Preparation method and application of solid-phase synthesis carrier functionalized surface

Abstract

The invention relates to a solid-phase carrier surface functionalization method and application thereof. The method combines the steps of carrier surface alkylation and surface branching treatment, firstly, a functional surface with functional groups including hydroxyl or amino and the like is formed on the surface of the carrier, then the functional surface is subjected to branching treatment, and the functional surface with expanded coupling groups is obtained. A large number of groups capable of being coupled and synthesized are loaded on the functionalized surface through surface alkylation treatment, the density of the groups is further remarkably increased through branching treatment, more synthesis starting points are provided for synthesis of bioactive molecules, the bioactive molecule synthesis loading capacity of the chip is improved, and the method is suitable for large-scale and industrialized solid-phase synthesis of the bioactive molecules.

Description

Technical Field

[0001] The present application relates to the field of biological solid-phase synthesis, and in particular to a surface functionalization method for a solid-phase synthesis carrier and its application. Background Art

[0002] Solid-phase synthesis has become a common technique in the life sciences in recent years. Its basic principle is to immobilize a large number of oligonucleotide molecules on a support to achieve the artificial synthesis of oligonucleotide chains. This high-fidelity, low-cost technique has demonstrated strong potential in areas such as gene expression profiling, novel gene discovery, mutation and polymorphism analysis, genomic library mapping, clinical testing, biopharmaceuticals, and gene sequencing.

[0003] The solid-phase phosphoramidite method is a relatively well-established strategy for the solid-phase synthesis of oligonucleotides. Traditional synthesis methods rely on column-based synthesis based on phosphoramidite chemistry, where each oligonucleotide is synthesized in a separate column on a synthesis tube or plate. Yields typically reach nanomolar (nmol) levels. However, this synthesis consumes large amounts of organic reagents, resulting in high costs, heavy environmental wastewater treatment burdens, and limited synthetic throughput. New-generation DNA synthesis technologies primarily achieve high-throughput oligonucleotide synthesis through massively parallel synthesis, primarily including photochemical in situ synthesis, electrochemical in situ synthesis, and in situ synthesis based on microfluidics and inkjet printing. Microfluidic chips integrate numerous solid-phase synthesis units, and an inkjet printhead selectively delivers the phosphoramidite reaction raw materials to each synthesis unit, enabling high-throughput in situ custom nucleic acid synthesis.

[0004] The key to in-situ inkjet printing synthesis is how to stabilize the ink droplets printed on the surface of the solid support at a specific position. In practical applications, a common method is to use hydrophilic and hydrophobic reagents to treat areas on the surface of the solid support respectively. The hydrophilic area provides hydrophilic groups for subsequent synthesis reactions with phosphoramide monomers, while the hydrophobic area usually acts as a "barrier" to the ink droplet landing point. These hydrophobic areas occupy a considerable portion of the surface of the solid support, thereby reducing the area available for synthesis and the overall yield. In addition, increasing the synthesis flux often means sacrificing the area of ​​a single synthesis site, resulting in a certain trade-off between synthesis yield and synthesis flux.

[0005] Therefore, how to increase the density of synthetic groups on the solid-phase synthesis surface has become one of the main challenges facing inkjet printing synthesis technology. Summary of the Invention

[0006] In order to obtain a solid phase carrier with a higher density of synthetic groups, the first aspect of the present application provides a surface functionalization method for a solid phase synthetic carrier. Specifically, the method includes the following steps: a first step, surface functionalization modification; a second step, functionalization expansion.

[0007] The surface functionalization modification includes connecting a terminal functional group to the surface of a solid phase synthesis carrier.

[0008] Preferably, the terminal functional groups include one or more of hydroxyl, carboxyl, amino, aldehyde, epoxy or methoxy groups.

[0009] Furthermore, the terminal functional groups include one or more of hydroxyl, carboxyl, amino or epoxy groups.

[0010] The method for connecting a terminal functional group includes connecting a coupling agent containing a terminal functional group to a surface.

[0011] Preferably, the coupling agent containing terminal functional groups includes a silane coupling agent containing terminal amino groups, terminal hydroxyl groups or epoxy groups.

[0012] The functionalization extension includes the amplification of terminal functional groups.

[0013] Preferably, the amplification of the surface terminal functional groups includes branching of the functional groups.

