Construction and optimization of recombinant bacteria for synthesizing anti-ultraviolet compound gadusol and derivatives thereof

Abstract

The invention discloses recombinant escherichia coli for producing gadusol and a preparation method of the recombinant escherichia coli. The invention belongs to the field of daily chemicals and synthetic biology, and particularly relates to recombinant escherichia coli for producing gadusol and a preparation method of the recombinant escherichia coli. The recombinant escherichia coli provided by the invention can be used for synthesizing gadusol at a high level, the production period is short, the thallus culture is simple, and the production capacity is obviously improved compared with that of a traditional method.

Description

Technical Field

[0001] The invention relates to the construction and application of an Escherichia coli strain for synthesizing an anti-ultraviolet compound gadusol and derivatives thereof, belonging to the field of biotechnology. Background Art

[0002] With the depletion of the ozone layer and global warming brought about by industrial development, the intensity of ultraviolet (UV) radiation at the Earth's surface has been increasing annually. UV radiation can be categorized by wavelength as UVA (315-400 nm), UVB (280-315 nm), and UVC (100-280 nm). UVA and UVB penetrate the atmosphere directly to the Earth's surface, accounting for 95% and 5% of the UV radiation reaching the surface, respectively (UVC is blocked by the ozone layer). Although UVB has a lower concentration, it is more damaging than UVA. UVB acts directly on the epidermis, and even short-term exposure can cause inflammatory reactions such as erythema, pain, and blisters. Long-term exposure significantly increases the risk of skin cancer by inducing DNA damage (such as pyrimidine dimer formation). Furthermore, UVB damages the skin barrier and exacerbates the photoaging process. Its biological hazards have been well-documented through epidemiological studies, such as the surge in skin cancer incidence in areas with high radiation levels.

[0003] Traditional UV protection systems primarily rely on a dual strategy of physical and chemical sunscreens. Physical sunscreens, such as titanium dioxide and zinc oxide, work by reflecting or scattering UV rays, but they can suffer from drawbacks such as a heavy feel and the tendency to leave white marks. Chemical sunscreens, such as avobenzone and octocrylene, protect by absorbing UV energy, but they generally face significant challenges such as poor photostability (for example, avobenzone degrades by 36% after exposure to light), sensitization risks (oxybenzone has been shown to have endocrine disrupting effects), and environmental toxicity (oxybenzone causes coral bleaching). Furthermore, some chemical sunscreen ingredients, when stimulated by UV rays, generate free radicals such as singlet oxygen, which can exacerbate oxidative stress in the skin. These limitations have prompted researchers to turn their attention to naturally derived biosunscreen molecules. Gadusol, derived from marine organisms, has become a focus of research due to its unique protective mechanism and superior UVB absorption.

[0004] Gadusol (3,5,6-Trihydroxy-5-(hydroxymethyl)-2-methoxy-2-cyclohexen-1-one) is the first endogenous UV-protective substance discovered in cod eggs. Gadusol exists in enol isomers at different pH levels, with the enol form (gadusol) predominating at lower pH levels and the enolate form (gadusolate) predominating at neutral and alkaline pH levels. At pH 2.5, gadusol absorbs UV light at 270 nm, and at pH 7.0, at 294 nm. Compared to chemical sunscreens, gadusol exhibits three core advantages: First, it exhibits excellent photostability, retaining over 70% of its active ingredient after 8 hours of simulated sunlight exposure. Second, it can directly scavenge ROS and activate the Nrf2-ARE antioxidant pathway, forming a dual "prevention-repair" protective network. Third, experiments in zebrafish embryos have demonstrated that its embryotoxicity (LC50 > 500 μM) is significantly lower than that of conventional sunscreens. However, the industrial production of gadusol has long been constrained by three major technical bottlenecks: first, natural extraction is limited by its extremely low content in marine organisms (the concentration in cod eggs is only 0.02%) and the problem of unsustainable species resources; second, the chemical synthesis route involves thiolation reactions and the construction of chiral centers, resulting in complex processes (requiring 8 reaction steps), low yields (total yield <15%) and environmental pollution; finally, although genetic engineering (such as constructing engineered strains to optimize metabolic pathways) and biosynthesis technologies (such as screening for key enzyme genes) have initially achieved microbial production of gadusol, its industrialization still faces bottlenecks such as low yield, unstable fermentation process, and high cost.

[0005] This patent focuses on breaking through the technical barriers to large-scale production of gadusol. By using E. coli as the chassis, innovating biosynthesis strategies and process optimization, it aims to develop efficient and environmentally friendly gadusol-based sunscreen products to provide solutions for protecting against UVB damage. Summary of the Invention

[0006] The purpose of the present invention is to provide an Escherichia coli construction method and application for synthesizing the anti-ultraviolet compound gadusol and its derivatives.

[0007] In a first aspect, the present invention provides a recombinant Escherichia coli, wherein the recombinant Escherichia coli comprises the following characteristics:

[0008] A1), does not contain the transaldolase B (talB) gene;

[0009] A2), does not contain the transaldolase A (talA) gene;

[0010] A3), does not contain the phosphohexose isomerase (pgi) gene;

[0011] A4) containing substances that regulate the expression of the transketolase A (tktA) gene or regulate the activity or content of transketolase A;

[0012] A5), does not contain the pyruvate formate lyase (pflB) gene;

[0013] A6) containing substances that regulate the expression of the 6-phosphate glucose dehydrogenase (zwf) gene or the activity or content of 6-phosphate glucose dehydrogenase;

[0014] A7) containing substances that regulate the expression of the 6-phosphogluconolactonase (pgl) gene or the activity or content of 6-phosphogluconolactonase;

[0015] A8) containing substances that regulate the expression of 6-phosphogluconate dehydrogenase (gnd) gene or regulate the activity or content of 6-phosphogluconate dehydrogenase;

[0016] A9), containing the 2-epimal-5-epimal-valinone synthase (EEVS) gene;

[0017] A10), containing the methyltransferase-oxidoreductase (MTox) gene;

[0018] Furthermore, in the recombinant Escherichia coli, the recombinant Escherichia coli also includes the following characteristics:

[0019] A11), does not contain the L-methionine synthesis transcription factor (metJ) gene;

[0020] A12) containing substances that regulate the expression of the L-methionine adenosyltransferase (metK) gene or the activity or content of L-methionine adenosyltransferase;

[0021] A13) containing substances that regulate the expression of the S-adenosyl-L-homocysteine ​​hydrolase (SAHase) gene or the activity or content of S-adenosyl-L-homocysteine ​​hydrolase;

[0022] Furthermore, in the recombinant Escherichia coli, the recombinant Escherichia coli also includes the following characteristics:

[0023] A14) containing substances that regulate the expression of adenine phosphoribosyltransferase (apt) gene or regulate the activity or content of adenine phosphoribosyltransferase;

[0024] A15) Contains substances that regulate adenylate kinase (ADK) gene expression or regulate adenylate kinase activity or content;

[0025] A16), does not contain the 5'-nucleotidase diphosphatase (ushA) gene;

[0026] A17), does not contain adenosine deaminase (add) gene;

[0027] A18), does not contain the AMP nucleosidase (amn) gene;

[0028] A19), does not contain the pyruvate oxidase (poxB) gene;

[0029] A20), containing a gene encoding adenosine kinase (Ado1) and / or containing substances that regulate adenosine kinase gene expression or adenosine kinase activity or content;

[0030] Furthermore, in the recombinant Escherichia coli, the regulation may be upregulation, promotion or improvement.

[0031] Furthermore, in the recombinant Escherichia coli, the substances described in A4), A13), A14), and A15) are promoters, and the promoter is P CPA1 ;

[0032] Furthermore, in the recombinant Escherichia coli, the substances described in A6), A7), A8), A12), and A20) are promoters, and the promoters are P 119 .

[0033] Furthermore, in the recombinant Escherichia coli, the P CPA1 The nucleotide sequence is SEQ ID No.1.

[0034] Furthermore, in the recombinant Escherichia coli, the P 119 The nucleotide sequence is SEQ ID No.2.

[0035] Furthermore, in the recombinant Escherichia coli, the 2-epimal-5-epimal-valinone synthase (EEVS) gene described in A9) can be derived from Streptomyces sp. CG1, Danio aesculapii, or Streptomyces olivaceoviridis.

[0036] Furthermore, in the recombinant Escherichia coli, the methyltransferase-oxidoreductase (MTox) gene described in A10) can be derived from zebrafish (Danio aesculapii) or Saitoella complicate NRRL Y-17804.

[0037] Furthermore, in the recombinant Escherichia coli, the S-adenosyl-L-homocysteine ​​hydrolase (SAHase) gene described in A13) can be derived from Saccharomyces cerevisiae S288C.

[0038] In a second aspect, the present invention provides a method for preparing the above-mentioned recombinant Escherichia coli, wherein the method uses Escherichia coli as a recipient bacterium and comprises the following preparation steps:

[0039] M1), knocking out the transaldolase B (talB) gene of claim 1 in the recipient bacteria;

[0040] M2), knocking out the transaldolase A (talA) gene of claim 1 in the recipient bacteria;

[0041] M3), knocking out the glucose-6-phosphate isomerase (pgi) gene of claim 1 in the recipient bacteria;

[0042] M4), knock out the wild-type promoter that drives the expression of the transketolase A (tktA) gene in the recipient bacteria and replace it with the P CPA1 ;

[0043] M5) Knock out the pyruvate formate lyase (pflB) gene in the recipient bacterium as described in claim 1 and replace it with the constitutive promoter P119 and the gene encoding 6-phosphogluconolactonase zwf, the gene encoding 6-phosphogluconolactonase pgl, and the gene encoding 6-phosphogluconate dehydrogenase gnd.

[0044] M6), introducing the 2-epimal-5-epimal-valinone synthase (EEVS) gene into the recipient bacteria;

[0045] M7), introducing the methyltransferase-oxidoreductase (MTox) gene into the recipient bacteria;

[0046] Furthermore, the 2-epimal-5-epimal-valinone synthase encoding gene EEVS can be introduced into recombinant Escherichia coli in the form of pXB1K-EEVS.

