . Attached Figure Description
[0035] Figure 1 Cell morphology of Bacillus subtilis C1 under a microscope;
[0036] Figure 2 The colony morphology of Bacillus subtilis C1;
[0037] Figure 3Colony morphology of Bacillus subtilis C1 under high-salt conditions;
[0038] Figure 4 The graph shows the degradation effect of Bacillus subtilis C1 on chitin; where A represents the solid degradation effect and B represents the liquid degradation effect.
[0039] Figure 5 The potassium-solubilizing effect of Bacillus subtilis C1 is shown in the figure.
[0040] Figure 6 The graph shows the phosphorus solubilization (organic phosphorus) effect of Bacillus subtilis C1.
[0041] Figure 7 The image shows the phosphorus-solubilizing (inorganic phosphorus) effect of Bacillus subtilis C1.
[0042] Figure 8 Phylogenetic tree between Bacillus spp. C1 and reference strain;
[0043] Figure 9 State of bacterial culture after 48 hours in liquid culture;
[0044] Figure 10 Extracellular polysaccharides extracted from the fermentation broth of Bacillus subtilis C1; where A is a photograph of the extracellular polysaccharides extracted with ethanol, and B is the extracellular polysaccharide.
[0045] Figure 11 A real-life photo of a soil column used in a test of the water retention of sand by a solution of Bacillus subtilis C1.
[0046] Figure 12 Curve showing the change in water migration distance over time in a soil column experiment;
[0047] Figure 13 The growth-promoting effect of Bacillus subtilis on rice seedlings. Detailed Implementation
[0048] The present invention will now be described in detail with reference to specific accompanying drawings and embodiments. The examples described below are merely preferred embodiments of the present invention. It should be noted that the following description is only for explaining the present invention and is not intended to limit the present invention in any way. Any simple modifications, equivalent changes, and alterations made to the embodiments based on the technical essence of the present invention shall fall within the scope of the technical solution of the present invention.
[0049] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.
[0050] Example 1: Screening of salt-tolerant mucilaginous spore-forming bacteria
[0051] (1) Soil samples of 5-10 cm depth from the saline-alkali land of the Yellow River Delta Nature Reserve were placed in clean sampling bags, mixed thoroughly, labeled, and placed in an ice box to be brought back to the laboratory and stored at -80℃ for later use. 1 g of soil sample was weighed in a sterile laminar flow hood and placed in an Erlenmeyer flask containing 20 mL of liquid culture medium with colloidal chitin as the sole carbon source. The flask was then incubated at 30℃ and 220 rpm for 48 hours. Under sterile conditions, 1 mL of the culture medium was thoroughly mixed with 9 mL of sterile water, and then serially diluted to prepare 10 mL of the culture medium. -1 10 -3 10 -5 For sample solutions of different dilutions, 0.2 mL of each solution was plated onto a solid culture plate containing colloidal chitin as the sole carbon source. The plates were incubated upside down at 30°C for 2–5 days, and the presence of transparent degradation zones was observed. Single colonies from the degradation zones were transferred to identical solid culture plates, numbered sequentially, and cultured. After two streaking operations, pure cultures of the bacterial strain were obtained.
[0052] (2) Pick a single colony with an inoculation loop and transfer it to a test tube containing 5 mL of liquid culture medium with colloidal chitin as the only carbon. Incubate at 30℃ and 220 rpm for 24 h with shaking. Perform strain preservation and 16S rDNA sequencing. The strain was preserved by cryopreservation in glycerol tubes. Add 200 μL of glycerol (final glycerol concentration of 20%) and 800 μL of bacterial solution to the cryopreservation tubes, mix well, and store in an ultra-low temperature freezer at -80℃.
[0053] Among the screened strains, one strain produced a very significant chitin clear degradation zone ( Figure 4 (As shown in A and B). When cultured on solid at 30℃, the colonies are round, oil droplet-shaped, with a gel-like surface, translucent, and smooth and moist. Figure 2 The inoculation loop picks up the inoculation material in a stringy state, and it is then inoculated under conditions of 10% salt content (NaCl). Figure 3 It can still reproduce normally. This strain is numbered C1 and has been preliminarily identified as the selected strain C1 for this invention.
[0054] The liquid culture medium with the above-mentioned colloidal chitin as the sole carbon source consists of: 5 g of colloidal chitin, 0.5 g of yeast extract, 1.0 g of potassium dihydrogen phosphate, 1 g of ammonium sulfate, 0.3 g of magnesium sulfate, 0.02 g of ferrous sulfate, 30 g of sodium chloride, and 3 g of yeast extract per 1000 mL of distilled water, adjusted to pH 7.5-8.0 (the solid culture plate also contains 15 g of agar powder).