[0014] The branching treatment includes connecting a polymer having a hyperbranched terminal functional group and / or a hyperbranched terminal functional group biologically active molecular monomer analog to the surface terminal functional group.

[0015] Preferably, the polymer having a hyperbranched terminal functional group and / or the biologically active molecule monomer analogue comprises a polymer having a branched terminal amino group and / or a phosphoramidite monomer having a branched DMT group.

[0016] The functionalization method further comprises connecting a cleavable coupling linker reagent to the extended functionalized group.

[0017] The cleavable coupling linker comprises a coupling group that can be connected to the branched surface and a group that can be coupled to the biologically active molecule monomer.

[0018] In a second aspect of the present application, a functionalized surface of a solid phase synthesis carrier is provided, wherein the functionalized surface comprises a functional region capable of being grafted with a biologically active molecule.

[0019] The functional area is prepared by the method of functionalizing the surface of the solid phase carrier.

[0020] Preferably, the functional areas are separated by patterning.

[0021] The ordered partitioning of the functionalized surface includes configuring non-functionalized surface repeating units to partition the functionalized surface.

[0022] The non-functionalized surface includes a surface having hydrophobic properties.

[0023] Preferably, the surface having hydrophobic properties includes a surface treated with a perfluoro chain, a chain alkane siloxane or a chlorosilane.

[0024] In a third aspect of the present application, a solid phase carrier having a functionalized surface is provided.

[0025] The materials of the solid phase carrier include conventional materials in the art such as silicon wafer, quartz glass sheet, PDMA, etc.

[0026] The functionalized surface includes the functionalized surface obtained by the functionalization method and / or the functionalized surface orderly separated by non-functional surfaces.

[0027] In a fourth aspect, the present application discloses a solid phase carrier having a functionalized surface prepared by the method, which is used for the in situ synthesis of bioactive molecules.

[0028] The beneficial effects of the present invention are:

[0029] The present invention provides a surface functionalization method for a solid-phase synthesis carrier. The method increases the density of synthetic linkers on the carrier surface by functionalizing the surface and expanding the functional groups, significantly improving the oligonucleotide loading capacity on the carrier surface, and facilitating the large-scale and industrialized synthesis of bioactive molecules. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 Amplification curve of the synthetic product.

[0031] Figure 2 The standard curve of the synthesis results.

[0032] Figure 3 Schematic diagram of surface hydroxylation.

[0033] Figure 4 Schematic diagram of surface amination.

[0034] Figure 5 Schematic diagram of surface epoxy modification.

[0035] Figure 6 Schematic diagram of surface amino group extension.

[0036] Figure 7 Schematic diagram of surface branched phosphoramidite modification.

[0037] The meaning of the numbers in the figure are: 201 is the position of the synthetic amount of Comparative Example 1 on the standard curve, 202 is the position of the synthetic amount of Comparative Example 2 on the standard curve, 203 is the position of the synthetic amount of Application Example 1 on the standard curve, 204 is the position of the synthetic amount of Application Example 3 on the standard curve, and 205 is the position of the synthetic amount of Application Example 2 on the standard curve. DETAILED DESCRIPTION

[0038] 1. The invention content of this application is described in conjunction with specific implementation methods. On the one hand, this application provides a method for functionalizing the surface of a solid carrier. Specifically, the method includes the following steps: the first step is surface functionalization modification; the second step is functionalization expansion.

[0039] The surface functionalization modification includes connecting a modification layer having terminal functional groups to the surface of the material.

[0040] Preferably, the terminal functional groups include hydroxyl, carboxyl, amino, aldehyde, epoxy or methoxy groups.

[0041] Furthermore, the terminal functional group includes a hydroxyl group, a carboxyl group, an amino group or an epoxy group.

[0042] The functionalization extension includes the amplification of terminal functional groups.

[0043] Preferably, the amplification of the terminal functional groups includes branching of the functional groups.

[0044] Furthermore, the branching treatment includes connecting a polymer having a hyperbranched end functional group to the functionalized surface or connecting a bioactive molecule analog having a branched functional group to the functionalized surface.

[0045] Optionally, the amplified functionalized surface is condensation coupled to a cleavable linker.

[0046] One end of the cleavable linker is condensed with the branched functional group, and the other end is condensed and connected with the biologically active molecule monomer according to a predetermined sequence.

