Characteristic sequence, marker primer and identification method of fig variety gray mountain mouth

By designing the characteristic sequence and molecular specific marker primer combination of the fig variety Huishankou, and using SLAF-seq technology and PCR amplification electrophoresis detection, the problems of accuracy and speed in fig variety identification were solved, and the specific identification of Huishankou variety was achieved.

CN120608067APending Publication Date: 2025-09-09ZHEJIANG FORESTRY ACAD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410258865.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-03-07
Publication Date
2025-09-09

AI Technical Summary

Technical Problem

Existing technologies make it difficult to achieve rapid and accurate molecular-level identification in fig variety identification, especially the specific identification of the Huishankou variety, which is affected by the small differences between plants and the confusion in the naming of hybrid offspring.

Method used

The characteristic sequence and molecular-specific marker primer combination of the fig variety Huishankou were designed and verified. The SLAF-seq technology was used to develop genome-wide molecular markers, and the specific identification of the Huishankou variety was achieved through PCR amplification and electrophoresis detection.

Benefits of technology

The reliability of the identification method and the intuitiveness of the detection are improved, the gray mountain pass variety can be identified quickly and accurately, the requirements for samples are reduced, and the identification process is simplified.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120608067A_ABST
    Figure CN120608067A_ABST
Patent Text Reader

Abstract

The invention relates to a characteristic sequence of a fig variety gray mountain mouth, a molecular specific marker primer and a method capable of rapidly identifying the fig variety gray mountain mouth. The molecular specific marker primer has the following sequences: 1) a 16793104 primer group, namely 16793104 LF ATTTTTAGAACTTTCACCAGCCG16793104 RR GTTGCACCACCACCATAAAATGTCTGCCTTAAATACCCTAAATACCCTAAATACCCTAAAATTACCTAAATGCCTAGATTAG19115113RR, namely 19115113 LF AATAACAATCGTGTCTTGTTGTTGGGCACAT, and the molecular specific marker primer disclosed by the invention can be used for carrying out rapid early identification on the fig variety gray mountain mouth, and is simple in method, high in specificity, high in specificity, high in specificity, high in specificity, high in specificity
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention relates to a characteristic sequence of a fig variety Huishankou, a molecular specific marker primer combination, and a method for specifically identifying the fig variety Huishankou by utilizing the molecular specific marker primer combination. Background Art

[0002] Fig Ficus carica Ficus genus, Moraceae Ficus A deciduous shrub or small tree native to the Mediterranean coast, it was first cultivated throughout Xinjiang, my country, and is now being introduced and cultivated in many locations across my country. It boasts high yields and rapid returns. Currently, over 20 varieties have performed well in this field, including 'Bojihong,' 'Huishankou,' and 'Masyitaofen.' The fig fruit contains a variety of active ingredients, including polysaccharides, flavonoids, and psoralens, with benefits such as treating sore throats, fighting tumors, lowering blood sugar and lipids, and boosting immunity. Consequently, market demand for figs is increasing. While the fruit shape, size, color, and flavor of different fig cultivars vary significantly, the differences between individual plants are minimal. Furthermore, the naming of hybrids between some fig cultivars can be confusing, hindering cultivar identification, promotion, communication, and the development of new varieties. Therefore, efforts are underway to develop stable and specific DNA markers at the molecular level, a scientific approach to accurately and rapidly identifying fig varieties. Summary of the Invention

