Application of Dihydroquercetin in Virus-free Production of Passiflora edulis and Breeding Use of Pedu CYP75B Gene
By using dihydroquercetin chemical treatment combined with micro-shoot tip culture and PeduCYP75B gene expression in passion fruit, the problem of passion fruit virus disease was solved, achieving efficient virus removal and disease-resistant breeding, and providing the passion fruit industry with stable and efficient virus removal technology and the application of disease-resistant genes.
Patent Information
- Application Number
- CN202510782084.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-12
- Publication Date
- 2026-02-27
- Estimated Expiration
- 2045-06-12
AI Technical Summary
In the current technology, viral diseases of passion fruit seriously restrict the development of the industry. There are no reports on the combination of chemical detoxification and micro-stem tip detoxification. There are no reports on the application of flavonoids in passion fruit detoxification. The functions of related genes in passion fruit are unknown. There is a lack of efficient detoxification technology and disease-resistant genes.
A passion fruit detoxification system was established by chemical treatment with dihydroquercetin combined with micro-shoot tip culture. The PeduCYP75B gene was also identified to increase dihydroquercetin synthesis. Passion fruit explants were cultured in MS medium with dihydroquercetin added, and the PeduCYP75B14, PeduCYP75B24, and PeduCYP75B37 genes were cloned and expressed in a yeast system to verify their catalytic activity.
It significantly improved the virus eradication efficiency of passion fruit, with the virus eradication rates of night-blooming jasmine mosaic virus and East Asian passion fruit virus reaching 21.09±4.28% and 19.85±2.24%, respectively. There was no significant difference in seedling survival rate, laying the foundation for the creation of virus-resistant germplasm and molecular breeding of passion fruit.
Smart Images

Figure CN120608010B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application relates to the technical field of tissue culture and detoxification, in particular to application of dihydroquercetin in Passiflora edulis detoxification and disease-resistant breeding use of Pedu CYP75B genes. BACKGROUND
[0002] Passiflora edulis, also known as egg fruit, passion fruit, passion fruit, and Brazilian fruit, is a perennial vine plant originally from South America. It is rich in vitamins, amino acids, phenolic compounds, flavonoid active substances, minerals and other nutrients required by the human body. In recent years, Passiflora edulis has been widely planted, but viral diseases have seriously hindered the development of the Passiflora edulis industry. To solve this big problem in the industry, on the one hand, a stable and efficient Passiflora edulis detoxification system can be established to obtain a large number of detoxified seedlings, and on the other hand, disease-resistant varieties can be cultivated by mining disease-resistant genes.
[0003] The method for obtaining detoxified seedlings by adding virus zao, virus ether, salicylic acid, dihydrothioctic acid and other antiviral agents in the culture medium for in vitro culture is called chemical detoxification method. The antiviral agents can stimulate the plant to produce systemic resistance or inhibit the movement and proliferation of plant viruses. In the prior art, chemical treatment is often combined with micro stem tip detoxification to obtain better detoxification effect. However, there is no report on the combination of Passiflora edulis micro stem tip and chemical detoxification. Although flavonoids have been confirmed to inhibit proliferation by combining with viral proteins, their specific application in Passiflora edulis detoxification has not been reported. The synthesis of flavonoids in plants depends on CYP75 family enzymes (such as F3'H / F3'5'H), but the function of related genes in Passiflora edulis is unknown. Therefore, it is of great significance to develop efficient detoxification technology for Passiflora edulis and mine disease-resistant genes for the industrial production of virus-free seedlings. SUMMARY
[0004] The application provides the application of dihydroquercetin in Passiflora edulis detoxification and the disease-resistant breeding use of Pedu CYP75B genes to solve the problems in the prior art. The application also provides a chemical detoxification method for Passiflora edulis, which establishes an in vitro culture system of Passiflora edulis detoxified seedlings by chemical treatment with dihydroquercetin, and mines catalytic enzymes of dihydroquercetin in Passiflora edulis to provide a reference for resistance breeding.
[0005] To achieve the above-mentioned purpose, the application provides the following solutions.
[0006] The application provides the application of dihydroquercetin in the preparation of Passiflora edulis detoxification preparations.