[0055] Example 2: Optimization of Culture Conditions for Strains C1
[0056] Strain C1 was inoculated onto LB agar plates and incubated at 30°C for 24 hours, but no colonies were observed to grow. However, when strain C1 was inoculated onto LB agar plates diluted 5, 10, and 100 times with both carbon and nitrogen sources, normal colony growth was observed after incubation at 30°C for 24 hours. These results indicate that strain C1 is more suitable for growth under oligotrophic conditions and may be more easily colonized in soil, showing good potential for agricultural applications. Further optimization of the carbon and nitrogen sources yielded the optimal fermentation medium for the strain. Figure 2 , Figure 9 ).
[0057] The LB solid culture medium, diluted 10 times with the above carbon and nitrogen sources, consists of: 1 g peptone, 0.5 g yeast extract, 30 g sodium chloride, and 15 g agar powder per 1000 mL of distilled water, with the pH adjusted to 7.5-8.0.
[0058] The fermentation medium consists of 10 g sucrose, 0.5 g dipotassium hydrogen phosphate trihydrate, 10 g sodium chloride, 0.2 g magnesium sulfate heptahydrate, 1.0 g calcium carbonate, and 0.5 g yeast extract per 1000 mL of distilled water, with the pH adjusted to 7.5-8.0.
[0059] Example 2: Morphological observation and physiological and biochemical identification of strain C1
[0060] The morphology of strain C1 cells was observed using a microscope.
[0061] The physiological and biochemical characteristics of strain C1 were identified at a culture temperature of 30℃. The biological characteristics of strain C1 are: short rod-shaped, producing endospores, with cell size of (0.2 μm ~ 0.5 μm) × (1.0 μm ~ 1.6 μm). Figure 1 When cultured in a solid medium at 30℃, the colonies initially appear as round cells. As the culture time increases, the colonies enlarge and gradually become irregularly round, gelatinous, raised, colorless and transparent, with a very moist surface. They exhibit a stringy texture when picked up. Figure 2 ).
[0062] The physiological and biochemical characteristics of strain C1 are as follows: Gram-negative, aerobic, with an optimal growth temperature of 28-32℃ and an optimal growth pH of 6.5-8.0. It can grow normally in a salt concentration range of 1-10% and has enzyme activities such as esterase, lipoesterase, acid phosphatase, naphthol-AS-BI-phosphohydrolase, α-glucosidase, N-acetyl-glucosaminease, and chitinase.
[0063] The results of 16S rRNA gene sequence determination of the screened strain C1 showed that its gene length was 1402 bp, and the corresponding nucleotide sequence is shown in SEQ ID NO.1.
[0064] The selected strain was identified as a Bacillus subtilis strain by comparison and phylogenetic analysis using the BLASTN program from the National Center for Biotechnology Information (NCBI). Paenibacillus mucilaginosus ), namely, Bacillus colloidis C1.
[0065] Ten highly homologous 16S rDNA sequences were selected as references. A phylogenetic tree between strain C1 and the reference strains was constructed using the Neighbour-Joining method and Mega 7 software. In the phylogenetic tree, strain C1 and the model strain of *Bacillus mucilaginosus* were compared. Paenibacillus mucilaginosus strain VKPMB-7519 forms a separate intracluster evolutionary branch. Figure 8 ).
[0066] The composition of the solid culture medium used for observing bacterial cell morphology is as follows: 1 g of peptone, 0.5 g of yeast extract, 10 g of sodium chloride, and 15 g of agar powder per 1000 mL of distilled water, with the pH adjusted to 7.5-8.0.
[0067] Example 3: Functional analysis of strain C1 in potassium solubilization, phosphorus solubilization, and phosphorus lysis.
[0068] A single colony of the isolated strain C1 was transferred to a test tube containing 5 mL of liquid culture medium and cultured with shaking at 30℃ and 220 rpm for 24 h. 10 μL of the culture was then inoculated onto potassium-solubilizing medium and incubated at 30℃ for 3 days. The presence of transparent oil droplet-like colonies on the agar plates was observed. The results showed that after 24 hours of culture on potassium-solubilizing medium, transparent oil droplet-like colonies grew on the plates, indicating that strain C1 can dissolve potassium feldspar and possesses potassium-solubilizing properties. Figure 5 ).