[0047] Furthermore, the methyltransferase-oxidoreductase encoding gene Mtox can be introduced into recombinant E. coli in the form of pLB1A-MTox. Furthermore, in the method described above, the 2-epi-5-epi-valinone synthase encoding gene EEVS described in M7) and the methyltransferase-oxidoreductase encoding gene Mtox described in M8) can be introduced into recombinant E. coli in the form of pXB1K-EEVS-MTox or pXB1K-MTox-EEVS.

[0048] Furthermore, in the method described above, the method further comprises the following preparation steps:

[0049] M8), knocking out the L-methionine transcription factor (metJ) gene of claim 1 in the recipient bacteria and replacing it with the above-mentioned S-adenosyl-L-homocysteine ​​hydrolase (SAHase) gene;

[0050] Furthermore, in the method described above, the S-adenosyl-L-homocysteine ​​hydrolase (SAHase) described in M8) is prepared by P CPA1 The promoter initiates expression.

[0051] M9), the wild-type promoter that drives the expression of the L-methionine adenosyltransferase (metK) gene in the recipient bacteria was knocked out and replaced with the P 119 ;

[0052] M10) knocking out the adenosine deaminase (add) gene of claim 1 in the recipient bacteria.

[0053] M11) The wild-type promoter that drives the expression of the adenine phosphoribosyltransferase (apt) gene in the recipient bacteria is knocked out and replaced with the P CPA1 ;

[0054] M12), knock out the wild-type promoter that drives the expression of the adenylate kinase (adk) gene in the recipient bacteria and replace it with the P CPA1 ;

[0055] M13), knocking out the 5'-nucleotidase diphosphatase (ushA) gene of claim 1 in the recipient bacteria;

[0056] M14), knocking out the AMP nucleosidase (amn) gene of claim 1 in the recipient bacteria;

[0057] M15), knocking out the pyruvate oxidase (poxB) gene of claim 1 in the recipient bacterium and replacing it with the adenosine kinase (Ado1) gene described above;

[0058] Furthermore, in the method described above, the adenosine kinase (Ado1) described in M15) is composed of P CPA1 The promoter initiates expression.

[0059] In a third aspect, the present invention provides the recombinant Escherichia coli prepared by the above method.

[0060] In a fourth aspect, the present invention provides any application of the recombinant Escherichia coli in the following aspects:

[0061] 1) Application in the production of gadusol;

[0062] 2) Application in the preparation and production of gadusol-related products.

[0063] The product may be a bacterial agent containing the recombinant Escherichia coli and / or a culture of the recombinant Escherichia coli.

[0064] In a fifth aspect, the present invention provides a bacterial agent containing the above-mentioned recombinant Escherichia coli or a culture containing the above-mentioned recombinant Escherichia coli.

[0065] The term "culture" refers to any liquid or solid product (i.e., fermentation product) containing a microbial population after artificial inoculation and cultivation. This refers to a product obtained by growing and / or amplifying microorganisms. It can be a biologically pure culture of the microorganism or contain a certain amount of culture medium, metabolites, or other components produced during the cultivation process.

[0066] In a sixth aspect, the present invention provides a method for preparing gadusol, which comprises using the above-mentioned recombinant Escherichia coli to prepare gadusol.

[0067] Specifically, the recombinant Escherichia coli is cultured with arabinose induction to obtain induced recombinant Escherichia coli, and the induced recombinant Escherichia coli is used to catalyze a glucose reaction to obtain gadusol.

[0068] In the above method, the L-arabinose induction culture is carried out in a culture medium containing arabinose, and the induction culture temperature is 25° C. and the time is 15 hours.

[0069] In a specific embodiment of the present invention, the transformation medium comprises:

[0070] Medium composition and final concentrations: 48 mM Na2HPO4, 22 mM KH2PO4, 8.6 mM NaCl, 18.7 mM NH4Cl, 10 g / L glucose, 5 g / L L-methionine.

[0071] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the glucose-6-phosphate isomerase (hereinafter referred to as pgi) is NP_418449.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the encoding gene is Gene ID: 948535 (2023.10.7).

[0072] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the transaldolase A (hereinafter referred to as talA) is NP_416959.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 947006 (2023.10.7).

[0073] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the transaldolase B (hereinafter referred to as talB) is NP_414549.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the transaldolase B is Gene ID: 944748 (2023.10.7).

[0074] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the transketolase A (hereinafter referred to as tktA) is YP_026188.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 947420 (2023.10.7).

[0075] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the pyruvate formate lyase (hereinafter referred to as pflB) is NP_415423.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the pyruvate formate lyase is Gene ID: 94551 (2024.7.6).

[0076] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the 6-phosphate glucose dehydrogenase (zwf) is AKT72612.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the zwf is Gene ID: 946370 (2023.10.7).

[0077] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the 6-phosphogluconolactonase (pgl) is NP_415288.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the 6-phosphogluconolactonase (pgl) is Gene ID: 946398 (2024.12.3).

[0078] In the present invention, the NCBI Reference Sequence number (NCBI Reference Sequence) of the 6-phosphogluconate dehydrogenase (hereinafter referred to as gnd) is NP_416533.1, and the NCBI Reference Sequence number (NCBI Reference Sequence) of its encoding gene is Gene ID: 946554 (2023.10.7).

[0079] In the present invention, the NCBI Reference Sequence number (NCBI Reference Sequence) of the L-methionine biosynthesis transcription factor (hereinafter referred to as metJ) is NP_418373, and the NCBI Reference Sequence number (NCBI Reference Sequence) of its encoding gene is Gene ID: 948435 (2024.12.17).

[0080] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the L-methionine adenosyltransferase (hereinafter referred to as metK) is NP_417417.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the L-methionine adenosyltransferase is Gene ID: 945389 (2024.7.6).

[0081] In the present invention, the NCBI reference sequence number (NCBI Reference Sequence) of the 2-epimal-5-epimal-valinone synthase EEVS derived from Streptomyces sp. CG1 is WP_369393227.1 (2024.8.8).

[0082] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the 2-epim-5-epim-valinone synthase EEVS derived from Streptomyces olivaceoviridis is WP_382568099.1 (2024.12.30).

[0083] In the present invention, the NCBI reference sequence number (NCBI Reference Sequence) of the 2-epimal-5-epimal-valinone synthase EEVS from Danio aesculapii is XP_056316349.1 (2023.5.27).

[0084] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the methyltransferase-oxidoreductase MTox derived from Danio aesculapii is XP_056316348.1 (2023.5.27).

[0085] In the present invention, the NCBI reference sequence number (NCBI Reference Sequence) of the methyltransferase-oxidoreductase MTox derived from Saitoella complicate NRRL Y-17804 is XP_017027009.1 (2020.2.5).

[0086] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the S-adenosyl-L-homocysteine ​​hydrolase (SAHase) derived from Saccharomyces cerevisiae S288C is NP_010961.3 (2025.3.5).

[0087] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the adenylate kinase (adk) is NP_415007.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 945097 (2022.3.9).

[0088] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the adenine phosphoribosyltransferase (apt) is NP_415002, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the adenine phosphoribosyltransferase (apt) is Gene ID: 945113 (2025.3.26).

[0089] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the 5'-nucleotidase diphosphatase (ushA) is NC_000913.3, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 947331 (2025.3.26).

[0090] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the adenosine deaminase (add) is NC_000913.3, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the adenosine deaminase (add) is Gene ID: 945851 (2025.3.26).

[0091] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the AMP nucleosidase (amn) is NC_000913.3, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 946508 (2025.3.26).

[0092] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the pyruvate oxidase (hereinafter referred to as poxB) is CAD6018048.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the pyruvate oxidase is Gene ID: 946132 (2023.10.7).

[0093] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the adenosine kinase (hereinafter referred to as Ado1) is NP_012639.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the adenosine kinase is Gene ID: 853569 (2025.05.11).

[0094] The present invention transforms the recipient bacteria including 1), 2), 3) and 4):

[0095] 1) Knock out the transaldolase A and transaldolase B genes in biological cells, and enhance the transketolase A (transketolase 1) gene.

[0096] 2) The gene for the DNA-binding transcriptional repressor MetJ in biological cells was knocked out and replaced with S-adenosyl-L-homocysteine ​​hydrolase, and the gene for L-methionine adenosyltransferase in biological cells was enhanced. Adenosine deaminase and pyruvate oxidase were knocked out and replaced with adenosine kinase. 5′-nucleotidase diphosphatase, AMP nucleosidase, and nucleoside phosphorylase were knocked out, and adenylate kinase was enhanced.

[0097] 3) The 2-epi-5-epi-valiolone synthase and methyltransferase-oxidoreductase genes for gadusol synthesis from different sources were introduced into Escherichia coli.

[0098] 4) Glucose-6-phosphate isomerase was knocked out in Escherichia coli cells, and the genes encoding 6-phosphogluconolactonase, 6-phosphogluconate dehydrogenase, and transketolase A were enhanced.

[0099] The recombinant bacteria of the present invention have significantly improved their ability to produce gadusol and can be used for large-scale production of gadusol. Compared with traditional methods of extracting gadusol from algae, the microbial fermentation method of the present invention has the advantages of a short production cycle, no climatic environment restrictions, and high yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0100] Figure 1 Comparison of the ability of recombinant bacteria G1 to produce gadusol intracellularly and extracellularly.

[0101] Figure 2 Comparison of the extracellular production of gadusol by recombinant bacteria G1, G7, and G8.

[0102] Figure 3 Comparison of the extracellular production of gadusol by recombinant bacteria G8 and G16.

[0103] Figure 4 Comparison of the extracellular production of gadusol by recombinant bacteria G16, G17, and G18. DETAILED DESCRIPTION

[0104] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0105] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0106] The quantitative experiments in the following examples were performed in triplicate unless otherwise specified.