[0007] The application further provides an application of Pedu CYP75B genes in breeding virus-resistant guava varieties, wherein the genes are used to increase the synthesis of dihydroquercetin, and the Pedu CYP75B genes are selected from the group consisting of a Pedu CYP75B14 gene with a nucleotide sequence as shown in SEQ ID NO. 5, a Pedu CYP75B24 gene with a nucleotide sequence as shown in SEQ ID NO. 6, and a Pedu CYP75B37 gene with a nucleotide sequence as shown in SEQ ID NO. 7.
[0008] Further, the Pedu CYP75B gene encodes a protein with F3'H enzyme activity.
[0009] Further, the virus includes a Mirabilis jalapa mosaic virus and / or a Passiflora edulis virus.
[0010] The application further provides a method for decontaminating guavas, which comprises the step of inoculating an explant of a guava into a culture medium added with dihydroquercetin for culture.
[0011] Further, the explant is a microstem tip.
[0012] Further, the culture time is 60 days.
[0013] The application further provides a culture medium for decontaminating guavas, which comprises a basic culture medium and dihydroquercetin.
[0014] Further, the basic culture medium comprises an MS culture medium.
[0015] Further, the concentration of the dihydroquercetin is 5-60 mg / L.
[0016] The application discloses the following technical effects:
[0017] The application significantly improves the virus removal efficiency by adding 50 mg / L of Dihydroquercetin to the MS medium to treat the guava tissue culture seedlings, combined with micro stem tip culture. Among them, the TeMV detoxification rate reaches 21.09±4.28%, the EAPV detoxification rate reaches 19.85±2.24%, and the survival rate has no significant difference with the control group, which confirms that Dihydroquercetin can efficiently remove the virus of guava without affecting the plant regeneration. At the same time, the application first clones PeduCYP75B14 (SEQ ID NO. 5), PeduCYP75B24 (SEQ ID NO. 6), and PeduCYP75B37 (SEQ ID NO. 7) genes from guava, constructs the eukaryotic expression vector and successfully expresses in the yeast system; verified by LC-MS / MS, the recombinant enzyme can catalyze the substrate dihydrokaempferol to convert into Dihydroquercetin, which confirms that the three have F3'H enzyme activity, and lays a foundation for the creation of guava virus-resistant germplasm and molecular breeding. The application verifies that PeduCYP75B14 / 24 / 37 is the key enzyme for catalyzing the biosynthesis of Dihydroquercetin in guava, and its function verification and detoxification application fill the gap in the prior art, and provide core support for virus-resistant seedling production and molecular breeding. BRIEF DESCRIPTION OF DRAWINGS
[0018] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor.
[0019] Figure 1 The results of double enzyme digestion of the eukaryotic expression vector are shown in the figure; wherein M is Marker; 1-3 are expression vectors pYES2-NT-C-PeduCYP75B14, pYES2-NT-C-PeduCYP75B24 and pYES2-NT-C-PeduCYP75B37 respectively;
[0020] Figure 2 The results of Western blot detection of PeduCYP75B14, PeduCYP75B24, and PeduCYP75B37 recombinant proteins are shown in the figure; wherein M is Marker; 1-3 are PeduCYP75B14, PeduCYP75B24, and PeduCYP75B37 recombinant proteins respectively;
[0021] Figure 3LC-MS / MS detection of the expected product, dihydroquercetin, catalyzed by the recombinant proteins in vivo; wherein A, B and C are the catalytic products of PeduCYP75B14, PeduCYP75B24 and PeduCYP75B37 recombinant yeasts, respectively, under three ion conditions (three ion conditions and Figure 3 The corresponding relationship of green, blue and red colors is green: Q1 / Q3 = 303.2 / 284.7; blue: Q1 / Q3 = 303.2 / 176.8; and red: Q1 / Q3 = 303.2 / 124.7, respectively, under the detected dihydroquercetin signal. DETAILED DESCRIPTION
[0022] The detailed description set forth below of certain inventive embodiments is not offered as a limitation of the present application. Rather, it is an exemplification of certain aspects of the present application, and these aspects are meant to be illustrative only.
[0023] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. In addition, where particular ranges of values are given, understand that each intervening value, to the upper or lower limit of the ranges is also specifically included. Each smaller range that falls within the broader ranges is also specifically included. The upper and lower limits of these smaller ranges can independently be included or excluded in the range, and each range of values should be considered as having been specifically pointed out herein.
[0024] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although preferred methods and materials are described, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application. All documents mentioned herein are incorporated by reference to disclose and describe the methods and / or materials in connection with which the documents are cited. In case of conflict, the content of the present specification will control.