[0069] A single colony of the isolated strain C1 was transferred to a test tube containing 5 mL of liquid culture medium and cultured with shaking at 30℃ and 220 rpm for 24 h. 10 μL of the seed culture was then inoculated onto organophosphate solid medium and cultured at 30℃. The presence of a clear degradation zone around the colony was observed. The results showed that after 2 days of culture on organophosphate solid medium, a clear degradation zone appeared around the colony of strain C1. Upon further culture, the degradation zone significantly increased in size, indicating that strain C1 can rapidly dissolve organophosphates and possesses strong phosphorus-solubilizing properties. Figure 6 ).
[0070] A single colony of the isolated strain C1 was transferred to a test tube containing 5 mL of liquid culture medium and cultured with shaking at 30℃ and 220 rpm for 24 h. 10 μL of the seed culture was then inoculated onto inorganic phosphorus solid culture medium and cultured in a 30℃ incubator. After 3 days of culture, a clear transparent degradation zone appeared around the colony, indicating that strain C1 can dissolve inorganic phosphorus and possesses phosphorus-soluble properties. Figure 7 ).
[0071] The liquid culture medium consists of 1 g peptone, 0.5 g yeast extract, and 10 g sodium chloride per 1000 mL of distilled water, with the pH adjusted to 7.5-8.0.
[0072] The composition of the potassium-solubilizing medium is as follows: per 1000 mL of distilled water, there are 5 g of sucrose, 0.5 g of ammonium sulfate, 0.5 g of yeast extract, 0.3 g of magnesium sulfate, 2 g of disodium hydrogen phosphate, 0.03 g of ferrous sulfate, 0.03 g of manganese sulfate, 2 g of potassium feldspar, 15 g of agar powder, and pH 7.5.
[0073] The composition of the above-mentioned organophosphorus solid culture medium is as follows: per 1000 mL of distilled water, there are 10 g of glucose, 0.5 g of ammonium sulfate, 10 g of sodium chloride, 0.3 g of magnesium sulfate, 0.03 g of manganese sulfate, 0.3 g of potassium chloride, 0.03 g of ferrous sulfate, 2.0 g of lecithin, 15 g of agar powder, and pH 7.5.
[0074] The components of the above inorganic phosphorus solid culture medium are: 10 g glucose, 0.5 g ammonium sulfate, 10 g sodium chloride, 0.3 g magnesium sulfate, 0.03 g manganese sulfate, 0.3 g potassium chloride, 0.03 g ferrous sulfate, 5.0 g calcium phosphate, 15 g agar powder, and pH 7.5 per 1000 mL of distilled water.
[0075] Example 4: Method for identifying the 16S rRNA gene of strain C1
[0076] Total genomic DNA was extracted from the isolated and purified strain C1 according to the instructions of the BioTeKe bacterial genome extraction kit. The extracted total genomic DNA was detected by 1% agarose gel electrophoresis at 175V for 20 minutes. The 16S rRNA gene of the isolated strain was amplified using upstream primer 27F (5'-3': AGAGTTTGATCCTGGCTCAG) as shown in SEQ ID NO.2 and downstream primer 1492R (5'-3': GGTTACCTTGTTACGACTT) as shown in SEQ ID NO.3. The PCR reaction system and conditions are shown in Tables 1 and 2.
[0077] Table 1. PCR reaction system for the purified strain C1's 16S rRNA gene.
[0078]
[0079] Table 2 PCR reaction program settings
[0080]
[0081] PCR products were detected by 1% agarose gel electrophoresis at 175V for 20 minutes. Using a gel imaging system, the PCR signal for the 16S rRNA gene was observed near the 1.5 kbp marker band. After excising the desired band, the PCR products were purified and recovered according to the instructions of the agarose gel extraction kit. The purified and recovered PCR products were sent to a sequencing company for sequencing.
[0082] The results of the 16S rRNA gene sequence determination of strain C1 showed that its gene length was 1402 bp, and the corresponding nucleotide sequence is shown in SEQ ID NO.1.