[0107] Escherichia coli BW25113 (CGSC#: 7636), plasmid pKD46 (CGSC#: 7739), and pCP20 (CGSC#: 7629) in the following examples were purchased from the Escherichia coli Genetic Collection at Yale University (CGSC).

[0108] Escherichia coli MC02 (CGMCC No. 34378) can be obtained from CGMCC.

[0109] The primers used in the present invention are shown in Table 1; the constructed plasmids are shown in Table 2; and the obtained strains are shown in Table 3.

[0110] Table 1 Primers used

[0111] stE-F gctaacaggaggaattaaccATGTTACCCTCAGATGTACT stE-R tagtaccagatctaccctcgagTTAGCGACGCGCACGTTCGT daE-F gctaacaggaggaattaaccATGGAAAGGCCCGGAGAGAC daE-R tagtaccagatctaccctcgagTTATTGCGGGGAGCCGGTAG soE-F gctaacaggaggaattaaccATGACAATGACTAAACAAAG soE-R tagtaccagatctaccctcgagTTACACGCCCATGTCAACCG XB-F ctcgagggtagatctggtacta XB-R ggttaattcctcctgttagc VYZ-F AAGATTAGCGGATCCTACCTG VYZ-R TGGCAGTTCCCTACTCTC daM-F gctaacaggaggaattaaccATGCAAACTGCTAAAGTATC daM-R tagtaccagatctaccctcgagttaCCAAAGGCTTTGGCCAC scM-F gctaacaggaggaattaaccATGGATACACTACACAATTT scM-R tagtaccagatctaccctcgagttaCAAGAGGCTTTGACCTC LA-F ctcgagggtagatctggtacta LA-R ggttaattcctcctgttagc talB-F ttgcgtcgtgatatcatcagggcagaccggttacatccccctaacaagctgtttaaagagaaatactatc-ATTCCGGGGATCCGTCGACC talB-R ctgcgaagggagtgacagacaggcttcagaagaggtagcgtgaccgacttcccggtcacgctaagaatga -TGTAGGCTGGAGCTGCTTCG talB-up-500-F ccaggttgccgctacccacg Kan-in-R TTAGAAGAACTCGTCAAGAAGGCGATAGAA talB-in-500-R agacttcggctgaccgggtaa talA-F TTAGCGAAATTTCTCAGAAGTGTGAATTAACGCACTCATCTAACACTTTACTTTTCAAGGAGTATTTCCT-ATTCCGGGGATCCGTCGACC talA-R cgcatccatactgagtgcgcgaatcgcattggcaaggtcttttcgggacatataacactccgtggctggt-TGTAGGCTGGAGCTGCTTCG talA-up-500-F caccgccgtaccgttagaga talA-in-500-R cagcgaacagacttcgtggg PoxB up tcccatcccttccccctccgtcagatgaactaaacttgttaccgttatcacattcaggagatggagaacc PoxB down aaagggtggcatttcccgtcataataaggacatgccatgattgatttacgcagtgataccgttacccgac PoxB-F tcccatcccttccccctccgt PoxB-R gtcgggtaacggtatcactgcg poxB-up-500-F taccgtgatgacctgcggcc poxB-in-500-R aaattcccatgcttctttca TktA up ataaggaaaagcgcagcggacgggcgagtagattgcgcaacatgcgagcatgatccagagatttctgaag TktA down atgtcctcacgtaaagagcttgccaatgctattcgtgcgctgagcatggacgcagtacagaaagccaaat TktA-F ataaggaaaagcgcagcggac TktA-R ATTTGGCTTTCTGTACTG tktA-up-500-F ttgtcagacgtttagcgtat tktA-in-500-R agcaaacttcgtgggagatgcct stE-daM-R GATACTTTAGCAGTTTGCATGGTTAATTCCTCCTTTAGCGACGCGCACGTTCGT stE-daM-F ACGAACGTGCGCGTCGCTAAAGGAGGAATTAACCATGCAAACTGCTAAAGTATC metJ-up tttacggtcagtacccacatcaactgtgtggtctggtctcaatttattgacgaagaggattaagtatctc metJ-down agcaaaaaagagcggcgcggagtggaatcgcctgatgcgctacgcttatcaggcctacgtcatattgcaa metJ-F tttacggtcagtacccacatca metJ-R ttgcaatatgacgtaggcctgataagcg metJ -up-500-F tcgcggacatgccggtattag metJ-in-500-R taacgttttgccgtttgcgc add-up atcgtggatttttaccctgctttgtttttataatggtgcgcacttttatatccagaaaaagagtgcgacc add-down caaaatggatggtgcaaatgcaccatccatttttcatgcaaggcacaaagtcgcgcgatgtttggcggatt add-F atcgtggatttttaccctgctt add-R aatccgccaaacatcgcgcgac add-up-500-F cggcactgaaaggccgtgatg add-in-500-R ccggtcagcatgacggtagat ushA-up acgcagacttgtctatgatgtcgcgtcatactatttttcaacacgttgaaatcaggtcagggagagaagt ushA-down tccgaaagtgccggatgtttgcatccggcacaatgcttaatcgcggcgggcgatatcagcaaatttggca ushA-F acgcagacttgtctatgatg ushA-R tgccaaatttgctgatatcg ushA -up-500-F tcggtccagtagccgaccac ushA -in-500-R aattactcgaaaaaaacaag amn-up tacacttttgtttcacatttctgtgacatactatcggatgtgcggtaattgtatggaacaggagacacac amn-down taagttctgaaccttcttatcagaaatagatgtgaaggagtaagtaagacacctggcaaatagcctgcaa amn-F tacacttttgtttcacattt amn-R ttgcaggctatttgccaggtg amn -up-500-F gcctggcttgccgatcgtttt amn -in-500-R acgttcaataacgaatttta ppnP-up tttgcgtgacagccagcgcctctggcccctatagtgaagtagatgttcaactaccaaacagggccagttt ppnP-down ttcctcgccttccccttgaacgggagggcatttttctgaaatatcctttctttagcccataataatattt ppnP-F tttgcgtgacagccagcgcc ppnP-R aaatattattatgggctaaa ppnP -up-500-F tggttgaagtgctcgataat ppnP -in-500-R catggacgttgtgtcattgt apt-up gtttgcttttctatatgtggcgaattccggtgattgatgaaaagcaagaaaagcactgaagcacaacaat apt-down atgaccgcgactgcacagcagcttgagtatctcaaaaatagcatcaaaagcattcaggactacccaaaac apt-F gtttgcttttctatatgtgg apt-R gttttgggtagtcctgaatg apt-up-500-F gctggctggcggtagtgctgg apt-in-500-R agacgctgttcgccgccgag adk-up tttcttttcatcatctgcactttccgcaaattatctcgccattaaccgtttcagccccaggtgcctttct adk-down atgcgtatcattctgcttggcgctccgggcgcggggaaagggactcaggctcagttcatcatggagaaat adk-F tttcttttcatcatctgcacttt adk-R atttctccatgatgaactga adk-up-500-F tcggcgagcgcgtgaaagatg apt-in-500-R cgtttacgtacggtctcttc metK-up aggatccgctaccacagaaaatccacacaacagtttgagctaaccaaattctctttaggtgatattaaat metK-down atggcaaaacacctttttacgtccgagtccgtctctgaagggcatcctgacaaaattgctgaccaaattt metK-F aggatccgctaccacagaaaatc metK-R aaatttggtcagcaattttg metK-up-500-F aggtatgcaaagcagagatgc metK-in-500-R gcttttcgcgtccgggcgcag pgi-up tcacatttttctgtgactggcgctacaatcttccaaagtcacaattctcaaaatcagaagagtattgcta pgi-down tcatcgtcgatatgtaggccggataaggcgttcacgccgcatccggcaaccgatgcctgatgcgacgcgg pgi-F tcacatttttctgtgactgg pgi-R ccgcgtcgcatcaggcatcg pgi-up-500-F ttttcagccttggcacaagg pgi-in-500-R ataacaatttcccttcattg pflB-up aaacgaccaccattaatggttgtcgaagtacgcagtaaataaaaaatccacttaagaaggtaggtgttac pflB-down ttagatttgactgaaatcgtacagtaaaaagcgtacaataaaggctccacgaaagtggggccttttttag pflB-F aaacgaccaccattaatggt pflB-R ctaaaaaaggccccactttcgtgga pflB-up-500-F atatgaccgcaaatggtcaatgggga pflB-in-500-R acaggtatgaatgccttcttttt

[0112] Table 2 Plasmids used in the present invention

[0113] Plasmid name information Remark PXb <![CDATA[P15A ori, araBAD promoter, Kana r ]]> This patent pLB1a <![CDATA[R6K ori, araBAD promoter, Amp r ]]> This patent pRB1s <![CDATA[RSF1030 ori, araBAD promoter, Str r ]]> This patent pKD46A <![CDATA[araBAD promoter, temperature-sensitive plasmid expressing Red recombinase, Amp r > This patent pWB1a-cre <![CDATA[araBAD promoter, temperature-sensitive plasmid for eliminating lox site resistance, Amp r > This patent pXB1k-stEEVS The pXB1k plasmid contains the EEVS enzyme from Streptomyces sp. CG1. This patent pXB1k-daEEVS The pXB1k plasmid contains the EEVS enzyme from Danio aesculapii This patent pXB1k-soEEVS The pXB1k plasmid contains the EEVS enzyme from Streptomyces olivaceoviridis. This patent pLB1a-daMTox The pLB1a plasmid contains the MTox enzyme from Danio aesculapii This patent pLB1a-scMTox The pLB1a plasmid contains the MTox enzyme from Saitoella complicate NRRL Y-17804. This patent pXB1k-stEEVS-daMTox The pXB1k plasmid contains the EEVS enzyme from Streptomyces sp. CG1 and the MTox enzyme from Danioa esculapii. This patent pRB1s-stEEVS-daMTox The pRB1s plasmid contains the EEVS enzyme from Streptomyces sp.CG1 and the MTox enzyme from Danioa esculapii. This patent