[0025] Various modifications and changes can be made to the specific embodiments of the present application described herein without departing from the scope or spirit of the application. Other embodiments of the application will be apparent to those of ordinary skill in the art from the description and examples presented herein. The description and examples are illustrative only and are not intended to limit the scope of the application.
[0026] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or variations thereof, are intended to be open-ended terms that mean including, but not limited to.
[0027] Example 1
[0028] 1. Experimental materials
[0029] Guava was from Guizhou Provincial Academy of Agricultural Sciences Guava Experimental Base, Anshun City, Guizhou Province, and the variety was "Qinmi No. 9". The guava was transplanted to the sterilized cultivation substrate, and then moved into the artificial climate chamber for cultivation. The environmental parameters were set as constant temperature 26℃, day / night light cycle 14h / 8h, and constant relative humidity 70%.
[0030] Escherichia coli strain DH5α was purchased from Shanghai Shengong Biotechnology Co., Ltd.; Saccharomyces cerevisiae strain WAT11 was purchased from Beijing Coolab Technology Co., Ltd.; and the yeast eukaryotic expression vector pYES2-NT-C was purchased from Changsha Aibive Biotechnology Co., Ltd.
[0031] 2 Virus detection
[0032] 2.1 Extraction of total RNA from diseased guava leaves and synthesis of cDNA
[0033] The total RNA of guava diseased leaves was extracted by TRIzol method. The specific steps were as follows:
[0034] (1) Fresh diseased leaf samples of 100-200 mg were cut and placed in 2 mL grinding tubes containing sterilized steel beads, and then frozen by liquid nitrogen;
[0035] (2) The samples were ground in a grinding instrument until powdery (50 Hz, 30 s), 1 mL of TRIzol was added, and then shaken and mixed on ice for 5 min;
[0036] (3) 200 μL of RNA extraction solution was added, shaken and mixed, and then placed on ice for 5 min;
[0037] (4) Centrifuged at 12000 rpm for 10 min at 2℃, and 500 μL of supernatant was transferred to a new 1.5 mL enzyme-free centrifuge tube;
[0038] (5) 500 μL of isopropanol (-20℃ pre-cooled) was added, inverted 20 times, and then placed in a -20℃ refrigerator for 20 min;
[0039] (6) Centrifuged at 12000 rpm for 10 min at 2℃, and the supernatant was discarded. Immediately, 800 μL of enzyme-free 70% alcohol was added to wash the precipitate;
[0040] (7) Centrifuged at 12000 rpm for 5 min at 2℃, the supernatant was carefully discarded, and the remaining liquid was absorbed after brief centrifugation. After opening the cover and drying for 5-8 min, 50 μL of DEPC water was added, and then stored at -80℃ for standby.
[0041] The total RNA obtained was used as a template to synthesize cDNA, and the first strand cDNA was synthesized according to the instructions of HiScript IV 1st Strand cDNA Synthesis Kit (Novogene Bioinformatics Co., Ltd.), and then diluted with 50 μL ddH2O and stored at -20℃ for standby.
[0042] 2.2 Primer synthesis
[0043] The guava virus detection specific primers of the application were synthesized by Beijing Chengke Biological Technology Co., Ltd. (Table 1).
[0044] Table 1 Guava virus detection specific primers
[0045]
[0046] 2.3 RT-PCR detection of virus
[0047] The RT-PCR system was as follows: cDNA 1 μL, upstream primer 0.5 μL, downstream primer 0.5 μL, 2×Rapid Taq Master Mix 13.5 μL, ddH2O 10.5 μL, and the PCR reaction program was shown in Table 2 (the reaction was performed for 35 cycles). The mixed infected guava was used as the explant material for detoxification treatment.
[0048] Table 2 PCR reaction program
[0049]
[0050]
[0051] 2.4 Tissue culture conditions
[0052] The culture medium was: 4.41 g / L MS basal salt, 30 g / L sucrose, 6.5 g / L agar. After adjusting the pH value to 6.0±0.1, high-pressure sterilization was performed at 121℃ and 0.1 MPa for 20 min. The culture conditions were: the environmental temperature was set to 24±1℃, and a light period of 12 h was provided every day, and the light intensity was about 1800 lx.