[0047] 1.1 Surface functionalization modification

[0048] The functional modification methods include commonly used methods in the art, such as acid or alkali treatment of the material surface or plasma treatment of the material surface to obtain a surface with terminal hydroxyl groups and further coupling a coupling agent containing terminal functional groups on the surface to obtain a surface containing terminal hydroxyl groups and terminal amino groups.

[0049] Taking surface hydroxylation as an example, the functional modification method is described in detail, which includes the following steps: a. surface acid treatment; b. coupling with a hydroxylation reagent.

[0050] Specifically, the surface acid treatment includes immersing the material surface in piranha solution for 60 minutes to 120 minutes; the coupling hydroxylation reagent includes coupling a silane coupling agent having a terminal functional group to the surface of the acid-treated material; the silane coupling agent includes a silane coupling agent containing a methoxy group or a terminal hydroxyl group commonly used in the art, such as N-(3-triethoxysilylpropyl)-4-hydroxybutyramide, 3-glycidoxypropyltrimethoxysilane (GOPTS), propyltrimethoxysilane (GPTMS), etc.

[0051] When N-(3-triethoxysilylpropyl)-4-hydroxybutyramide is used as the silane coupling agent, the coupling hydroxylation reagent includes depositing a vaporized silane coupling agent solution on the acid-treated surface; the coupling agent solution can be a weakly acidic 95% ethanol solution of N-(3-triethoxysilylpropyl)-4-hydroxybutyramide; the concentration of the coupling agent solution is not less than 2%, and the deposition time is not less than 60 minutes.

[0052] When GOPTS is used as a silane coupling agent, the coupling hydroxylation agent comprises immersing the acid-treated surface in a coupling agent solution, boiling and refluxing overnight, then washing with toluene, a toluene-methanol mixed solution, and methanol in sequence, baking and drying to obtain a surface with an epoxy group; the coupling agent solution comprises a 1% GOPTS toluene solution; the obtained epoxy-based silicon wafer is immersed in a phosphoric acid aqueous solution to complete the ring-opening treatment to obtain a surface with terminal hydroxyl groups; the immersion time is not less than 10 hours, and the concentration of the phosphoric acid solution is not less than 2%.

[0053] Taking surface amination as an example, the amination method is described in detail, which includes the following steps: a. surface acid treatment b. coupling with a silane reagent.

[0054] Specifically, the surface acid treatment includes immersing the material surface in piranha solution for 60 minutes to 120 minutes; the coupling silane reagent includes immersing the acid-treated material surface in a silane coupling agent solution at room temperature; the silane coupling agent includes a methoxy- or terminal hydroxyl-containing silane coupling agent commonly used in the art, such as 3-aminopropyltrimethoxysilane (APTES).

[0055] APTES is used as a silane coupling agent for treatment. The coupling agent solution includes a weakly acidic 95% ethanol solution and a coupling agent. The coupling agent solution includes a coupling agent solution with a concentration of 2% to 4% by volume. The coupling temperature is between 20° C. and 25° C., and the immersion time is 60 min to 70 min.

[0056] 1.2 Functional group branching extension

[0057] The functional group branching extension includes branching the surface containing terminal functional groups modified by the above-mentioned hydroxylation, amination or epoxy modification methods. Preferably, the branching treatment includes connecting a polymer with hyperbranched terminal functional groups and / or connecting a highly branched bioactive molecule analog to the functionalized surface.

[0058] Taking the branching treatment of the amino surface as an example, the branch extension includes the following steps: a. modifying the terminal amino group; b. connecting the branched polymer.

[0059] The amino terminal modification includes chlorination modification. Specifically, the substrate carrying the amino terminal is immersed in an organic solution of cyanuric chloride and incubated for 40 min to 80 min at a temperature between -4°C and 0°C.

[0060] The branched polymer includes organic polymers containing primary and secondary amino groups, such as polylysine, polyethyleneimine of different molecular weights, and the like.

[0061] Taking polyethyleneimine as an example, the method for connecting branched polymers includes immersing a substrate carrying modified terminal amino groups in a polyethyleneimine ethanol solution and incubating the substrate, wherein the polyethyleneimine ethanol storage solution accounts for more than 10% of the solution by volume; the incubation time is not less than 24 hours; and the incubation temperature is 60°C~65°C.

[0062] Taking the branching treatment of the hydroxylated surface as an example, the extension includes connecting a branched bioactive substance analog on the surface, and the bioactive substance analog includes a phosphoramidite with multiple DMT groups, specifically including the following steps: a. activating the branching reagent b. connecting and extending c. deprotecting the hydroxyl group.