[0114] Table 3 Strains used in the present invention

[0115] Strain name describe source D1 Knockout of the talB gene in Escherichia coli MC02 The present invention D2 talA gene knocked out in recombinant strain D1 The present invention D4 <![CDATA[The promoter of the D2tktA gene in the recombinant bacterium is replaced with the constitutive promoter P CPA1 > The present invention G1 The plasmids pXB1k-stEEVS and pLB1a-daMTox were introduced into the recombinant bacteria D4. The present invention G2 The plasmids pXB1k-daEEVS and pLB1a-daMTox were introduced into the recombinant bacteria D4. The present invention G3 The plasmids pXB1k-soEEVS and pLB1a-daMTox were introduced into the recombinant bacteria D4. The present invention G4 The plasmids pXB1k-stEEVS and pLB1a-scMTox were introduced into the recombinant bacteria D4. The present invention G5 The plasmids pXB1k-daEEVS and pLB1a-scMTox were introduced into the recombinant bacteria D4. The present invention G6 The plasmids pXB1k-soEEVS and pLB1a-scMTox were introduced into the recombinant bacteria D4. The present invention G7 The plasmid pXB1k-stEEVS-daMTox was introduced into the recombinant bacteria D4. The present invention G8 The plasmid pRB1s-stEEVS-daMTox was introduced into the recombinant bacteria D4. The present invention D5 <![CDATA[The metJ of recombinant bacterium D4 is replaced with S-adenosyl-L-homocysteine hydrolase (SAHase, promoter is P CPA1 ), which is derived from Saccharomyces cerevisiae S288C]]> The present invention D6 Knockout of the add gene in recombinant strain D5 The present invention D7 Knockout of ushA gene in recombinant strain D6 The present invention D8 Knockout of the amn gene in recombinant strain D7 The present invention D9 <![CDATA[In recombinant bacterium D8, the pox gene is knocked out and replaced with ado1, and the promoter is P 119 > The present invention D10 <![CDATA[The apt gene promoter in recombinant bacterium D9 was replaced with the constitutive promoter P CPA1 > The present invention D11 <![CDATA[The adk gene promoter in recombinant bacterium D10 was replaced with the constitutive promoter P CPA1 > The present invention D12 <![CDATA[The promoter of the metK gene in recombinant bacterium D11 is replaced with the constitutive promoter P 119 > The present invention G16 The plasmid pRB1s-stEEVS-daMTox was introduced into the recombinant bacteria D12. The present invention D13 The gene pgi encoding phosphohexose isomerase was knocked out in the recombinant strain D12. The present invention D14 <![CDATA[The pflB of recombinant bacterium D13 was replaced with three gene clusters of zwf-pgl-gnd (the promoter for expressing the three gene clusters is P 119 ).]]> The present invention G17 The plasmid pRB1s-stEEVS-daMTox was introduced into the recombinant bacteria D13. The present invention G18 The plasmid pRB1s-stEEVS-daMTox was introduced into the recombinant bacteria D14. The present invention

[0116] Example 1. Construction of gadusol synthetic gene expression vector

[0117] In this example, an expression vector containing a gadusol synthetic gene was prepared. The primers used are shown in Table 1. The preparation method is as follows:

[0118] (1) Construction of expression vectors for 2-epi-5-epi-valinone synthase EEVS from different sources

[0119] 2-Epi-5-Epi-valinone synthase (EEVS) from Streptomyces sp. CG1 (nucleic acid sequence such as SEQ ID NO. 3), zebrafish (Danio aesculapii, nucleic acid sequence such as SEQ ID NO. 4), and olive viridans (Streptomyces olivaceoviridis, nucleic acid sequence such as SEQ ID NO. 5) was artificially synthesized after being codon-optimized in Escherichia coli. The fragment stEEVS was amplified by PCR using primers stE-F and stE-R with the synthetic gene as a template, the fragment daEEVS was amplified by PCR using primers daE-F and daE-R with the synthetic gene as a template, the fragment soEEVS was amplified by PCR using primers soE-F and soE-R with the synthetic gene as a template, and the vector fragment pXB1K was amplified by PCR using primers XB-F and XB-R with plasmid pXB1K (SEQ ID NO.6) as a template. The size of all PCR products was identified by agarose gel electrophoresis and the fragments were recovered using an agarose gel electrophoresis kit. Using the Gibson assembly method (Gibson DG, Young L, et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. methods. 2009; 6(5):343-345), the fragments pXB1K and stEEVS, pXB1K and daEEVS, and pXB1K and soEEVS were Gibson ligated and transformed into competent Escherichia coli DH5α cells (purchased from Beijing Qingke Biotechnology Co., Ltd., product catalog TSC-C01). After recovery, the cells were evenly plated onto the corresponding resistant LB plates and cultured overnight at 37°C. Clones were selected and verified for successful assembly by PCR amplification using primers VYZ-F and VYZ-R. Sequencing was then performed. Positive clones were screened and the resulting plasmids were extracted and named pXB1k-stEEVS, pXB1k-daEEVS, and pXB1k-soEEVS.

[0120] (2) Construction of expression vectors for methyltransferase-oxidoreductase MTox from different sources

[0121] A methyltransferase-oxidoreductase (MTox) from zebrafish (Danio aesculapii, nucleotide sequence shown in SEQ ID NO. 7) and Saitoella complicate NRRL Y-17804 (nucleotide sequence shown in SEQ ID NO. 8) was synthesized and codon-optimized in Escherichia coli. The daMTox fragment was amplified by PCR using primers daM-F and daM-R, using the synthesized gene as a template. The scMTox fragment was amplified by PCR using primers scM-F and scM-R, using the synthesized gene as a template. The vector fragment pLB1A (SEQ ID NO. 14) was amplified by PCR using primers LA-F and LA-R. All PCR products were size-checked by agarose gel electrophoresis and recovered using an agarose gel electrophoresis kit. Using the Gibson assembly method (Gibson DG, Young L, et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. methods. 2009; 6(5):343-345), the fragments pLB1A and scMTox, and pLB1A and daMTox were Gibson ligated and transformed into competent Escherichia coli DH5α cells (purchased from Beijing Qingke Biotechnology Co., Ltd., product catalog TSC-C01). After recovery, the cells were evenly plated onto the corresponding resistant LB plates and cultured overnight at 37°C. Clones were selected and verified for successful assembly by PCR amplification using primers VYZ-F and VYZ-R. Sequencing was then performed. Positive clones were screened and the resulting plasmids were extracted and named pLB1A-scMTox and pLB1A-daMTox.

[0122] Example 2: Construction of recombinant Escherichia coli D4

[0123] In this example, a basic strain D4 for gadusol production was constructed from Escherichia coli MC02. This strain primarily deleted the genes for transaldolase A and transaldolase B, replaced the gene encoding pyruvate oxidase with that encoding acetyl-CoA synthetase, and enhanced the transketolase A (transketolase 1) gene. The strain was constructed as follows; the primers used are listed in Table 1.

[0124] (1) Knockout of talB

[0125] First, the transaldolase encoding gene talB of Escherichia coli MC02 was knocked out to obtain recombinant strain D1. The specific steps are as follows:

[0126] (1-a) Preparation of the targeting fragment talBup-kan-talBdown:

[0127] PCR amplification was performed using talB-F / talB-R as primers and the frt-kan-frt (SEQ ID No. 9) screening marker fragment as a template to obtain the targeting fragment talB up-kan-talB down.

[0128] (1-b) Preparation of host bacteria containing the pKD46 plasmid

[0129] The pKD46 plasmid (from the Yale Genetic Collection of Escherichia coli (CGSC)) was transformed into E. coli MC02 using the calcium chloride method. After overnight culture at 30°C on LB plates containing ampicillin, colonies were selected to generate recombinant E. coli MC02 (pKD46) cells containing the pKD46 plasmid. MC02 (pKD46) cells were cultured in LB medium containing ampicillin at a final concentration of 100 μg / mL and L-arabinose at a final concentration of 2 g / L to an OD of 0.6-0.8. Competent MC02 (pKD46) cells were then washed twice with ice-cold 10% glycerol. Following induction with L-arabinose, MC02 (pKD46) cells expressed the three recombinant proteins Gam, Beta, and Exo of phage λ, enhancing their homologous recombination capacity.

[0130] (1-c) Homologous recombination

[0131] The targeting fragment talBup-kan-talBdown prepared in (1-a) was electroporated into the MC02 (pKD46) competent cells prepared in (1-b) and incubated overnight at 37°C on LB plates containing kanamycin (50µg / ml). Genomic DNA was extracted from selected clones and amplified by PCR using primers talB-up-500-F and Kan-in-R. Amplification of a target band of approximately 1400bp was considered positive, and the selected positive clone was named D1-kan. The positive clone suspension was streaked and incubated overnight at 42°C on plates containing 50µg / mL kanamycin to eliminate the temperature-sensitive plasmid pKD46.

[0132] (1-d) Elimination of resistance

[0133] The pcP20 plasmid was transformed into D1-kan using the calcium chloride method. The plasmid was plated onto LB plates containing ampicillin and cultured overnight at 30°C. A single colony was picked and cultured on LB medium supplemented with 100 μg / mL ampicillin and 2 g / L L-arabinose at 30°C. The bacterial suspension was then streaked onto antibiotic-free LB medium and cultured overnight at 42°C to eliminate the temperature-sensitive plasmid pcP20. Single colonies from the plate were transferred to LB medium containing antibiotics, kanamycin, or ampicillin to test for elimination of kanamycin resistance and pcP20. Single colonies were identified by PCR amplification using primers talB-up-500-F and talB-in-500-R. A positive result indicated the presence of a target band of approximately 1000 bp, indicating the recombinant strain D1.

[0134] The NCBI Reference Sequence number (NCBI Reference Sequence) of the transaldolase B (hereinafter referred to as talB) is NP_414549.1, and the NCBI Reference Sequence number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 944748 (2023.10.7).

