Characteristic sequence, marker primer and identification method of fig variety Blan Rake
By developing characteristic sequences and molecular-specific marker primer combinations for the fig variety Braunschweig, and using SLAF-seq technology and PCR amplification electrophoresis detection, the problems of rapid and accurate identification of fig varieties were solved, and stable and specific identification of the Braunschweig variety was achieved.
Patent Information
- Application Number
- CN202410257488.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-03-07
- Publication Date
- 2025-09-09
AI Technical Summary
Existing technologies make it difficult to achieve rapid and accurate molecular-level identification in fig variety identification, especially the identification difficulties caused by confusion in the naming of hybrid offspring between varieties.
Develop characteristic sequences and molecular-specific marker primer combinations for the fig variety Braunschweig, use SLAF-seq technology to develop molecular markers across the entire genome, design specific primer combinations, and achieve variety identification through PCR amplification and electrophoresis detection.
The rapid, stable and specific identification of the fig variety Braunschweig was achieved, the sample requirements were reduced, the detection was convenient and intuitive, and the identification reliability was improved.
Smart Images

Figure CN120608066A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to a characteristic sequence of a fig variety Braunschweig, a molecular specific marker primer combination, and a method for specifically identifying the fig variety Braunschweig by utilizing the molecular specific marker primer combination. Background Art
[0002] Fig Ficus carica Ficus genus, Moraceae Ficus A deciduous shrub or small tree native to the Mediterranean coast, it was first cultivated throughout Xinjiang, my country, and is now being introduced and cultivated in many locations throughout my country. It boasts high yields and rapid returns. Currently, over 20 varieties have performed well in this field, including 'Bojihong,' 'Blanrick,' and 'Masyi Taufin.' The fig fruit contains a variety of active ingredients, including polysaccharides, flavonoids, and psoralens, with benefits such as treating sore throats, fighting tumors, lowering blood sugar and lipids, and boosting immunity. Consequently, market demand for figs is increasing. While the fruit shape, size, color, and flavor of different fig cultivars vary significantly, the differences between individual plants are minimal. Furthermore, the naming of hybrids between some fig cultivars can be confusing, hindering cultivar identification, promotion, communication, and the development of new varieties. Therefore, efforts are underway to develop stable and specific DNA markers at the molecular level, a scientific approach to accurately and rapidly identifying fig varieties. Summary of the Invention
[0003] The purpose of the present invention is to provide a characteristic sequence of the fig variety Braunschweig, a molecular specific marker primer combination, and a method for specifically identifying the fig variety Braunschweig using the molecular specific marker primer combination; The technical solution adopted in the present invention is: The characteristic sequence group of the fig variety Braunschweig is as follows: 1) 4856_45: 5'-CCTTTGATCTCACCGAAGGATGGCCGCTTCCTATATTCTACTTCCGCTATCAAGCTCCGATAGCAACAAGAGACGAAAGAAGTAGTGAGGCTGGTATGAAGTGGATAACAGCATAGTTAGTTGGCTTNNN NNNNNNNCCTTGATGCCAGAACAAGAGGTCAGGCTGTTAATTCATATGAAAAAATGGGAACCAAACTTCAAATTTATATGGTTTGCGGACCAATCGGTCCAACCTCGATCGGGACTCAGCGGAGGACACGAAG -3' 2) 57284_45: 5'-CCCTCCTTCTAGCGCCAAAATATTGATGCCGAAAACGCTTCCGGCAGCAACACCCAATGTGGTCGGGTGGTCCGATCACGTCCGGCCAGTCGCTCCGCCGCAGTCACCTGCAAAACGAACGCACCTNNN NNNNNNNCCCCTATAAATAGGGGAAGAACCCACGAATCTAGGTAAGCTGACTTCTACCTTGCCAAAGCTCTGTCTCCTATCGCTCATCAGCTCTCGAACTGACTTAGGCATCGGAGTGCCCGCGACAGACA -3' Where NNNNNNNNNN is an unknown sequence within 300bp.