[0063] Taking tris-2,2,2-[3-(4,4'-dimethoxytrityloxy)propoxymethyl]ethyl-[(2-cyanoethyl)-(N,N-diisopropyl)]phosphoramidite as a branching reagent as an example, the activation of the branching reagent includes adding a dicyanoimidazole solution to an acetonitrile solution of the branching reagent for activation to obtain a branching reaction solution; immersing the hydroxylated surface in the branching reaction solution and incubating for 15 min to 20 min, washing and drying after the incubation is completed to complete the expansion; then removing the surface DMT with trichloroacetic acid, and washing to obtain a hydroxyl branched surface.

[0064] Furthermore, the hydroxyl branched surface includes further extension of the branched surface.

[0065] The further expansion of the hydroxyl branched surface includes reconnecting multiple DMT phosphoramidites to the branched hydroxyl surface.

[0066] Taking hydroxylation surface branching treatment as an example, the branching extension also includes connecting a branched polymer on the surface, and the branched polymer includes a polymer with branched end functional groups, specifically including the following steps: a. preparing a branched polymer incubation solution b. incubating and extending.

[0067] The polymer with terminal functional groups includes organic polymers containing primary and secondary amino groups, such as polylysine, aminodextran or polyethyleneimine of different molecular weights.

[0068] Taking polyethyleneimine as an example, the method for connecting branched polymers includes immersing the hydroxyl-modified substrate in a polyethyleneimine ethanol solution for catalytic incubation, wherein the concentration of the polyethyleneimine ethanol solution is not less than 10% by volume; the incubation time is not less than 24 hours; and the incubation temperature is 60°C~65°C.

[0069] 1.3 Condensation coupling

[0070] The condensation coupling involves further attaching a cleavable linker reagent to the branched functionalized surface, which can be coupled to a bioactive molecule. The linker reagent can condense with the functional groups on the branched surface to form a cleavable group, and can also couple with the bioactive molecule monomer to synthesize a target sequence.

[0071] Taking the condensation coupling of branched amino surface as an example, the specific implementation method is as follows: a. preparing coupling solution b. coupling incubation c. washing.

[0072] The coupling solution includes a mixed solution of a linker reagent, a catalyst, and an activator. The linker reagent includes a cleavable phosphoramidite monomer linker commonly used in the art, with 5'-dimethoxytriphenylmethyl-thymidine-succinate as the linker reagent. The coupling solution includes a DMSO solution of 5'-dimethoxytriphenylmethyl-thymidine-succinate, triethylamine, EDC, and DMAP, with a linker reagent molar concentration between 0.01‰ and 0.015‰. The coupling incubation time is no less than 3 hours.

[0073] 2. On the other hand, the present application provides a functionalized surface of a solid phase synthesis support.

[0074] The functionalized surface includes an orderly separated surface with biologically active functions.

[0075] The ordered compartmentalization includes constructing non-functionalized repeating units on a surface having biologically active functions.

[0076] The non-functionalized repeating unit comprises a surface having hydrophobic properties.

[0077] Specifically, the orderly separation of the functionalized surface includes the following steps: a first step, surface patterning; and a second step, modifying different areas of the pattern.

[0078] The present invention does not specifically limit the patterning method. As an example, the patterning process is performed using UV lithography. The specific implementation method is as follows: a. Spreading the film; b. Exposure; c. Development; the surface is heated and dried for 5 minutes before exposure and for 60 seconds after exposure.

[0079] The different regions of the pattern include a bioactive functional surface and a hydrophobic functional area.

[0080] The bioactive functional surface includes a surface modified by the surface functionalization method.

[0081] This application does not specifically limit the method for modifying the hydrophobic surface. As an example, a hydrophobic coating vapor phase chemical deposition method is used. The hydrophobic coating is a conventional hydrophobic coating in the art, such as fluorinated siloxanes, chlorosilanes, or silanes containing long-chain alkanes. The specific implementation method is as follows: a. Clean the patterned surface; b. Deposit the hydrophobic layer; c. Inflate and open the cover.

[0082] The patterned surface includes a surface obtained by the above-mentioned patterning method, and the cleaning adopts a light oxygen plasma dry cleaning method; after the cleaning is completed, it is discharged into the cleaning waste gas, the vaporized hydrophobic reagent is deposited, and the waste gas is discharged again after standing, and the deposition is completed by the cycle for more than 20 times.