[0135] (2) Knockout of talA

[0136] The recombinant bacteria D1 obtained in (1) of Example 2 was used as the starting strain, and the transaldolase gene talA was knocked out to obtain the recombinant bacteria D2. The specific steps are as follows:

[0137] (2-a) Preparation of the targeting fragment talAup-kan-talAdown:

[0138] PCR amplification was performed using talA-F / talA-R as primers and the frt-kan-frt (SEQ ID No. 9) screening marker fragment as a template to obtain the targeting fragment talA up-kan-talA down.

[0139] (2-b) The subsequent steps were similar to those in Example 2 (1) (steps 1-b to 1-d), except that the host strain MC02 was replaced by D1 and the primers talB-F / talB-R were replaced by talA-F / talA-R. In step (2-c), PCR amplification was performed using primers talA-up-500-F and Kan-in-R, and a positive result was obtained when a target band of approximately 1100 bp was amplified. In step (2-d), PCR amplification was performed using primers talA-up-500-F and talA-in-500-R, and a positive result was obtained when a target band of approximately 1000 bp was amplified.

[0140] The NCBI Reference Sequence number (NCBI Reference Sequence) of the transaldolase A (hereinafter referred to as talA) is NP_416959.1, and the NCBI Reference Sequence number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 947006 (2023.10.7).

[0141] (3) Enhanced expression of transketolase A

[0142] The recombinant strain D4 was obtained by enhancing the expression of the tktA gene based on the D2 starting strain. The specific steps are as follows:

[0143] (3-a) Preparation of the targeting fragment tktAup-kan-P119-tktAdown:

[0144] The gene-synthesized (GenScript) DNA fragments were as follows: from 5' to 3', they contained the 70-bp upstream homology arm of the tktA gene (denoted as tktA-up, see Table 1), the frt-kan-frt selection marker fragment (SEQ ID No. 9), the P119 promoter fragment (SEQ ID No. 2), and the first 70-bp fragment of the tktA gene (denoted as tktA-down, see Table 1). PCR amplification was performed using tktA-F / tktA-R as primers and the gene-synthesized DNA fragment as a template to obtain the targeting fragment tktAup-kan-P119-tktAdown.

[0145] (3-b) The subsequent steps were similar to those in Example 2 (1) (steps 3-b to 3-d), except that the host strain MC02 was replaced with D2 primers and talB-F / talB-R was replaced with tktA-F / tktA-R. In step (3-c), PCR amplification was performed using tktA-up-500-F and Kan-in-R as primers, and amplification of a target band of approximately 1100 bp was considered positive. In step (3-d), PCR amplification was performed using tktA-up-500-F and tktA-in-500-R as primers, and amplification of a target band of approximately 1100 bp was considered positive.

[0146] The NCBI Reference Sequence number (NCBI Reference Sequence) of the transketolase A (hereinafter referred to as tktA) is YP_026188.1, and the NCBI Reference Sequence number (NCBI Reference Sequence) of the gene encoding it is GeneID: 947420 (2023.10.7).

[0147] Example 3. Construction of gadusol-producing strain and preparation of gadusol

[0148] In this example, the plasmid constructed in Example 1 was introduced into recombinant bacteria D4 to obtain recombinant bacteria G1-G6. By comparing gadusol production, the superior enzymes derived from EEVS and MTox were selected, and plasmids pXB1k-stEEVS-daMTox and pRB1s-stEEVS-daMTox were constructed. These two plasmids were then transferred into recombinant bacteria D4 to obtain G7 and G8. This example also optimized the culture conditions and whole-cell catalytic conditions for gadusol synthesis by the recombinant bacteria. The specific steps are as follows:

[0149] (1) Construction of gadusol-producing strains G1-G6

[0150] The plasmid combinations constructed in steps (1) and (2) of Example 1 (pXB1k and pLB1a, pXB1k-stEEVS and pLB1a-daMTox, pXB1k-daEEVS and pLB1a-daMTox, pXB1k-soEEVS and pLB1a-daMTox, pXB1k-stEEVS and pLB1a-scMTox, pXB1k-daEEVS and pLB1a-scMTox, pXB1k-soEEVS and pLB1a-scMTox) were transformed into the recombinant bacteria D4 obtained in step (4-d) of Example 2 by the calcium chloride transformation method. After overnight culture at 37°C on LB plates containing 100 µg / mL ampicillin and 50 µg / mL kanamycin, clones were selected to obtain production strains containing different plasmid combinations, which were named recombinant bacteria G0-G6.

[0151] (2) Preparation of gadusol

[0152] (2-a) Preparation of culture medium:

[0153] The composition of medium A is 10 g / L tryptone, 5 g / L yeast powder, 5 g / L glycerol, 0.5 g / L glucose, 2 g / L L-arabinose, 25 mM Na2HPO4, 25 mM KH2PO4, 50 mM NH4Cl, 5 mM Na2SO4, 2 mM MgSO4, 50 μM FeCl3, 20 μM CaCl2, 10 μM MnCl2, 10 μM ZnSO4, 2 μM CoCl2, 2 μM NiCl2, 2 μMNa2MO4, 2 μM Na2SeO3 and 2 μM H3BO3.

[0154] The composition of medium B is 48 mM Na2HPO4, 22 mM KH2PO4, 8.6 mM NaCl, 18.7 mM NH4Cl, 10 g / L glucose, and 5 g / L L-methionine.

[0155] (2-b) Culture of bacteria:

[0156] Strains G0-G6 were cultured as follows: single colonies were picked from LB plates and inoculated into LB liquid medium containing the corresponding antibiotics. The cells were incubated at 37°C and 220 rpm until an OD600 nm of 1.5 was reached. A 1% inoculum of the seed solution was then inoculated into a 100-mL Erlenmeyer flask containing 20 mL of medium A. The cells were incubated at 30°C and 220 rpm for 16 hours. The cells were then harvested and resuspended in 5 mL of LB medium to a total OD600 nm of 30. The cells were then transformed at 37°C and 220 rpm for 24 hours to obtain the transformed solution. The experiment was repeated three times, with 10 flasks inoculated each time.

[0157] (2-c) Collection and detection of products:

[0158] Centrifuge 0.5 ml of the transformation solution obtained in step 2-b at 4000 g and 4°C for 20 min. Collect the extracellular and intracellular products using the following steps a) and b), respectively:

[0159] a) Vacuum-dry 350 μL of the supernatant obtained after centrifugation, then reconstitute it with 700 μL of methanol. Centrifuge at 18,000 g for 10 min. Vacuum-dry 600 μL of the supernatant, then reconstitute it with 300 μL of deionized water. Centrifuge the reconstituted solution at 18,000 g for 2 min. Filter the supernatant through a 0.22 μm filter to obtain the filtrate, which is the test sample.

[0160] b) Add 1 ml of methanol to the cell pellet obtained after centrifugation and disrupt the cells by ultrasound. Centrifuge at 18,000 g for 10 min. Take 800 μL of the supernatant and vacuum dry it. Then, add 400 μL of deionized water for reconstitution. Centrifuge the reconstituted solution at 18,000 g for 2 min. Filter the supernatant through a 0.22 μm filter to obtain the filtrate, which is the test sample.

[0161] The gadusol content in the samples was determined using high-performance liquid chromatography (HPLC). HPLC analysis was performed using an Agilent 0C18 column with a mobile phase consisting of methanol and water (methanol:water volume ratio of 84:16), a column temperature of 30°C, a flow rate of 1 mL / min, and a UV detector.

[0162] Gadusol has a characteristic absorption peak at around 271 nm. The results showed that no gadusol was detected in the sample of strain G0, while strain G1 produced 0.02±0.002 g / L and 0.31±0.004 g / L gadusol intracellularly and extracellularly, respectively, which were higher than the intracellular and extracellular gadusol production of other strains (no gadusol was detected intracellularly in G2, and 0.05±0.003 g / L gadusol was detected extracellularly; 0.01±0.002 g / L gadusol was detected intracellularly in G3, and 0.21±0.003 g / L gadusol was detected extracellularly; no gadusol was detected intracellularly in G4, and 0.07±0.002 g / L gadusol was detected extracellularly; 0.02±0.003 g / L gadusol was detected intracellularly in G5, and 0.26±0.003 g / L gadusol was detected extracellularly). The production level of strain G1 is shown in Table 1. Figure 1 , indicating that G1 has a higher ability to produce gadusol, and proving that EEVS from Streptomyces sp.CG1 and MTox from Danio aesculapii are superior to other sources.

[0163] (3) Comparison of the ability of EEVS and MTox to synthesize gadusol

[0164] (3-a) Construction of plasmids pXB1k-stEEVS-daMTox and pRB1s-stEEVS-daMTox

[0165] Fragment stE1 was amplified by PCR using primers stE-F and stE-daM-R with EEVS from Streptomyces sp. CG1 as a template. Fragment daM1 was amplified by PCR using primers stE-daM-F and daM-R with MTox from Danio aesculapii as a template. Vector fragment pXB1K was amplified by PCR using primers XB-F and XB-R with plasmid pXB1K (SEQ ID NO. 6) as a template. Vector fragment pRB1S was amplified by PCR using primers RS-F and RS-R with plasmid pRB1S (SEQ ID NO. 11) as a template. All PCR products were identified by size by agarose gel electrophoresis and the fragments were recovered using an agarose gel electrophoresis kit. Using the Gibson assembly method (Gibson DG, Young L, et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. methods. 2009; 6(5):343-345), the three fragments pXB1K, stE1, and daM1, and the three fragments pRB1S, stE1, and daM1 were Gibson ligated and transformed into competent Escherichia coli DH5α cells (purchased from Beijing Qingke Biotechnology Co., Ltd., product catalog TSC-C01). After recovery, they were evenly plated onto the corresponding resistance LB plates and cultured overnight at 37°C. Clones were selected and verified for successful assembly by PCR amplification using primers VYZ-F and VYZ-R, and sequencing was performed. Positive clones were finally screened and the plasmids were extracted and named pXB1k-stEEVS-daMTox and pRB1s-stEEVS-daMTox.