[0083] The specific sequence is as follows:
[0084]
[0085] The 16S rRNA gene sequence obtained from sequencing was submitted to the NCBI database (http: / / www.ncbi.nlm.nih.gov) for BLASTN comparison. The results showed that the 16S rRNA of this strain was similar to that of Bacillus subtilis (Bacillus subtilis). Paenibacillus mucilaginosus The similarity between strain C1 and the reference strain VKPM B-7519 was 99.86%. Ten highly homologous 16S rDNA sequences were selected as references, and a phylogenetic tree between strain C1 and the reference strains was constructed using Mega 7 software with the neighbor-joining method. In the phylogenetic tree, strain C1 and the Bacillus subtilis type strain... Paenibacillus mucilaginosus strain VKPM B-7519 forms a separate intracluster evolutionary branch. Figure 8 Therefore, it was named Bacillus colloidis C1.
[0086] Example 5: Application of strain C1 in chitin degradation
[0087] (1) Selection of strain: Bacillus subtilis strain C1.
[0088] (2) Activation of strains: Inoculate the strains onto activated solid culture plates and incubate them at 28-30℃ for 24-48 hours for later use.
[0089] (3) Pick the colonies from step (2) and inoculate them into a liquid culture medium containing 5 mL of colloidal chitin as the sole carbon source, and incubate at 30°C and 220 rpm for 24 h.
[0090] (4) Degradation of chitin: Take 5 μL and spot it onto a colloidal chitin solid plate. At the same time, inoculate the activated seed liquid into a liquid culture medium containing chitin as the sole carbon source at an inoculation rate of 1%. Place the solid plate in a static culture at 30°C and the liquid in a culture at 30°C and 220 rpm for 3-5 days. Observe the degradation zone of chitin on the plate and the degradation of chitin in the liquid.
[0091] The results showed that a transparent degradation zone of chitin was clearly visible after one day of fermentation, and the degradation zone significantly increased in size after three days of fermentation. Figure 4 As shown in A, the colloidal chitin in the liquid culture medium was also significantly reduced. After 3 days of culture, the colloidal chitin in the liquid culture medium was completely degraded (e.g., Figure 4 As shown in B in the figure, this indicates that Bacillus subtilis has great potential for application in chitin degradation.
[0092] The composition of the activated solid culture plate of Bacillus spp. C1 is as follows: per 1000 mL of distilled water, there are 10 g of sucrose, 0.5 g of dipotassium hydrogen phosphate trihydrate, 10 g of sodium chloride, 0.2 g of magnesium sulfate heptahydrate, 1.0 g of calcium carbonate, 0.5 g of yeast extract, and 15 g of agar powder, and the pH is adjusted to 7.5~8.0.
[0093] The composition of the above-mentioned liquid culture medium with colloidal chitin as the sole carbon source is as follows: per 1000 mL of distilled water, there are 5 g of colloidal chitin, 0.5 g of yeast extract, 1.0 g of potassium dihydrogen phosphate, 1 g of ammonium sulfate, 0.3 g of magnesium sulfate, 0.02 g of ferrous sulfate, 30 g of sodium chloride, and 3 g of yeast powder, with the pH adjusted to 7.5~8.0.
[0094] Example 6: Extraction of extracellular polysaccharides from fermentation broth of strain C1
[0095] (1) Strain selection: Bacillus subtilis strain C1;
[0096] (2) Activation of strain: Inoculate the strain onto a solid culture medium for strain activation and incubate at 28-30℃ for 24-48 h for later use;
[0097] (3) Seed culture: Pick the colonies from step (2) and inoculate them into a liquid seed culture medium containing 5 mL, and culture them at 30℃ and 220 rpm for 12-24 h;
[0098] (4) Fermentation culture: The seed liquid was inoculated into an Erlenmeyer flask (500 mL) containing 200 mL of fermentation medium at a 1% inoculation rate and cultured at 30℃ and 220 rpm for 48 h to obtain the fermentation broth of Bacillus subtilis;
[0099] (5) Extraction of extracellular polysaccharides with ethanol: Add 4 times the volume of anhydrous ethanol to the fermentation broth, i.e., the volume ratio of fermentation broth to anhydrous ethanol is 1:4. After mixing, let it stand overnight at 4℃. Flocculent suspensions can be observed. Figure 10 The A in the sample is picked up with a clean glass rod and transferred to a petri dish; this is the extracted extracellular polysaccharide. Figure 10 (B in the middle).
[0100] The composition of the above-mentioned activated solid culture medium and liquid seed culture medium for Bacillus subtilis C1 is as follows: per 1000 mL of distilled water, there are 10 g of sucrose, 0.5 g of dipotassium hydrogen phosphate trihydrate, 10 g of sodium chloride, 0.2 g of magnesium sulfate heptahydrate, 1.0 g of calcium carbonate, and 0.5 g of yeast extract, adjusted to pH 7.5-8.0. (Note: 15 g of agar powder is added to the solid culture medium).