[0083] 3. The third aspect of the present application provides a method for integrating the surface functionalization method to obtain a functionalized surface and / or a solid phase synthesis carrier of the functionalized surface.

[0084] The solid phase synthesis support material includes common supports in the art such as silicon wafers, quartz glass wafers, PDMA, etc.

[0085] The functionalized surface includes the functionalized surface obtained by the functionalization method and / or the functionalized surface orderly separated by non-functional surfaces.

[0086] 4. A fourth aspect of this application discloses a process for using the functionalized surface prepared by the method for in situ synthesis of bioactive molecules. Taking the in situ synthesis of oligonucleotide sequences as an example, the specific application method of the functionalized surface is as follows: the surface is placed in the reaction chamber of a synthesizer, and the following steps are repeated: treatment of the functionalized surface with a deprotecting agent—ligation of bioactive molecule monomers—delivery of a capping reagent—delivery of an oxidant to the synthesis chip surface—and cleaning.

[0087] The embodiments of the present application are further described with reference to the examples. The main reagents involved in the examples are shown in Table 1.

[0088] Table 1 List of reagents used in the examples

[0089] Drug name Purity / Model Manufacturer / seller N-(3-Triethoxysilylpropyl)-4-hydroxybutyramide 99.00% Shanghai Myril Biochemical Technology Co., Ltd. APTES 99% Sigma-Aldrich (Shanghai) Trading Co., Ltd. Cyanuric chloride 99% Sigma-Aldrich (Shanghai) Trading Co., Ltd. Polyethyleneimine m.w1800 / 99% Shanghai Myril Biochemical Technology Co., Ltd. 4,5-Dicyanoimidazole (DCI) 99.0% Sigma-Aldrich (Shanghai) Trading Co., Ltd. Trichloroacetic acid (TCA) 28~32g / L Sigma-Aldrich (Shanghai) Trading Co., Ltd. Tris-2,2,2-[3-(4,4'-dimethoxytrityloxy)propoxymethyl]ethyl-[(2-cyanoethyl)-(N,N-diisopropyl)]phosphoramidite 0.25g Glen Research 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) 98% Shanghai Aladdin Biochemical Technology Co., Ltd. 5'-O-(4,4'-dimethoxytrityl)-thymidine-3'-O-succinate (dT) >95% Shanghai Aladdin Biochemical Technology Co., Ltd. N,N-dimethyl-4-pyridinamine (DMAP) >98% Sigma-Aldrich (Shanghai) Trading Co., Ltd.

[0090] Example 1 Surface functionalization

[0091] 1. Patterning

[0092] A 4-inch silicon wafer was placed in a plasma cleaner for 30 seconds. The cleaned wafer was then spin-coated with photoresist at 4 krpm / min for 30 seconds on a spin coater. After spin coating, the wafer was dried on a hot plate at 65°C for 5 minutes. The dried wafer, covered with a mask, was exposed to UV light for 45 seconds and post-baked at 85°C for 60 seconds. The post-baked sample was cooled to room temperature and subsequently immersed in developer and deionized water for development. The patterned solid support substrate was then cut.

[0093] 2. Non-functional modification

[0094] The resulting patterned substrate was plasma cleaned again for 30 seconds. After cleaning, it was placed in a vapor deposition chamber, filled with vaporized octadecyltrichlorosilane, and deposited for 15 seconds, followed by a 20-second pause to complete the deposition process and exhaust the exhaust gas. After 20 cycles of deposition, the substrate was removed and allowed to stand in a vacuum chamber for 12 hours at room temperature. The remaining photoresist was then ultrasonically cleaned in acetone to remove the remaining photoresist, resulting in a substrate with a hydrophobic pattern.

[0095] 3. Hydroxyl functionalization

[0096] The substrate with a hydrophobic pattern prepared by the above method was immersed in 100 ml of 50°C piranha solution (concentrated sulfuric acid and hydrogen peroxide volume ratio of 1:1) for surface acid treatment, incubated for 2 hours, removed, rinsed with room temperature pure water, and then immersed in pure water for storage.

[0097] Adjust the pH of a 95% ethanol solution to 4.7, and prepare a 2% (volume) solution of N-(3-triethoxysilylpropyl)-4-hydroxybutyramide. This solution was vaporized in a vapor deposition oven and deposited onto the acid-treated chip surface at 70°C for 60 minutes. After deposition and incubation, the substrate was rinsed with ethanol, the waste liquid was blown off, and the substrate was dried to obtain a hydroxylated surface.