[0053] 3. Chemical detoxification
[0054] 3.1 Calculation formula and data processing
[0055] The following calculation formula was used to quantitatively analyze each index:
[0056] The seedling rate (%) = (the total number of germinated seedlings / micro stem tips inoculated) × 100%;
[0057] Detoxification rate (%) = (total number of virus-free plantlets / total number of tested plantlets) x 100%;
[0058] Detoxification rate (%) = (total number of virus-free plantlets / total number of tested plantlets) x 100%;
[0059] 3.2 Disinfection of explants
[0060] In the sunny afternoon of the growing season of passion fruit (March to September), the tender branches of the current year were cut from the passion fruit plants with good growth conditions, and the leaves were removed. The branches were cut to about 6 cm and used as explant materials. The explants were soaked in 500 times benomyl solution for 30 min, and then rinsed with running water for more than 3 h. The explants were transferred to a clean bench, immersed in 75% alcohol for 30 s, and then washed with sterile water for more than 2 min for 3 times. 20% NaClO was used as the disinfectant for 10 min. After disinfection, the explants were rinsed with sterile water for more than 2 min for 3 times, and the bottle containing the explants was shaken constantly during the process. After the end, the water on the surface of the explants was absorbed with filter paper.
[0061] 3.3 Chemical treatment of passion fruit for detoxification
[0062] Different concentrations (see Table 3) of Dihydroquercetin were added to the MS medium, and passion fruit plantlets with a height of 6-9 cm were transferred to the medium. After 21 days of inoculation, 0.5-1 mm stem tips were removed, and the microstem tips without chemical treatment were used as blank controls (CK). MS + 1 mg / L 6-BA + 0.3 mg / L NAA was used as the microstem tip induction medium. Each treatment inoculated 30 microstem tips, repeated 3 times, and the rooting rate, TeMV and EAPV detoxification rate, and detoxification rate were counted after 60 days of inoculation.
[0063] The results are shown in Table 3. In all treatment groups, the rooting rate was not significantly different from the blank control. When the concentration of Dihydroquercetin was 50 mg / L, the TeMV and EAPV detoxification rates were 21.09 ± 4.28% and 19.85 ± 2.24%, respectively, which were significantly higher than the blank control. Therefore, the best detoxification treatment was the H3 treatment group.
[0064] Table 3 Effect of different concentrations of Dihydroquercetin on rooting rate, detoxification rate, and detoxification rate
[0065]
[0066]
[0067] 4 Construction of Ped CYP75B eukaryotic expression vector
[0068] The nucleotide sequence of Ped CYP75B of passion fruit is as follows:
[0069] PedU CYP75B14 gene:
[0070]
[0071] Ped U CYP75B24 gene:
[0072]
[0073] PedU CYP75B37 gene:
[0074] ATGATTTATTATGAACATGTGGGTTCTGGTGGTAGACTGAAAATCCTTATGGAGAGGATGGTAGACGTAGCAGGTAGCACAAATATTGCAGACTTTTATCCGTTTCTTGCTGGAGTAGATCCACAGGGGATAAGAGGAGAGATGAGAAGGCTTATTGATGAAATGTATGAAGCATGGGAAGATGAAGTCAAAGCAAGAAGAGCATGTCGAGACAATGGTGCTCCTAAGAGAGACCTTTTGGATTCTTTTCTGGAGAATGGATTTGATAACGATCATATCAATTGGTTAACACTTGAGTTACTAATTGCAGGTTCAGACACTACAATTGCAACAGTAGAATGGGCAATGAAACAAACAAGTCCTGGACAAGGTATGCGAAGAGCTAGCACGGAAATGGACGACCAAAACCAGATGAAAGAGTCTCGTATCTCTCAACTTCCATATTTACATGCTTGTGTGAAGGAAACACTAAGACTGCATCCACCAACACCATTACTTGATCCTCGTCGAGCCACCGATTCATGTGAAGTCATGAACTATACAATTCCGAGAGAAACTCAGATATTCATAAACGTCTGGGCTATGGGACGTGACCCTTCAGTATGGGAGGATCCATTATCGTTCAAGCCCGAGAGGTTTCTTAGCTCAAACATGGATTACAAAGGCCAGCACTATGAGTTCTTACCTTTCGGTGGAGGAAGAAGGATTTGCCCAGGATTGAATATGACTCCCTCCTTGTTGCATTATTTTGATTGGTCTCTGCCAAATGGGGAAGATCCTTCAAAGCTGGACATGAAGGAAAAATTTGGAGTGATATTGCAGAAGGAACAGCAGCTGCTTCTTGTTCCCAACAAAAGATCTTGA (SEQ ID NO. 7).