[0166] (3-b) Construction of production strains G7 and G8 and comparison of gadusol synthesis abilities of different strains

[0167] The plasmids (pXB1k-stEEVS-daMTox, pRB1s-stEEVS-daMTox) constructed in step (3-1) of Example 3 were transferred into the recombinant strain D4 obtained in step (4-d) of Example 2 by the calcium chloride transformation method. After overnight culture at 37°C on an LB plate containing 100 µg / mL ampicillin, clones were selected to obtain production strains containing different plasmids, which were named recombinant strains G7 and G8.

[0168] According to the method of step (2) in Example 3, the recombinant bacteria G1, G7 and G8 were cultured and the gadusol synthesis ability of the three recombinant bacteria was compared.

[0169] The quantitative results of extracellular gadusol are as follows Figure 2 As shown in the figure, after 24 hours of transformation, strain G8 accumulated 2.25±0.06 g / L gadusol extracellularly, which was higher than the gadusol production of strains G1 and G7. The results showed that strain G8 had enhanced gadusol production capacity compared with strain G1.

[0170] Example 4: Construction of recombinant strain G16 and evaluation of its gadusol production capacity

[0171] This example uses the recombinant strain D4 prepared in Example 2 as a starting point, further modifying its target site to produce strain D12. This strain enhances the S-adenosylmethionine (SAM) synthesis module and blocks AMP and adenosine consumption. The strain was constructed as follows; the primers used are listed in Table 1.

[0172] (1) Knockout metJ and replace it with SAHase

[0173] The recombinant bacterium D4 obtained in Example 2 was used as the starting strain, and the expression cassette of the SAHase gene was inserted into the metJ site of the L-methionine synthesis transcription factor to obtain the recombinant bacterium D5. The specific steps are as follows:

[0174] (1-a) Targeting fragment metJ up-kan-P CPA1 Preparation of SAHase-metJ down:

[0175] The DNA fragments synthesized (GenScript) were as follows: from 5' to 3', they contained the 70 bp homology arm fragment upstream of the metJ gene (denoted as metJ-up, see Table 1), the frt-kan-frt screening marker fragment, the P CPA1 The promoter fragment (SEQ ID No. 1), SAHase fragment (SEQ ID No. 12), TrrnB terminator fragment (SEQ ID No. 10), and 70 bp downstream fragment of metJ gene (denoted as metJ-down, see Table 1) were amplified by PCR using metJ-up / metJ-down as primers and the gene synthesized DNA fragment as template to obtain the targeting fragment metJ up-kan-P CPA1 -SAHase-metJdown.

[0176] (1-b) The subsequent steps were similar to those in Example 2 (1) (steps 1-b to 1-d), except that the host strain MC02 was replaced by D4 and the primers talB-F / talB-R were replaced by metJ-up / metJ-down. In step (1-c), PCR amplification was performed using metJ-up-500-F and Kan-in-R as primers, and amplification of a target band of approximately 1100 bp was considered positive. In step (3-d), PCR amplification was performed using metJ-up-500-F and metJ-in-500-R as primers, and amplification of a target band of approximately 2500 bp was considered positive.

[0177] In the present invention, the NCBI Reference Sequence number (NCBI Reference Sequence) of the L-methionine biosynthesis transcription factor (hereinafter referred to as metJ) is NP_418373, and the NCBI Reference Sequence number (NCBI Reference Sequence) of its encoding gene is Gene ID: 948435 (2024.12.17).

[0178] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the S-adenosyl-L-homocysteine ​​hydrolase (SAHase) derived from Saccharomyces cerevisiae S288C is NP_010961.3 (2025.3.5).

[0179] (2) Knockout of the add gene

[0180] The recombinant bacteria D5 obtained in (1) of Example 4 was used as the starting strain, and the adenosine deaminase gene add was knocked out to obtain the recombinant bacteria D6. The specific steps are as follows:

[0181] (2-a) Preparation of the targeting fragment add up-kan-add down:

[0182] The gene-synthesized (GenScript) DNA fragments are as follows: from 5' to 3', they contain a 70-bp homology arm fragment upstream of the add gene (denoted as add-up, see Table 1), an frt-kan-frt selection marker fragment, and a 70-bp fragment downstream of the add gene (denoted as add-down, see Table 1). PCR amplification was performed using add-F / add-R as primers and the gene-synthesized DNA fragment as a template to obtain the targeting fragment add up-kan-add down.

[0183] (2-b) The subsequent steps were similar to those in Example 2 (1) (steps 2-b to 2-d), except that the host strain MC02 was replaced by D5 and the primers talB-F / talB-R were replaced by add-F / add-R. In step (2-c), PCR amplification was performed using add-up-500-F and Kan-in-R as primers, and amplification of a target band of approximately 1100 bp was considered positive. In step (2-d), PCR amplification was performed using add-up-500-F and add-in-500-R as primers, and amplification of a target band of approximately 1000 bp was considered positive.

[0184] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the adenosine deaminase (add) is NC_000913.3, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the adenosine deaminase (add) is Gene ID: 945851 (2025.3.26).

[0185] (2) Knockout of the ushA gene

[0186] The recombinant bacterium D6 obtained in (2) of Example 4 was used as the starting strain, and the 5'-nucleotidase diphosphatase gene ushA was knocked out to obtain the recombinant bacterium D7. The specific steps are as follows:

[0187] (3-a) Preparation of the targeting fragment ushA up-kan-ushA down:

[0188] The gene-synthesized (GenScript) DNA fragments are as follows: from 5' to 3', they contain a 70-bp homology arm fragment upstream of the ushA gene (denoted as ushA-up, see Table 1), an frt-kan-frt selection marker fragment, and a 70-bp fragment downstream of the ushA gene (denoted as ushA-down, see Table 1). PCR amplification was performed using ushA-F / ushA-R as primers and the gene-synthesized DNA fragment as a template to obtain the targeting fragment ushA up-kan-ushA down.

[0189] (3-b) The subsequent steps were similar to those in Example 2 (1) (steps 3-b to 3-d), except that the host strain MC02 was replaced by D6 and the primers talB-F / talB-R were replaced by ushA-F / ushA-R. In step (3-c), PCR amplification was performed using primers ushA-up-500-F and Kan-in-R, and a positive result was obtained when a target band of approximately 1100 bp was amplified. In step (3-d), PCR amplification was performed using primers ushA-up-500-F and ushA-in-500-R, and a positive result was obtained when a target band of approximately 1000 bp was amplified.

[0190] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the 5'-nucleotidase diphosphatase (ushA) is NC_000913.3, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 947331 (2025.3.26).

[0191] (4) Knockout of the amn gene

[0192] Using recombinant D7 as the starting strain, the AMP nucleoside enzyme gene amn was knocked out to obtain recombinant D8. The specific steps are as follows:

[0193] (4-a) Preparation of the targeting fragment amn up-kan-amn down:

[0194] The gene-synthesized (GenScript) DNA fragments are as follows: from 5' to 3', they contain a 70-bp homology arm fragment upstream of the amn gene (denoted as amn-up, see Table 1), an frt-kan-frt selection marker fragment, and a 70-bp fragment downstream of the amn gene (denoted as amn-down, see Table 1). PCR amplification was performed using amn-F / amn-R as primers and the gene-synthesized DNA fragment as a template to obtain the targeting fragment amn up-kan-amn down.

[0195] (4-b) The subsequent steps were similar to those in Example 2 (1) (steps 4-b to 4-d), except that the host strain MC02 was replaced by D7 and the primers talB-F / talB-R were replaced by amn-F / amn-R. In step (4-c), PCR amplification was performed using amn-up-500-F and Kan-in-R as primers, and amplification of a target band of approximately 1100 bp was considered positive. In step (4-d), PCR amplification was performed using amn-up-500-F and amn-in-500-R as primers, and amplification of a target band of approximately 1000 bp was considered positive.

[0196] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the AMP nucleosidase (amn) is NC_000913.3, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 946508 (2025.3.26).

[0197] (5) Replace the poxB gene with the ado1 gene

[0198] Using strain D8 as the starting strain, the poxB gene was replaced with the ado1 gene, and the constitutive promoter P119 was used to express the ado1 gene to obtain the recombinant strain D9. The specific steps are as follows:

[0199] (5-a) Construction of the targeting fragment poxB_up-kan-119-ado1-poxB_down:

[0200] The following DNA fragment was synthesized (GenScript): from 5' to 3', it contains the 70-bp upstream homology arm of the poxB gene (denoted as poxB up, see Table 1), the frt-kan-frt selection marker fragment (SEQ ID No. 9), the P119 promoter fragment (SEQ ID No. 2), the ado1 gene (SEQ ID No. 15), the TrrnB terminator fragment (SEQ ID No. 10), and the 70-bp downstream fragment of the poxB gene (denoted as poxB down, see Table 1). PCR amplification was performed using primers poxB-F / poxB-R and the synthesized DNA fragment as a template to generate the targeting fragment poxB_up-kan-119-ado1-poxB_down. This targeting fragment can be used to replace the poxB gene with the ado1 gene, which is then expressed using the P119 promoter.

[0201] (5-b) The subsequent steps were similar to those in Example 2 (1) (steps 5-b to 5-d), except that the host strain MC02 was replaced by D8 and the primers talB-F / talB-R were replaced by poxB-F / poxB-R. In step (5-c), PCR amplification was performed using poxB-up-500-F and Kan-in-R as primers, and amplification of a target band of approximately 1100 bp was considered positive. In step (5-d), PCR amplification was performed using poxB-up-500-F and poxB-in-500-R as primers, and amplification of a target band of approximately 3000 bp was considered positive.

[0202] The NCBI Reference Sequence number (NCBI Reference Sequence) of the pyruvate oxidase (hereinafter referred to as poxB) is CAD6018048.1, and the NCBI Reference Sequence number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 946132 (2023.10.7).