[0003] The purpose of the present invention is to provide a characteristic sequence of a fig variety Huishankou, a molecular specific marker primer combination, and a method for specifically identifying the fig variety Huishankou using the molecular specific marker primer combination; The technical solution adopted in the present invention is: The characteristic sequence group of the fig variety Huishankou is as follows: 1) 16793_104: 5'-CCGACCTTCAATTAGTGCCAAATCCCCGATTTGCCCTCATCTCCCACCCGCCTAAAAGTCACTATCCCTCGAATGCCCTAAATACCCTAAAAAAATTTCAAACTATCTTCTACAGTGTTTTAG AGANNNNNNNNNNACCGAATTTTTAGAACTTTCACCAGCCGATGACCTTTTGGATGACTTAGCCGTAACTCGGACTGACCTCTTCTCGGGACGAGTGTTTTTCTCAGACATTTTAGTGGGTGTCAACATGGGTAGTTTT -3' 2) 19115_113: 5'-CCAAAAAAGGTCCTTCTGATTAGGGGTCTTCCTCTATTTATAGAGGAAGGACCGTGGGTTTGAATCAGTAACCGATGATGAACGGTTTTCGCTTGTTGTCCTTTGGGGACACATGTCACGATGTGNNN NNNNNNNCCGAACCCAATTTACAATCCTAATTCATTTCGTCATGAATAACAATCGTTCGCATTCGAGCTTCGAATCAATCAGTTCAAACATGATTGGACATACATCGAATCTAATTTAAGCCACGAACGGTGC -3' where NNNNNNNNNN is an unknown sequence within 300bp.

[0004] The present invention also relates to a molecular specific marker primer set of the fig variety Huishankou, wherein the primer sequence is: 1) Primer set 16793_104: 16793_104LFATTTTTAGAACTTTCACCAGCCG 16793_104RRGTTGACACCCACTAAAATGTCTG 16793_104SF GCCCTAAATACCCTAAAAAAATTTCAAACT 2) Primer set 19115_113: 19115_113LF AATAACAATCGTTCGCATTCGAG 19115_113RR CACCGTTCGTGGCTTAAATTAG 19115_113SF GCTTGTTGTCCTTTGGGGACAT The two primer sets described above were derived from 23 accessions using SLAF-seq (Specific-Locus Amplified Fragment Sequencing) technology to develop molecular markers covering the entire genome. An average of 118,891 SLAF tags were developed per sample in this project, with an average sequencing depth of 10.12x. A total of 72.00 Mb reads were generated. Bioinformatics analysis identified 166,254 SLAF tags, including 6,575 polymorphic SLAF tags, for a total of 72,678 population SNPs. Based on these results, over 1,000 primer pairs were designed and screened and validated in 23 samples. DNA fragments specific to the fig variety Huishankou were identified; no specific fragments were obtained for the selected primer combinations in other fig varieties. It should be noted that the molecular marker primer combinations described in this invention are limited to fig variety identification, meaning that the samples tested are limited to figs.

[0005] The results of a random sampling of 5 plants of this variety showed that the characteristics of the Huishankou variety of figs are shown in the table: The present invention also relates to a method for rapidly identifying a fig variety Huishankou using the molecular specific marker primer combination, the method comprising: extracting genomic DNA from leaves of the fig variety to be tested as a template, using the molecular specific marker primer set as amplification primers, and performing PCR amplification, wherein the primers correspond to binding sites on characteristic sequences such as Figure 1 , Figure 2 shown.