[0101] Example 7: Application of strain C1 in enhancing the water retention capacity of sandy soil
[0102] (1) Selection of strain: Bacillus subtilis strain C1.
[0103] (2) Activation of strains: Inoculate the strains onto a solid culture medium for strain activation and incubate at 28-30°C for 24-48 h for later use.
[0104] (3) Seed culture: Pick the colonies from step (2) and inoculate them into a liquid seed culture medium containing 5 mL, and culture them at 30℃ and 220 rpm for 12-24 h.
[0105] (4) Fermentation culture: The seed liquid was inoculated into an Erlenmeyer flask (500 mL) containing 200 mL of fermentation medium at a 1% inoculation rate and cultured at 30℃ and 220 rpm for 48 h to obtain a bacterial suspension containing Bacillus mucilaginosus. The suspension was then diluted 5 times and 10 times for later use.
[0106] (5) Soil column device: Use an acrylic soil column device with an inner diameter of 10 cm and a height of 70 cm, and install drainage valves at the middle and bottom of the column. Add sand (taken from the 0-20cm topsoil layer of Caoxian County, Heze City, Shandong Province) into the soil column. The sand filling height in the soil column is 65 cm, leaving a 5 cm gap at the top of the column for the flow of tap water. Figure 11 ).
[0107] (6) Soil column seepage test: Three groups were set up in the experiment: CK (blank control group), D5 (diluted 5 times) and D10 (diluted 10 times). 50ml of tap water, 5 times diluted bacterial solution and 10 times diluted bacterial solution were sprayed into the three groups respectively. After spraying and standing for 1 hour, water was added to the column in a laminar flow so that the water level was 5cm higher than the soil layer. The water migration distance (the distance of the seeping water to the top of the soil column) was measured at 5 min, 15 min, 30 min, 60 min, 120 min, 180 min, 240 min and 300 min respectively. Water addition was stopped when water leaked from the bottom drain valve and the time was recorded. At the same time, the migration time of the water migration peak to the middle and bottom of the column was recorded.
[0108] The results showed that the water migration rate of the sand column with added diluted bacterial solution was significantly reduced. Figure 12 The time for the water migration peaks at D5 and D10 to reach the middle of the column was 8.6 times and 4.6 times that of the control group, respectively, and the time to reach the bottom of the column was 7 times and 3 times that of the control group, respectively. Therefore, it can be determined that the fermentation broth of Bacillus subtilis can effectively prolong the retention time of water in sandy soil and enhance the water retention capacity of sandy soil. The average migration rates of CK, D5, and D10 were approximately 13 cm / h, 1.8 cm / h, and 4.3 cm / h, respectively.
[0109] Table 3. Duration of the wetting peak's migration to the middle and bottom of the column.
[0110]
[0111] The composition of the above-mentioned activated solid culture medium and liquid seed culture medium for Bacillus subtilis C1 is as follows: per 1000 mL of distilled water, there are 10 g of sucrose, 0.5 g of dipotassium hydrogen phosphate trihydrate, 10 g of sodium chloride, 0.2 g of magnesium sulfate heptahydrate, 1.0 g of calcium carbonate, and 0.5 g of yeast extract, adjusted to pH 7.5-8.0. (Note: 15 g of agar powder is added to the solid culture medium).
[0112] Example 8: Application of strain C1 in alleviating the growth inhibition effect of salt stress on rice
[0113] (1) Selection of strain: Bacillus subtilis strain C1.
[0114] (2) Activation of strains: Inoculate the strains onto a solid culture medium for strain activation and incubate at 28-30°C for 24-48 h for later use.
[0115] (3) Seed culture: Pick the colonies from step (2) and inoculate them into a liquid seed culture medium containing 5 mL, and culture at 30℃ and 220 rpm for 12-24 h.
[0116] (4) Fermentation culture: Inoculate the seed liquid with 1% inoculation into an Erlenmeyer flask (500 mL) containing 200 mL of fermentation medium, and culture at 30℃ and 220 rpm for 48 h to obtain a bacterial suspension containing Bacillus spp. C1 for later use.