[0098] Example 2 Surface functionalization

[0099] 1. Patterning

[0100] A silicon wafer was placed in a plasma cleaner for 30 seconds. The cleaned wafer was then placed on a spin coater for spin coating with photoresist. After spin coating, the wafer was dried on a hot plate at 65°C for 5 minutes. The dried wafer, covered with a mask, was exposed to UV light for 45 seconds and post-baked for 60 seconds at 85°C. The post-baked sample was cooled to room temperature, developed in developer and then in deionized water, and then cut to obtain a patterned substrate.

[0101] 2. Non-functional modification

[0102] The resulting patterned substrate was plasma cleaned again for 30 seconds. After cleaning, it was placed in a vapor deposition chamber, filled with vaporized octadecyltrichlorosilane, and deposited for 15 seconds, followed by a 20-second pause to complete the deposition process and exhaust the exhaust gas. After 20 cycles of deposition, the substrate was removed and allowed to stand in a vacuum chamber for 12 hours at room temperature. The remaining photoresist was then ultrasonically cleaned in acetone to remove the remaining photoresist, resulting in a substrate with a hydrophobic pattern.

[0103] 3. Amino functionalization modification

[0104] The substrate with a hydrophobic pattern prepared by the above method was immersed in 100 ml of 50°C piranha solution (concentrated sulfuric acid and hydrogen peroxide volume ratio of 1:1) for surface acid treatment, incubated for 2 hours, removed, rinsed with room temperature pure water, and then immersed in pure water for storage.

[0105] The pH value of the 95% ethanol solution was adjusted to 4.7, and a 2% volume concentration APTES solution was prepared. The acid-treated surface was immersed in the solution and incubated at 25°C for 60 min. After incubation, it was rinsed with ethanol, the waste liquid was blown away, and the substrate was dried to obtain a substrate with an amino surface.

[0106] Example 3 Surface Functional Extension

[0107] A 3 g / ml cyanuric chloride tetrahydrofuran solution was prepared and incubated at 0° C. for 60 min on the substrate having an amino surface obtained by the method of Example 2. After the incubation, the substrate was washed and dried.

[0108] The substrate with an amino-functional surface obtained by the method of Example 2 was placed in a 1% polyethyleneimine ethanol solution, heated to 65°C, and incubated with ultrasound for 24 hours. After the incubation, it was washed with ethanol and pure water, and dried with nitrogen to obtain a substrate with a branched amino surface.

[0109] Example 4 Surface Functional Extension

[0110] A 10 g / ml tris-2,2,2-[3-(4,4'-dimethoxytrityloxy)propoxymethyl]ethyl-[(2-cyanoethyl)-(N,N-diisopropyl)]phosphoramidite solution in acetonitrile was prepared and mixed with a 4,5-dicyanoimidazole (DCI) solution in acetonitrile at a volume ratio of 1:1.

[0111] The chip with a hydroxylated surface obtained by the method of Example 1 was immersed in the above-mentioned mixed solution and incubated for 20 minutes. After the incubation was completed, it was washed and dried to obtain a chip with a branched hydroxyl surface.

[0112] Example 5 Surface Functional Extension

[0113] A TCA solution was prepared to remove the DMT groups on the branched hydroxyl surface obtained in Example 4, and tris-2,2,2-[3-(4,4'-dimethoxytrityloxy)propoxymethyl]ethyl-[(2-cyanoethyl)-(N,N-diisopropyl)]phosphoramidite was coupled again using the same method as in Example 4 to obtain a hydroxylated chip that had been expanded twice.

[0114] Example 6 Condensation Coupling

[0115] A mixed DMSO solution of EDC, 5'-dimethoxytriphenylmethyl-thymidine-succinic acid, and DMAP was prepared in a ratio of 30:3:2 as a coupling solution. The substrate with the branched surface obtained by the method in Example 2 was immersed in the coupling solution and incubated for 120 min. The substrate was then rinsed with DMSO, methanol, and pure water, and dried to obtain a chip with a branched amino surface.