[0004] The present invention also relates to a molecular specific marker primer set for the fig variety Braunschweig, wherein the primer sequence is: 1) 4856_45 primer set: 4856_45LFTTGATGCCAGAACAAGAGGTC 4856_45RRGGTCCGCAAACCATATAAATTTG 4856_45SF TGGCGCTTCCTATATTCTACTTCCG 2) 57284_45 primer set: 57284_45LF ACGAATCTAGGTAAGCTGACTTC 57284_45RRGATGCCTAAGTCAGTTCGAGAG 57284_45SF GCCGAAAACGCTTCCGGT The two primer sets described above were derived from 23 accessions using SLAF-seq (Specific-Locus Amplified Fragment Sequencing) technology to develop molecular markers covering the entire genome. An average of 118,891 SLAF tags were developed per sample in this project, with an average sequencing depth of 10.12x. A total of 72.00 Mb reads were generated. Bioinformatics analysis identified 166,254 SLAF tags, including 6,575 polymorphic SLAF tags, for a total of 72,678 population SNPs. Based on these results, over 1,000 primer pairs were designed and screened and validated in 23 samples. DNA fragments specific to the fig variety Braunschweig were identified; no specific fragments were obtained for the selected primer combinations in other fig varieties. It should be noted that the molecular marker primer combinations described in this invention are limited to fig variety identification, meaning that the samples tested are limited to figs.
[0005] The results of a random sampling of 5 plants of this variety showed that the characteristics of the Brunswick variety of figs are shown in the table: The present invention also relates to a method for rapidly identifying the fig variety Braunschweig using the molecular specific marker primer combination. The method comprises the following steps: extracting genomic DNA from leaves of the fig variety to be tested as a template, using the molecular specific marker primer set as amplification primers, and performing PCR amplification. The primers correspond to the binding sites on the characteristic sequences, such as Figure 1 , Figure 2 As shown: The key to the method of the present invention lies in the selection of amplification primer combinations, while DNA extraction, PCR reaction system and reaction conditions, and electrophoresis detection can all be performed according to conventional methods in the art. Compared with existing molecular marker methods for fig varieties, such as SSR marker methods, the method of the present invention has the following advantages: (1) Because the primers used have been sequenced and repeatedly verified, their reliability has been greatly improved; (2) The detection is convenient and intuitive. The presence or absence of band combinations can be directly determined by ordinary electrophoresis. However, if the SSR marker method is used, further analysis or sequencing by high-resolution electrophoresis is required after amplification. (3) The sample requirements are relatively low, and DNA samples from tissues such as leaves can meet the needs of variety identification; Preferably, the PCR amplification system of the present invention is composed as follows: The final concentration of PCR Buffer is 1× dNTPs 1 mmol / L MgCl2 2.5 mmol / L Taq enzyme 1.0 U / reaction 0.2 μM each of upstream and downstream primers Template DNA 60 ng / reaction The balance is ddH2O; The PCR amplification conditions were as follows: pre-denaturation at 94°C for 300 s, denaturation at 95°C for 10 s, annealing at 56°C for 50 s, extension at 72°C for 40 s, for a total of 30 cycles, and a final fill-in at 72°C for 300 s; the termination temperature was 4°C; The final concentration of PCR Buffer is 1×, which means that the concentrations of the components in the reaction system are the same as those of 1× PCR Buffer. 10× PCR Buffer is usually used, with a volume of 1 / 10 of the reaction system volume. 10× PCR Buffer consists of: 100 mM Tris-HCl (pH 8.5), 500 mM KCl, 25 mM MgCl2, and 1.0% Triton-X-100, with ddH2O as the solvent. Specifically, the method is as follows: (1) Take the fig leaves to be tested, grind them with liquid nitrogen, and extract the genomic DNA of the fig leaves to be tested using the CTAB method; (2) Using the genomic DNA extracted in step (1) as a template and the molecular specific labeled primers as amplification primers, PCR amplification is performed: The PCR reaction system per 15 μL is composed as follows: 2×TsingKE master mix 7.5μL 0.2 μL each of 10 μM upstream and downstream primers 2 μL 20 ng / μL template DNA dd H2O 5.1μLl; PCR reaction conditions are as follows: After pre-denaturation at 94°C for 300 s, the reaction was cycled for 30 cycles: denaturation at 95°C for 10 s, annealing at 56°C for 50 s, and extension at 72°C for 40 s. The final cycle was completed at 72°C for 300 s. The termination temperature was 4°C. (3) Take 3 μL of the amplified product from step (2), mix it with 1 μL of 0.25% bromophenol blue buffer, spot it on a 1.5% agarose gel, and electrophorese it in 1×TAE buffer at 5 V / cm. After the electrophoresis, stain it with EB and photograph it on an automatic gel image analyzer. If the electrophoresis results show that the DNA sample can be PCR-amplified into two bands in the 4856_45 primer set and one band in the 57284_45 primer set, then the fig variety to be tested that the DNA sample comes from is Braunschweig; if it does not have this characteristic, then it is not. BRIEF DESCRIPTION OF THE DRAWINGS