[0075] 4.1 Gene cloning
[0076] The eukaryotic expression vector was constructed using the method of homologous recombination, and the full-length cloning primer of PeduCYP75 gene was designed according to the sequence information of the candidate gene and the vector using the online primer design tool of Novozyme (https: / / crm.vazyme.com / cetool / singlefragment.html).
[0077] Table 4 Full-length cloning primer of PeduCYP gene
[0078]
[0079]
[0080] Note: The lower case part is the homologous arm.
[0081] The gene was amplified using passion fruit cDNA as the template, and the reaction system and PCR program are shown in Tables 5 and 6.
[0082] Table 5 Reaction system
[0083]
[0084] Table 6 PCR program
[0085]
[0086] Note: The reaction was performed for 32 cycles.
[0087] 4.2 Construction of expression vector
[0088] The eukaryotic expression vector pYES2-NT-C was double-digested using BamH I and EcoR I, and the enzyme digestion system is shown in Table 7. The double-digested product was identified by gel electrophoresis, and the linearized vector was recovered and purified.
[0089] Table 7 Enzyme digestion system
[0090]
[0091] The cloning product was ligated with the linearized vector, and the reaction system was as follows: linearized vector 2 μL, target gene fragment 0.5 μL, ligase 2.5 μL, ligation at 50°C for 5 min; E. coli DH5α was thawed on ice, 2.5 μL of the ligation product was added, and it was gently mixed and placed on ice for 30 min, then it was heat shocked at 42°C for 45 s, quickly placed on ice for 2 min, 600 μL of liquid LB medium (without antibiotics) was added, and it was cultured at 37°C and 300 rpm for 45 min, 80 μL of the bacterial solution was uniformly spread on solid LB medium containing the corresponding antibiotic, and it was cultured overnight in a 37°C incubator; single colonies were picked for colony PCR verification, the single colonies containing the target band were expanded, plasmids were extracted for double enzyme digestion and sequencing verification.
[0092] Results as shown in Figure 1 Figure 2, the recombinant plasmid was verified by double enzyme digestion using endonuclease BamH I and EcoR I, electrophoresis showed a single band at 1500 bp and 800 bp, which was consistent with the size of the candidate gene. The sequencing results were consistent with the CDS sequence of the candidate gene, indicating that the eukaryotic expression vectors pYES2-NT-C-PeduCYP75B14, pYES2-NT-C-PeduCYP75B24 and pYES2-NT-C-PeduCYP75B37 were successfully constructed.
[0093] 5 Verification of catalytic activity
[0094] 5.1 Induced expression and extraction of recombinant protein
[0095] (1) Transform the recombinant plasmid into WAT11 yeast competent cells, pick positive clones in SG-Ura medium, inoculate 20 mL of SD / -Ura liquid medium, and incubate at 30°C, 280 rpm overnight;
[0096] (2) Centrifuge at 1500g for 5 min at 4°C to collect the bacterial cells, resuspend the precipitate with 500 mL of SG / -Ura liquid medium, and continue to incubate overnight under the same conditions;
[0097] (3) Centrifuge at 1500g for 5 min at 4°C to collect the bacterial cells, resuspend the bacterial cells with TEK buffer, stand at room temperature for 5 min, centrifuge at 4°C, 1500g, discard the supernatant, and resuspend the bacterial cell precipitate with 2.5 mL of TESB buffer;
[0098] (4) Add 0.5 mm acid-washed glass beads to completely cover the bacterial cells, use a full-automatic tissue rapid grinding instrument for crushing (30 Hz, 30 s / time), repeat the operation after ice bath for 1 min, repeat for 30 times;
[0099] (5) Add 5 mL of TESB buffer to wash the glass beads, repeat the washing for 3 times, and combine the eluate;
[0100] (6) Centrifuge at 12000g for 10 min at 4°C to collect the supernatant;
[0101] (7) Dilute the sample to 3 times the volume with TESB buffer;
[0102] (8) Add 0.15 M NaCl and 0.1 g / mL PEG4000 to a final concentration, and precipitate on ice for 15 min;
[0103] (9) Centrifuge at 12000g for 10 min at 4°C to collect the precipitate, resuspend with TEG buffer, and then distribute to 1.5 mL centrifuge tubes, and store at -80°C for standby.