[0116] Example 7 Condensation Coupling

[0117] A mixed DMSO solution of EDC, 5'-dimethoxytriphenylmethyl-thymidine-succinic acid, and DMAP was prepared in a ratio of 30:3:2 as a coupling solution. The substrate with the functionalized surface obtained by the method in Example 3 was immersed in the coupling solution for 120 min, rinsed with DMSO, methanol, and pure water, and dried to obtain a chip with a branched amino surface.

[0118] Application Example 1 In situ synthesis of oligonucleotide sequences

[0119] The chip obtained in Example 4 was placed on the chip carrier in the reaction chamber of the synthesizer, and the target oligonucleotide chain was synthesized using the obtained chip according to the following steps.

[0120] Step 1: Use high-purity argon as the protective gas to fill the reaction chamber until the water and oxygen contents reach 0.1 ppm respectively.

[0121] Step 2: Treat the synthesis unit on the chip surface with dichloroacetic acid to perform a deprotection reaction, and then empty it after a period of time.

[0122] Step 3: Introduce acetonitrile to rinse the chip surface and then drain it.

[0123] Step 4: Fill the reaction chamber with argon gas again to exhaust the acetonitrile, and deliver the phosphoramidite monomer solution to each reaction unit on the surface of the synthesis chip through the inkjet print head, and then deliver dicyanoimidazole to each reaction unit for activation.

[0124] Step 5: Clean the chip surface with acetonitrile.

[0125] Step 6: Refill the reaction chamber with argon until the acetonitrile is emptied, and deliver a mixed reagent of CapA and CapB in a volume ratio of 1:1 to the surface of the synthesis chip. After a period of reaction, empty the reagent.

[0126] Step 7: Use acetonitrile to clean the excess CapA and CapB reagents on the chip surface.

[0127] Step 8: After evacuating the acetonitrile with argon, iodine solution is delivered to the surface of the synthesis chip for oxidation and evacuated after a period of reaction.

[0128] Step 9: After cleaning the oxidant with acetonitrile, evacuate with argon.

[0129] The second to ninth steps are cycled, and phosphoramidite monomers are grafted onto each synthetic unit in sequence according to the target sequence (see Table 2) to complete the synthesis of the oligonucleotide chain.

[0130] Application Example 2 In situ synthesis of oligonucleotide sequences

[0131] The substrate with a branched surface obtained in Example 5 was placed on the chip carrier in the reaction chamber of the synthesizer, and the same oligonucleotide sequence was synthesized according to the steps described in Application Example 1.

[0132] Application Example 3 In situ synthesis of oligonucleotide sequences

[0133] The substrate with a branched surface obtained in Example 7 was placed on the chip carrier in the reaction chamber of the synthesizer, and the target oligonucleotide sequence was synthesized according to the steps described in Application Example 1.

[0134] Comparative Example 1 In situ synthesis of oligonucleotide sequences

[0135] The substrate with a hydroxylated surface obtained in Example 1 was placed on the chip carrier in the reaction chamber of the synthesizer, and the target oligonucleoside chain was synthesized according to the steps described in Application Example 1.

[0136] Comparative Example 2 In situ synthesis of oligonucleotide sequences

[0137] The substrate with an amino surface obtained in Example 6 was placed on the chip carrier in the reaction chamber of the synthesizer, and the target oligonucleoside chain was synthesized according to the steps described in Application Example 1.

[0138] The synthesized chip was placed in a gas phase ammoniolysis apparatus and ammonia (4-5 bar, 85 ° C) was introduced for cleavage and deprotection for 2 hours to obtain free oligonucleotides. After qPCR reaction was performed using Sybr Green fluorescent dye method, the amount of synthesized oligonucleotides in each example and comparative example was determined using the standard curve method. The test results are shown in the attached Figure 2 .

[0139] The functionalized surfaces obtained in Example 1 and Example 6 were not expanded and were applied to Comparative Example 1 and Comparative Example 2. The synthesis amount was as follows: Figure 2The values ​​of points 201 and 202 are 724 pM and 957 pM, respectively. The functionalized surfaces obtained in Example 4 and Example 7 were expanded once and applied to the corresponding Example 1 and Example 3. The synthesis amount is as follows: Figure 2 The values ​​of points 203 and 204 are 1424 pM and 2084 pM, respectively. The functionalized surface obtained in Example 5 was expanded twice and applied to Application Example 2. The synthesis amount is as follows: Figure 2 The point value shown as 205 is calculated to be 3038 pM.