[0006] Figure 1 Schematic diagram of the relative positions of the primers in the 4856_45 primer set within the fig DNA signature sequence fragment 45261_48; Figure 2 Schematic diagram of the relative positions of the primers in the 57284_45 primer set within the fig DNA signature sequence fragment 117112_45; Figure 3 PCR amplification results of 23 fig varieties using the 4856_45 primer set (numbers 1-23 represent fig varieties: 1, 2, Grace; 3, Brunswick; 4, Zaohuang; 5, Masyi-Taufin; 6, Strawberry; 7, B1011; 8, Huishankou; 9, Jinaofen; 10, Qinghua; 11, Hongyan; 12, Papa John's; 13, BNR; 14, Hardy; 15, BBR; 16, Baishan; 17, Sala; 18, Jiashan; 19, Lukang 1; 20, Dela; 21, Baiya; 22, California Black; 23, Baraunay). M represents the Takara DL2000 marker. Two specific DNA bands were amplified from the fig variety numbered 3, Brunswick, using the 4856_45 primer set. Figure 4 PCR amplification results of 23 fig varieties using the 57284_45 primer set (variety numbers 1-23 represent: 1, 2, Grace; 3, Brunswick; 4, Zaohuang; 5, Masyi-Taufin; 6, Strawberry; 7, B1011; 8, Huishankou; 9, Jinaofen; 10, Qinghua; 11, Hongyan; 12, Papa John's; 13, BNR; 14, Hardy; 15, BBR; 16, Baishan; 17, Sala; 18, Jiashan; 19, Lukang 1; 20, Dela; 21, Baiya; 22, California Black; 23, Baraunay). M represents the Takara DL2000 marker. A specific DNA band was amplified from the fig variety Brunswick, numbered 3, using the 57284_45 primer set. DETAILED DESCRIPTION
[0007] The present invention will be further described below with reference to specific embodiments, but the protection scope of the present invention is not limited thereto. Example
[0008] (1) Extraction of genomic DNA from fig varieties: 0.05 g of young leaves of the tested fig variety were taken and ground thoroughly with liquid nitrogen. Genomic DNA from the leaves was extracted using the CTAB method. After multiple extractions, a genomic DNA extract of the fig variety was obtained. The DNA extract was then subjected to 1.5% agarose gel electrophoresis to test integrity, purity, and concentration. Band brightness was determined for subsequent PCR amplification. The DNA extract was stored at -20°C until use. (2) Design specific PCR amplification primers. The sequences of the primer pairs are: 1) 4856_45 primer set: 4856_45LFTTGATGCCAGAACAAGAGGTC 4856_45RRGGTCCGCAAACCATATAAATTTG 4856_45SF TGGCGCTTCCTATATTCTACTTCCG 2) 57284_45 primer set: 57284_45LF ACGAATCTAGGTAAGCTGACTTC 57284_45RRGATGCCTAAGTCAGTTCGAGAG 57284_45SF GCCGAAAACGCTTCCGGT Synthesized by Shanghai Bioengineering Technology Co., Ltd.; (3) PCR amplification: PCR reaction solution composition (15 μL): 2×TsingKE master mix (TsingKE Biotechnology, Beijing) 7.5μL 0.2 μL each of 10 μM upstream and downstream primers 2 μL 20 ng / μL template DNA dd H2O 5.1 μL; The amplification reaction was performed on a TC-XP thermal amplification instrument. The amplification conditions were as follows: 94°C pre-denaturation for 300 s, 95°C denaturation for 10 s, 56°C annealing for 50 s, and 72°C extension for 40 s, for a total of 30 cycles, followed by a final fill-in at 72°C for 300 s. The termination temperature was 4°C. (4) Electrophoresis detection: Take 3 μL of the PCR amplification product from step (3), mix it with 1 μL of 0.25% bromophenol blue buffer, apply it to a 1.5% agarose gel, and electrophorese it in 1×TAE buffer at 5 V / cm. After the electrophoresis is completed, stain it in an aqueous solution containing 0.5 μg / ml EB for 30 minutes, and then stain it on a Bio-rad Gel imaging system Gel Doc took photos; According to the above method, 23 fig varieties (numbered 1-23, representing fig varieties, are as follows: 1, Brooke Red; 2, Grace; 3, Brunswick; 4, Early Yellow; 5, Masyi Dauphin; 6, Strawberry; 7, B1011; 8, Huishankou; 9, Jinaofen; 10, Qinghua; 11, Hongyan; 12, Papa John's; 13, BNR; 14, Hardy; 15, BBR; 16, Baishan; 17, Sala; 18, Rockery; 19, Green Anti-1; 20, Dela; 21, Baiya; 22, California Black; 23, Balaonai) were detected by electrophoresis. The marker used was Takara DL2000. The results of electrophoresis are shown in the table. Figure 3 , Figure 4 .