[0203] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the adenosine kinase (hereinafter referred to as Ado1) is NP_012639.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the adenosine kinase is Gene ID: 853569 (2025.05.11).

[0204] (6) Enhanced expression of apt genes

[0205] Using D9 as the starting strain, the expression of the apt gene was enhanced to obtain the recombinant strain D10. The specific steps are as follows:

[0206] (6-a) Targeting fragment apt up-kan-P CPA1 -apt down preparation:

[0207] The DNA fragments synthesized (GenScript) were as follows: from 5' to 3', they contained the 70 bp homology arm fragment upstream of the apt gene promoter (denoted as apt-up, see Table 1), the frt-kan-frt screening marker fragment, the P CPA1 The promoter fragment (SEQ ID No. 1) and the first 70 bp fragment of the apt gene (denoted as sequence apt-down, see Table 1) were amplified by PCR using apt-F / apt-R as primers and the gene-synthesized DNA fragment as template to obtain the targeting fragment apt up-kan-P CPA1 -apt down.

[0208] (6-b) The subsequent steps were similar to those in Example 2 (1) (steps 6-b to 6-d), except that the host strain MC02 was replaced by D9 and the primers talB-F / talB-R were replaced by apt-F / apt-R. In step (6-c), PCR amplification was performed using primers apt-up-500-F and Kan-in-R, and amplification of a target band of approximately 1100 bp was considered positive. In step (6-d), PCR amplification was performed using primers apt-up-500-F and apt-in-500-R, and amplification of a target band of approximately 1100 bp was considered positive.

[0209] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the adenine phosphoribosyltransferase (apt) is NP_415002, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the adenine phosphoribosyltransferase (apt) is Gene ID: 945113 (2025.3.26).

[0210] (7) Enhanced expression of adk gene

[0211] Using D10 as the starting strain, the expression of the adk gene was enhanced to obtain the recombinant strain D11. The specific steps are as follows:

[0212] (7-a) Targeting fragment adk up-kan-P CPA1 Preparation of -adk down:

[0213] The DNA fragments synthesized (GenScript) are as follows: from 5' to 3', they contain the 70 bp homology arm fragment upstream of the ADK gene promoter (denoted as ADK-UP, see Table 1), the FRT-KAN-FRT selection marker fragment, the P CPA1 The promoter fragment (SEQ ID No. 1) and the first 70 bp fragment of the adk gene (denoted as sequence adk-down) were amplified by PCR using adk-F / adk-R as primers and the gene-synthesized DNA fragment as template to obtain the targeting fragment adk up-kan-P CPA1 -adk down.

[0214] (7-b) The subsequent steps were as described in Example 2 (1) (steps 7-b to 7-d), except that the host strain MC02 was replaced by D10 and the primers talB-F / talB-R were replaced by adk-F / adk-R. In step (7-c), PCR amplification was performed using adk-up-500-F and Kan-in-R as primers, and amplification of a target band of approximately 1100 bp was considered positive. In step (7-d), PCR amplification was performed using adk-up-500-F and adk-in-500-R as primers, and amplification of a target band of approximately 1100 bp was considered positive.

[0215] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the adenylate kinase (adk) is NP_415007.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 945097 (2022.3.9).

[0216] (8) Enhanced expression of metK gene

[0217] Using D11 as the starting strain, the expression of the metK gene was enhanced to obtain the recombinant strain D12. The specific steps are as follows:

[0218] (8-a) Preparation of the targeting fragment metK up-kan-P119-metK down:

[0219] The gene-synthesized (GenScript) DNA fragments are as follows: from 5' to 3', they contain the 70-bp homology arm fragment upstream of the metK gene (denoted as metK-up, see Table 1), the frt-kan-frt selection marker fragment, the P119 promoter fragment (SEQ ID No. 2), and the first 70-bp fragment of the metK gene (denoted as metK-down). PCR amplification was performed using metK-F / metK-R as primers and the gene-synthesized DNA fragment as a template to obtain the targeting fragment metK up-kan-P119-metK down.

[0220] (8-b) The subsequent steps were as described in Example 2 (1) (steps 8-b to 8-d), except that the host strain MC02 was replaced by D11 and the primers talB-F / talB-R were replaced by metK-F / metK-R. In step (8-c), PCR amplification was performed using metK-up-500-F and Kan-in-R as primers, and amplification of a target band of approximately 1100 bp was considered positive. In step (8-d), PCR amplification was performed using metK-up-500-F and metK-in-500-R as primers, and amplification of a target band of approximately 1100 bp was considered positive.

[0221] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the L-methionine adenosyltransferase (hereinafter referred to as metK) is NP_417417.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the L-methionine adenosyltransferase is Gene ID: 945389 (2024.7.6).

[0222] (9) Evaluation of the gadusol production capacity of recombinant strain G16

[0223] To evaluate the gadusol production capacity of recombinant strain G16, the plasmid pRB1s-stEEVS-daMTox described in Example 3 (3-a) was introduced into recombinant strain D12 by the calcium chloride transformation method. After overnight culture at 37°C on LB plates containing 50 µg / mL streptomycin, clones were selected to obtain a production strain containing the plasmid, which was named recombinant strain G16.

[0224] The recombinant strain G16 was cultured and gadusol was prepared according to the method described in (2) of Example 3. As a control, the strain G8 was cultured in the same manner.

[0225] The quantitative results of extracellular gadusol are as follows Figure 3 As shown in the figure, after 24 hours of transformation, strain G16 accumulated 5.596±0.094 g / L gadusol extracellularly, which was higher than the 2.25±0.058 g / L accumulated by strain G8. This result indicates that the gadusol production capacity of strain G16 is enhanced.

[0226] Example 5. Construction of recombinant strains G17 and G18 and evaluation of their ability to produce gadusol

[0227] This example starts with the recombinant bacterium D12 prepared in Example 4. On this basis, pgi is knocked out and its pentose phosphate pathway is strengthened to further improve the supply of sedoheptulose-7-phosphate, thereby obtaining recombinant bacterium D14. The specific implementation steps are as follows:

[0228] (1) Knockout of the pgi gene

[0229] First, starting from the recombinant strain D12, its 6-phosphoglucose isomerase gene pgi was knocked out to obtain the recombinant strain D13. The specific steps are as follows:

[0230] (1-a) Preparation of the targeting fragment pGI-up-kan-pGI-down:

[0231] The gene-synthesized (GenScript) DNA fragments are as follows: from 5' to 3', they contain a 70-bp homology arm fragment upstream of the pgi gene (denoted as pgi-up, see Table 1), an frt-kan-frt screening marker fragment, and a 70-bp fragment downstream of the pgi gene (denoted as pgi-down, see Table 1). PCR amplification was performed using pgi-F and pgi-R as primers and the gene-synthesized DNA fragment as a template to obtain the targeting fragment pgi-up-kan-pgi-down.

[0232] (1-b) The subsequent steps were as described in Example 2 (1) (steps 1-b to 1-d), except that the host strain MC02 was replaced by D12 and the primers talB-F / talB-R were replaced by pgi-F / pgi-R. In step (1-c), PCR amplification was performed using primers pgi-up-500-F and Kan-in-R, and amplification of a target band of approximately 1100 bp was considered positive. In step (5-d), PCR amplification was performed using primers pgi-up-500-F and pgi-in-500-R, and amplification of a target band of approximately 1000 bp was considered positive.

[0233] The NCBI Reference Sequence number (NCBI Reference Sequence) of the glucose-6-phosphate isomerase (hereinafter referred to as pgi) is NP_418449.1, and the NCBI Reference Sequence number (NCBI Reference Sequence) of its encoding gene is Gene ID: 948535 (2023.10.7).

[0234] (2) Strengthening the pentose oxidative phosphate pathway

[0235] Using D13 as the starting strain, the P119-zwf-pgl-gnd gene was inserted into its pflB locus to generate recombinant strain D14. The specific steps are as follows:

[0236] (2-a) Preparation of the targeting fragment pflB up-kan-P119-zwf-pgl-gnd-pflB down:

[0237] The following DNA fragments were synthesized (GenScript) from 5' to 3': They contained, in order: a 70-bp homology arm fragment upstream of the pflB gene (denoted as pflB-up, see Table 1), an frt-kan-frt selection marker fragment, a P119 promoter fragment (SEQ ID No. 2), a zwf-pgl-gnd fragment (SEQ ID No. 13), a TrrnB terminator fragment (SEQ ID No. 10), and the first 70-bp fragment downstream of the pflB gene (denoted as pflB-down, see Table 1). PCR amplification was performed using pflB-F / pflB-R as primers and the synthesized DNA fragment as a template to generate the targeting fragment pflB up-kan-P119-zwf-pgl-gnd-pflBdown.

[0238] (2-b) The subsequent steps were similar to those in Example 2 (1) (steps 2-b to 2-d), except that the host strain MC02 was replaced by D13 and the primers talB-F / talB-R were replaced by pflB-F / pflB-R. In step (2-c), PCR amplification was performed using primers pflB-up-500-F and Kan-in-R, and a positive result was obtained when a target band of approximately 1100 bp was amplified. In step (2-d), PCR amplification was performed using primers pflB-up-500-F and pflB-in-500-R, and a positive result was obtained when a target band of approximately 1100 bp was amplified.

[0239] The NCBI Reference Sequence number of the lactate dehydrogenase (hereinafter referred to as pflB) is NP_415898.1, and the NCBI Reference Sequence number of the gene encoding the lactate dehydrogenase is Gene ID: 946315 (2024.12.3).

[0240] The NCBI Reference Sequence number (NCBI Reference Sequence) of the glucose-6-phosphate dehydrogenase (zwf) is AKT72612.1, and the NCBI Reference Sequence number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 946370 (2023.10.7).

[0241] The NCBI Reference Sequence number (NCBI Reference Sequence) of the 6-phosphogluconolactonase (pgl) is NP_415288.1, and the NCBI Reference Sequence number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 946398 (2024.12.3).