[0140] All application examples were consistent with the synthesis process of the comparative example, with the same synthetic target sequence, amplification process and elution amount. The surfaces used in Application Examples 1, 2, and 3 were expanded, and the amount of synthesized oligonucleotides was greater than that of Application Examples 1 and 2, which were synthesized on surfaces without expansion. In addition, the surface used in Application Example 2 was functionalized and expanded twice, and the amount of synthesized oligonucleotides was more than twice that of Application Example 1.

[0141] In summary, the present invention provides a method for preparing a functionalized surface. The synthesis flux of bioactive molecules in a synthetic chip integrating the surface obtained by this method is significantly improved, which is conducive to promoting the scale and industrialization of bioactive molecule synthesis.

[0142] Table 2 Sequence Listing

[0143] Target sequence 5'-ACGTGCCGAACTTAGATTAGCAAGGCACCCACTTGTAAAACGCGCTGGTATCGAGAACGGTATGCTGTAACCCCGCGGGAACTACACTCGGGCCTTTTATTGGGT*TTTTTTTTTT-3' Quantitative amplification primer sequences F-ACGTGCCGAACTTAG R-ACCCAATAAAAGGCC

[0144] Wherein, *T is the cleavable phosphoramidite monomer thymidine-succinylcaxonamide-CED-phosphoramidite, and A, C, T, G are phosphoramidite monomers A, C, T, G.

Claims

1. A method for functionalizing the surface of a solid support, characterized in that: The method comprises the following steps: The first step is surface functional modification; the second step is functional expansion.

2. The surface functionalization method according to claim 1, wherein the surface functionalization modification comprises attaching terminal functional groups to the surface of the solid support, preferably, the terminal functional groups comprise one or more of hydroxyl, carboxyl, amino, aldehyde, epoxy or methoxy groups, preferably, the terminal functional groups comprise one or more of hydroxyl, carboxyl, amino or epoxy groups.

3. The method according to any one of claims 1 or 2, wherein the surface functionalization modification comprises connecting a coupling agent containing a terminal functional group to the surface of the material, preferably, the coupling agent containing a terminal functional group comprises a silane coupling agent containing a terminal hydroxyl group, a terminal amino group or an epoxy group.

4. The method according to any one of claims 1 to 3, wherein the functionalization extension comprises the amplification of the surface terminal functional groups, and preferably, the amplification of the surface terminal functional groups comprises branching treatment of the functional groups.

5. The method according to any one of claims 1 to 4, wherein the branching treatment of the functional group comprises connecting a polymer having a hyperbranched end functional group to the surface end functional group and / or connecting a bioactive molecule analog having a branched end functional group to the functionalized surface. Preferably, the polymer having a hyperbranched end functional group and / or the bioactive molecule analog having a branched end functional group comprises a polymer having a branched end amino group and / or a phosphoramidite monomer having a branched dimethoxytrityl (DMT) group.

6. The method according to any one of claims 1 to 5, characterized in that The method further includes attaching a cleavable conjugated linker to the extended functionalized surface.

7. The method according to any one of claims 1 to 6, wherein the cleavable coupling linker comprises a coupling group that can be connected to the branched surface and a group that can be coupled to a biologically active molecule monomer.

8. A surface of a solid phase synthesis support, characterized in that It includes a functional region capable of being grafted with a biologically active molecule.

9. The surface according to claim 8, characterized in that The functional region is prepared by the method according to any one of claims 1 to 7.

10. The surface according to any one of claims 8 or 9, wherein the functional areas are separated by patterning. 11 . The surface according to claim 8 , wherein the patterned separation comprises forming a patterned non-functional surface on the functionalized surface, and preferably, the non-functional surface is hydrophobic.

12. The method for preparing a surface according to any one of claims 8 to 11, comprising the steps of: In the first step, surface patterning is used to distinguish functional areas from non-functional areas; in the second step, the functional areas and non-functional areas are modified separately.

13. A solid phase synthesis support comprising the functionalized surface according to any one of claims 8 to 11.

14. The functionalized surface prepared by the method according to any one of claims 1 to 7 is used in the in situ synthesis of bioactive molecules.

15. The surface of the solid phase synthesis carrier according to any one of claims 8 to 11, used for the in situ synthesis of bioactive molecules.

16. The functionalized surface prepared by the method according to claim 11 is used in the in situ synthesis process of bioactive molecules.

17. The solid phase synthesis carrier according to claim 13, used for the in situ synthesis of biologically active molecules.

Images