[0117] (5) Relief of the inhibitory effect of salt stress on rice growth and detection of soluble potassium and phosphorus in soil: Rice seeds were first soaked in tap water for 24±2 h. Seeds of uniform size and fullness were taken and evenly arranged in flower pots (30 cm × 24 cm × 9 cm) containing an equal amount of sterilized nutrient soil irrigated with 7‰ NaCl solution. The C1 bacterial suspension prepared by fermentation was diluted 10 times to obtain the C1 bacterial suspension. The C1 diluted bacterial suspension was poured into the flower pots of the experimental group, while the inactivated bacterial suspension was used as a control. 7‰ NaCl solution was poured into all flower pots. The 7‰ NaCl solution irrigation treatment was carried out once every other day. After ten days, the growth of rice seedlings was observed, and the content of soluble potassium and soluble phosphorus in the soil around the rice roots was detected. Each treatment was repeated in three replicates, and 40 rice seeds were placed in each replicate.
[0118] The results showed that under continuous irrigation with 7‰ NaCl solution, the rice seedlings in the experimental group exhibited significantly better growth than those in the control group, demonstrating that strain C1 can significantly alleviate the inhibitory effect of salt stress on rice seedling growth. Figure 13By measuring the physicochemical indicators of rice root zone soil (Table 4), it was found that the contents of soluble potassium and soluble phosphorus in the rice root zone soil with added C1 bacterial solution were significantly increased compared with the control group, with the highest increase in soluble potassium content reaching 46.1% and the highest increase in soluble phosphorus content reaching 36.6%.
[0119] Table 4. Detection results of soluble phosphorus and soluble potassium in rice root zone soil.
[0120]
[0121] The composition of the above-mentioned activated solid culture medium and liquid seed culture medium for Bacillus subtilis C1 is as follows: per 1000 mL of distilled water, there are 10 g of sucrose, 0.5 g of dipotassium hydrogen phosphate trihydrate, 10 g of sodium chloride, 0.2 g of magnesium sulfate heptahydrate, 1.0 g of calcium carbonate, and 0.5 g of yeast extract, adjusted to pH 7.5-8.0. (Note: 15 g of agar powder is added to the solid culture medium).
Claims
1. The application of a gelatinous Bacillus C1 in improving the water retention function of sandy soil, characterized in that, The *Bacillus lentigines* C1, with accession number CGMCC No. 30802, was deposited at the China General Microbiological Culture Collection Center on May 28, 2024, and classified as *Bacillus lentigines*. Paenibacillus mucilaginosus The nucleotide sequence of the 16S rRNA gene of the Bacillus spp. C1 is shown in SEQ ID NO.
1. The Bacillus spp. C1 has enzyme activities such as esterase, lipoesterase, acid phosphatase, naphthol-AS-BI-phosphohydrolase, α-glucosidase, N-acetyl-glucosaminease, and chitinase.
2. An application of the Bacillus subtilis C1 as described in claim 1 to increase available potassium and available phosphorus in saline-alkali soil under salt stress conditions.
3. The application according to claim 2, characterized in that, Salt stress refers to saline-alkali soils where the salt concentration by mass ratio is not less than 2‰.
4. The application according to claim 2 or 3, characterized in that, Includes the following steps: (1) The activated Bacillus mucilaginosus C1 seed culture was inoculated into the fermentation liquid culture medium for culture to obtain a suspension containing Bacillus mucilaginosus; (2) Dilute the fermented Bacillus spp. suspension and apply the diluted Bacillus spp. suspension to saline-alkali soil.
5. The application according to claim 4, characterized in that, In step (1), the inoculation is carried out by inoculating the activated Bacillus mucilaginosus seed liquid at a volume ratio of 1 to 2%.
6. The application according to claim 4, characterized in that, In step (1), the fermentation liquid culture medium consists of 10 g of sucrose, 0.5 g of dipotassium hydrogen phosphate trihydrate, 10 g of sodium chloride, 0.2 g of magnesium sulfate heptahydrate, 1.0 g of calcium carbonate, and 0.5 g of yeast extract per 1000 mL of distilled water, with the pH adjusted to 7.5~8.
0.
7. The application according to claim 4, characterized in that, In step (1), the culture conditions are 28~30℃ and 220 rpm for 24~48 h.
8. The application according to claim 4, characterized in that, In step (2), the concentration of the diluted Bacillus subtilis suspension is 1×10⁻⁶. 7 cfu / mL ~1×10 8 cfu / mL.
Citation Information
Patent Citations
Paenibacillus mucilaginosus N6 and application thereof
CN105950505A
Paenibacillus mucilaginosus HB-02 strain and application thereof in promoting crop growth
CN114908025A
Saline-alkaline tolerant strain and culture method and application thereof
CN119592446A