[0242] The NCBI Reference Sequence number (NCBI Reference Sequence) of the 6-phosphogluconate dehydrogenase (hereinafter referred to as gnd) is NP_416533.1, and the NCBI Reference Sequence number (NCBI Reference Sequence) of its encoding gene is Gene ID: 946554 (2023.10.7).

[0243] (3) Evaluation of the gadusol production capacity of recombinant strains G17 and G18

[0244] To evaluate the gadusol production capacity of recombinant bacteria G17 and G18, the plasmid pRB1s-stEEVS-daMTox described in Example 3 (3-a) was introduced into recombinant bacteria D13 and D14 by the calcium chloride transformation method. After overnight culture at 37°C on LB plates containing 50 µg / mL streptomycin, clones were selected to obtain production strains containing the plasmid, which were named recombinant bacteria G17 and G18.

[0245] Recombinant strains G17 and G18 were cultured and gadusol was prepared according to the method described in (2) of Example 3. As a control, strain G16 was cultured in the same manner.

[0246] The quantitative results of extracellular gadusol are as follows Figure 4 As shown in the figure, after 24 hours of transformation, strains G17 and G18 accumulated 6.51±0.26 g / L and 9.51±0.15 g / L gadusol extracellularly, respectively, which was higher than the 5.596±0.094 g / L gadusol accumulated by strain G16. The results showed that compared with strain G16, strains G17 and G18 had enhanced gadusol production capacity, and G18 had a higher gadusol yield than G17.

[0247] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that further improvements can be made to the present invention. In short, according to the principles of the present invention, this application is intended to include any changes, uses or improvements to the present invention, including changes that depart from the disclosed scope in this application and are made using conventional techniques known in the art.

Claims

1. A method for constructing a recombinant bacterium, characterized in that: The method comprises transforming the recipient bacteria as follows: M1), knocking out the transaldolase B (talB) gene in the recipient bacteria; M2), knocking out the transaldolase A (talA) gene in the recipient bacteria; M3), knocking out the glucose-6-phosphate isomerase (pgi) gene in the recipient bacteria; M4), knocking out the wild-type promoter that drives the expression of the transketolase A (tktA) gene in the recipient bacteria and replacing it with the promoter PCPA1; M5), knocking out the pyruvate formate lyase (pflB) gene in the recipient bacteria and replacing it with the constitutive promoter P119 and the genes encoding 6-phosphogluconolactonase (zwf), 6-phosphogluconolactonase (pgl), and 6-phosphogluconate dehydrogenase (gnd); M6), introducing the 2-epimal-5-epimal-valinone synthase (EEVS) gene into the recipient bacteria; M7) Introducing the methyltransferase-oxidoreductase (MTox) gene into the recipient bacteria.

2. The method according to claim 1, characterized in that The method further comprises transforming the recombinant bacteria as follows: M8), knocking out the L-methionine transcription factor (metJ) gene in the recipient bacteria and replacing it with the S-adenosyl-L-homocysteine ​​hydrolase (SAHase) gene; Furthermore, the S-adenosyl-L-homocysteine ​​hydrolase (SAHase) is composed of P CPA1 The promoter initiates expression; M9), knock out the wild-type promoter that drives the expression of the L-methionine adenosyltransferase (metK) gene in the recipient bacteria and replace it with promoter P 119 .

3. The method according to claim 1-2, characterized in that The method further comprises transforming the recombinant bacteria as follows: M10), knocking out the adenosine deaminase (add) gene in the recipient bacteria; M11) The wild-type promoter that drives the expression of the adenine phosphoribosyltransferase (apt) gene in the recipient bacteria was knocked out and replaced with the promoter P CPA1 ; M12), knock out the wild-type promoter that drives adenylate kinase (ADK) gene expression in the recipient bacteria and replace it with promoter P CPA1 ; M13), knocking out the 5'-nucleotidase diphosphatase (ushA) gene in the recipient bacteria; M14), knocking out the AMP nucleosidase (amn) gene in the recipient bacteria; M15), knocking out the pyruvate oxidase (poxB) gene in the recipient bacteria and replacing it with the adenosine kinase (Ado1) gene; Furthermore, the adenosine kinase (Ado1) is composed of P CPA1 The promoter initiates expression.

4. The method according to any one of claims 1 to 3, characterized in that: The NCBI Reference Sequence number of the glucose-6-phosphate isomerase (hereinafter referred to as pgi) is NP_418449.1, and the NCBI Reference Sequence number of the gene encoding it is Gene ID: 948535 (2023.10.7); The NCBI Reference Sequence number of the transaldolase A (hereinafter referred to as talA) is NP_416959.1, and the NCBI Reference Sequence number of the gene encoding it is Gene ID: 947006 (2023.10.7); The NCBI Reference Sequence number of the transaldolase B (hereinafter referred to as talB) is NP_414549.1, and the NCBI Reference Sequence number of the gene encoding it is Gene ID: 944748 (2023.10.7); The NCBI Reference Sequence number of the transketolase A (hereinafter referred to as tktA) is YP_026188.1, and the NCBI Reference Sequence number of the gene encoding it is Gene ID: 947420 (2023.10.7); The NCBI Reference Sequence number of the pyruvate formate lyase (hereinafter referred to as pflB) is NP_415423.1, and the NCBI Reference Sequence number of the gene encoding it is Gene ID: 94551 (2024.7.6); The NCBI Reference Sequence number of the glucose-6-phosphate dehydrogenase (zwf) is AKT72612.1, and the NCBI Reference Sequence number of the gene encoding it is Gene ID: 946370 (2023.10.7); The NCBI Reference Sequence number of the 6-phosphogluconolactonase (pgl) is NP_415288.1, and the NCBI Reference Sequence number of the gene encoding it is Gene ID: 946398 (2024.12.3); The NCBI Reference Sequence number (NCBI Reference Sequence) of the 6-phosphogluconate dehydrogenase (hereinafter referred to as gnd) is NP_416533.1, and the NCBI Reference Sequence number (NCBI Reference Sequence) of its encoding gene is Gene ID: 946554 (2023.10.7); The NCBI Reference Sequence number of the L-methionine biosynthesis transcription factor (hereinafter referred to as metJ) is NP_418373, and the NCBI Reference Sequence number of the gene encoding it is Gene ID: 948435 (2024.12.17); The NCBI Reference Sequence number of the L-methionine adenosyltransferase (hereinafter referred to as metK) is NP_417417.1, and the NCBI Reference Sequence number of the gene encoding it is Gene ID: 945389 (2024.7.6); The NCBI reference sequence number of the 2-epimal-5-epimal-valinone synthase (EEVS) from Streptomyces sp. CG1 is WP_369393227.1 (2024.8.8); The NCBI reference sequence number of the 2-epimal-5-epimal-valinone synthase (EEVS) from Streptomyces olivaceoviridis is WP_382568099.1 (2024.12.30); The NCBI reference sequence number of the 2-epimal-5-epimal-valinone synthase (EEVS) from Danio aesculapii is XP_056316349.1 (2023.5.27); The NCBI Reference Sequence Number (NCBI Reference Sequence) of the methyltransferase-oxidoreductase (MTox) from Danio aesculapii is XP_056316348.1 (2023.5.27); The NCBI Reference Sequence number of the methyltransferase-oxidoreductase (MTox) from Saitoella complicate NRRL Y-17804 is XP_017027009.1 (2020.2.5); The NCBI reference sequence number (NCBI Reference Sequence) of the S-adenosyl-L-homocysteine ​​hydrolase (SAHase) derived from Saccharomyces cerevisiae S288C is NP_010961.3 (2025.3.5); The NCBI Reference Sequence number of the adenylate kinase (adk) is NP_415007.1, and the NCBI Reference Sequence number of the gene encoding it is Gene ID: 945097 (2022.3.9); The NCBI Reference Sequence number of the adenine phosphoribosyltransferase (apt) is NP_415002, and the NCBI Reference Sequence number of the gene encoding it is Gene ID: 945113 (2025.3.26); The NCBI Reference Sequence number of the 5'-nucleotidase diphosphatase (ushA) is NC_000913.3, and the NCBI Reference Sequence number of the gene encoding it is GeneID: 947331 (2025.3.26); The NCBI Reference Sequence number of the adenosine deaminase (add) is NC_000913.3, and the NCBI Reference Sequence number of the gene encoding it is Gene ID: 945851 (2025.3.26); The NCBI Reference Sequence number of the AMP nucleosidase (amn) is NC_000913.3, and the NCBI Reference Sequence number of the gene encoding it is Gene ID: 946508 (2025.3.26); The NCBI Reference Sequence number of the pyruvate oxidase (hereinafter referred to as poxB) is CAD6018048.1, and the NCBI Reference Sequence number of the gene encoding it is Gene ID: 946132 (2023.10.7); The NCBI Reference Sequence number of the adenosine kinase (hereinafter referred to as Ado1) is NP_012639.1, and the NCBI Reference Sequence number of the gene encoding it is Gene ID: 853569 (2025.05.11); Wherein, the PCPA1 promoter is any one of the following DNA molecules: 1) The nucleotide sequence of one chain is a DNA molecule having SEQ ID No: 1 in the sequence listing, 2) a DNA molecule that is more than 80% identical to the DNA molecule in 1) and has promoter function; The P119 promoter is any of the following DNA molecules: 3) A DNA molecule whose nucleotide sequence on one chain is SEQ ID No: 2 in the sequence listing, 4) A DNA molecule that has more than 80% identity with the DNA molecule in 3) and has promoter function.

5. Use of the method according to any one of claims 1 to 4 in W1) or W2): W1) Application in the production of mycosporin-like amino acid gadusol; W2) Application in the preparation of products producing mycosporin-like amino acid gadusol.

6. A method for preparing a mycosporin-like amino acid gadusol, comprising inoculating the recombinant bacterium according to claim 6 into a culture medium containing the substrate using glucose or the like as a substrate, and catalyzing the production of the mycosporin-like amino acid gadusol by whole-cell catalysis.

Images