[0104] 5.2 Western blot detection of recombinant protein
[0105] (1) Take 50 μL of extracted recombinant protein and mix with 150 μL loading buffer, 100°C metal bath for 15 min, -80°C storage for standby;
[0106] (2) Take the treated protein sample for SDS-PAGE gel electrophoresis, 90V, electrophoresis until the sample is a straight line in the concentrated gel, 120V, electrophoresis until the sample is close to the bottom;
[0107] (3) Take the appropriate size PVDF membrane for transfer, PVDF membrane needs to be soaked with methanol before use, transfer conditions are 400mA, 25min;
[0108] (4) After transfer, the PVDF membrane is placed in the prepared skimmed milk powder, and sealed at room temperature for 2h;
[0109] (5) PVDF membrane is placed in the primary antibody solution (1:5000) at room temperature for 2h, and washed with 1x TBST for 3 times, 10min each time after incubation;
[0110] (6) PVDF membrane is placed in the secondary antibody solution (1:8000) at room temperature for 1h, and washed with 1x TBST for 3 times, 10min each time after incubation; add developing solution for photography.
[0111] The results are shown in Figure 2 As shown, a single band appears at 50KDa and 30KDa, which is consistent with the expected size, indicating that PeduCYP75B14, PeduCYP75B24 and PeduCYP75B37 are successfully expressed in recombinant yeast.
[0112] 5.3 In vivo catalysis experiment of recombinant yeast
[0113] (1) Take the recombinant yeast positive monoclonal from the SD / -Ura culture plate, add 30mL SD / -Ura+20g / L glucose liquid medium to a 50mL centrifuge tube, and culture at 30°C, 250rpm on a shaker until OD 600 =0.6;
[0114] (2) Centrifuge at room temperature, 700g for 5min to collect the bacterial cells, discard the supernatant, add 30mL SD / -Ura+20g / L galactose liquid medium to resuspend, adjust OD 600 to 0.4;
[0115] (3) Take 2 mL of the prepared culture medium into a 10 mL centrifuge tube, add 1 mM NADPH and 20 μg / mL dihydrokaempferol that have been filtered and sterilized, and transfer to a 16℃ shaker at 250 rpm for overnight culture for 12 h.
[0116] (4) Add 2 mL of ethyl acetate to stop the reaction, vortex to mix, centrifuge at 6000 g for 5 min at room temperature, and collect the upper liquid into a new centrifuge tube.
[0117] (5) Repeat step 4;
[0118] (6) Evaporate the organic phase of the liquid using a vacuum rotary dryer at 50 rpm and 30-35 ℃, add 150 μL of chromatographic grade methanol to redissolve it, filter it with a 0.22 μm organic filter membrane, and then use it for LC-MS product detection and analysis.
[0119] The results are as follows Figure 3 As shown, LC-MS / MS liquid phase spectra indicate that the catalytic products of recombinant yeasts PeduCYP75B14, PeduCYP75B24, and PeduCYP75B37 were catalyzed under three daughter ion conditions (Q1 / Q3 = 303.2 / 284.7, Q1 / Q3 = 303.2 / 176.8, and Q1 / Q3 = 303.2 / 124.7, respectively); the three ion conditions are consistent with... Figure 3 The corresponding relationships of green, blue, and red colors are as follows: green: Q1 / Q3 = 303.2 / 284.7; blue: Q1 / Q3 = 303.2 / 176.8; red: Q1 / Q3 = 303.2 / 124.7. Dihydroquercetin signals were detected in all of them. This result indicates that PeduCYP75B14, PeduCYP75B24, and PeduCYP75B37 have F3'H activity and can catalyze the hydroxyl substitution at the 3' position of the B ring of dihydrokaempferol to generate dihydroquercetin.
[0120] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. The application of dihydroquercetin in the preparation of passion fruit detoxification agents, characterized in that, The detoxified viruses are night-blooming jasmine mosaic virus and / or passion fruit virus.
2. A method for detoxifying passion fruit, characterized in that, The method includes the step of inoculating passion fruit explants into a culture medium supplemented with dihydroquercetin for cultivation, wherein the detoxified virus is night-blooming jasmine mosaic virus and / or East Asian passion fruit virus.
3. The detoxification method according to claim 2, characterized in that, The explant is a microstem tip.
4. The detoxification method according to claim 2, characterized in that, The culture period is 60 days.