[0009] Only fig variety Braunschweig (number 3) amplified two specific DNA bands with primer set 4856_45, and one specific DNA band with primer set 57284_45; the number of bands for the remaining numbered fig varieties varied. This demonstrates that the molecularly specific marker primer pairs developed by this invention are highly stable and specific for early identification of the fig variety Braunschweig.
Claims
1. The characteristic sequence of the fig variety Braunschweig, which is composed of two coexisting specific DNA fragments, has the following sequence: 1)4856_45: 5'-CCTTTGATCTCACCGAAGGATGGCCGCTTCCTATATTCTACTTCCACTATCAAGCTCCGATAGCAACAAGAGACGAAAGAAGTAGTGAGGCTGGTATGAAGTGGATAACAGCATAGTTAGTTGGCTTNNN NNNNNNNCCTTGATGCCAGAACAAGAGGTCAGGCTGTTAATTCATATGAAAAAATGGGAACCAAACTTCAAATTTATATGGTTTGCGGACCAATCGGTCCAACCTCGATCGGGACTCAGCGGAGGACACGAAG -3', 2)57284_45: 5'-CCCTCCTTCTAGCGCCAAAATATTGATGCCGAAAACGCTTCCGGCAGCAACACCCAATGTGGTCGGGTGGTCCGATCACGTCCGGCCAGTCGCTCCGCCGCAGTCACCTGCAAAACGAACGCACCTNNN NNNNNNNCCCCTATAAATAGGGGAAGAACCCACGAATCTAGGTAAGCTGACTTCTACCTTGCCAAAGCTCTGTCTCCTATCGCTCATCAGCTCTCGAACTGACTTAGGCATCGGAGTGCCCGCGACAGACA -3', Where NNNNNNNNNN is an unknown sequence within 300bp.
2. A primer set for detecting the characteristic sequence of the fig variety Braunschweig according to claim 1, wherein the primer set comprises the following primer sequences: 1) 4856_45 primer set: 4856_45LF:TTGATGCCAGAACAAGAGGTC 4856_45RR:GGTCCGCAAACCATATAAATTTG 4856_45SF:TGGCCGTCCTATATTCTACTTCCG 2) 57284_45 primer set: 57284_45LF:ACGAATCTAGGTAAGCTGACTTC 57284_45RR:GATGCCTAAGTCAGTTCGAGAG 57284_45SF:GCCGAAACGCTTCCGGT.
3. A method for rapidly identifying the fig variety Braunschweig using the molecular-specific marker primer set of claim 2, comprising: extracting genomic DNA from leaves of the fig variety Braunschweig as a template, performing PCR amplification using the primers grouped with the characteristic sequences, and performing electrophoresis on the amplified products. If the electrophoresis results indicate that two specific DNA bands appear when the 4856_45 primer set is amplified, and one specific DNA band appears when the 57284_45 primer set is amplified, then the fig variety to be tested is Braunschweig; otherwise, the variety is not. The primer set comprises the following complete primer sequences: 1) 4856_45 primer set: 4856_45LF:TTGATGCCAGAACAAGAGGTC 4856_45RR:GGTCCGCAAACCATATAAATTTG 4856_45SF:TGGCCGTCCTATATTCTACTTCCG 2) 57284_45 primer set: 57284_45LF:ACGAATCTAGGTAAGCTGACTTC 57284_45RR:GATGCCTAAGTCAGTTCGAGAG 57284_45SF:GCCGAAACGCTTCCGGT.
4. The method according to claim 3, wherein The PCR amplification conditions were as follows: pre-denaturation at 94°C for 300 s; denaturation at 95°C for 30 s, annealing at 56°C for 60 s, and extension at 72°C for 50 s, for a total of 30 to 40 cycles; and a final fill-in at 72°C for 300 s, with a termination temperature of 4°C.
5. The method according to claim 3, wherein The method is as follows: 1) Grind the leaves of the figs to be tested in liquid nitrogen, and extract genomic DNA from the leaves using the CTAB method; 2) performing PCR amplification using the genomic DNA extracted in step 1) as a template and the primers in the molecular-specific marker primer set as amplification primers; 3) Take 3 μL of the amplified product from step 2) and mix it with 1 μL of 0.25% bromophenol blue buffer. Blot the sample onto a 1.5% agarose gel and electrophorese in 1×TAE buffer at 5 V / cm. After electrophoresis, stain with EB and photograph the gel using an automated gel image analyzer. If the electrophoresis results show the characteristic band described in claim 3, the fig variety being tested is Braunschweig; if the aforementioned characteristic band is absent, the fig variety is not.