[0006] The key to the method of the present invention lies in the selection of amplification primer combinations, while DNA extraction, PCR reaction system and reaction conditions, and electrophoresis detection can all be performed according to conventional methods in the art. Compared with existing molecular marker methods for fig varieties, such as SSR markers, the method of the present invention has the following advantages: (1) Because the primers used have been sequenced and repeatedly verified, their reliability has been greatly improved; (2) The detection is convenient and intuitive. The presence or absence of band combinations can be directly determined by ordinary electrophoresis. However, if the SSR marker method is used, further analysis or sequencing by high-resolution electrophoresis is required after amplification. (3) The sample requirements are relatively low, and DNA samples from tissues such as leaves can meet the needs of variety identification; Preferably, the PCR amplification system of the present invention is composed as follows: The final concentration of PCR Buffer is 1× dNTPs 1 mmol / L MgCl2 2.5 mmol / L Taq enzyme 1.0 U / reaction 0.2 μM each of upstream and downstream primers Template DNA 60 ng / reaction The balance is ddH2O; The PCR amplification conditions were as follows: pre-denaturation at 94°C for 300 s, denaturation at 95°C for 10 s, annealing at 56°C for 50 s, extension at 72°C for 40 s, for a total of 30 cycles, and a final fill-in at 72°C for 300 s; the termination temperature was 4°C; The final concentration of PCR Buffer is 1×, which means that the concentrations of the components in the reaction system are the same as those of 1× PCR Buffer. 10× PCR Buffer is usually used, with a volume of 1 / 10 of the reaction system volume. 10× PCR Buffer consists of: 100 mM Tris-HCl (pH 8.5), 500 mM KCl, 25 mM MgCl2, and 1.0% Triton-X-100, with ddH2O as the solvent. Specifically, the method is as follows: (1) Take the fig leaves to be tested, grind them with liquid nitrogen, and extract the genomic DNA of the fig leaves to be tested using the CTAB method; (2) Using the genomic DNA extracted in step (1) as a template and the molecular specific labeled primers as amplification primers, PCR amplification is performed: The PCR reaction system per 15 μL is composed as follows: 2×TsingKE master mix 7.5μL 0.2 μL each of 10 μM upstream and downstream primers 2 μL 20 ng / μL template DNA dd H2O 5.1 μL; PCR reaction conditions are as follows: After pre-denaturation at 94°C for 300 s, the reaction was cycled for 30 cycles: denaturation at 95°C for 10 s, annealing at 56°C for 50 s, and extension at 72°C for 40 s. The final cycle was completed at 72°C for 300 s. The termination temperature was 4°C. (3) Take 3 μL of the amplified product from step (2), mix it with 1 μL of 0.25% bromophenol blue buffer, apply the sample to a 1.5% agarose gel, and electrophorese in 1×TAE buffer at 5 V / cm. After the electrophoresis, stain with EB and photograph it on an automatic gel image analyzer. If a specific DNA band appears in the electrophoresis result, the fig variety to be tested is Huishankou; otherwise, it is not. BRIEF DESCRIPTION OF THE DRAWINGS

[0007] Figure 1 Schematic diagram of the relative positions of the primers in the 16793_104 primer set within the fig DNA signature sequence fragment 16793_104. Figure 2 Schematic diagram of the relative positions of the primers in the 19115_113 primer set within the fig DNA signature sequence fragment 19115_113. Figure 3 Electrophoresis results of PCR amplification of 23 fig varieties using primer set 16793_104 (varieties numbered 1-23 are: 1, Brooke Red; 2, Grace; 3, Brunswick; 4, Early Yellow; 5, Mas-Yi-Taufin; 6, Strawberry; 7, B1011; 8, Huishankou; 9, Jinaofen; 10, Qinghua; 11, Hongyan; 12, Papa John's; 13, BNR; 14, Hardy; 15, BBR; 16, Baishan; 17, Sala; 18, Jiashan; 19, Lukang 1; 20, Dela; 21, Baiya; 22, California Black; 23, Balaonai). Takara DL2000 marker was used. Two specific DNA bands were amplified from Huishankou, the fig variety numbered 8, using primer set 16793_104. Figure 4 Electrophoresis results of PCR amplification of 23 fig varieties using the 19115_113 primer set (variety numbers 1-23 represent: 1. Brooke Red; 2. Grace; 3. Brunswick; 4. Early Yellow; 5. Mas-Yitaufen; 6. Strawberry; 7. B1011; 8. Huishankou; 9. Jinaofen; 10. Qinghua; 11. Hongyan; 12. Papa John's; 13. BNR; 14. Hardy; 15. BBR; 16. Baishan; 17. Sala; 18. Rockery; 19. Green Anti-1; 20. Dela; 21. Baiya; 22. California Black; 23. Baraunay). The Takara DL2000 marker was used. Only one specific DNA band was amplified from Huishankou, the fig variety numbered 8, using the 19115_113 primer set. DETAILED DESCRIPTION

[0008] The present invention is further described below with reference to specific embodiments, but the protection scope of the present invention is not limited thereto: Example

[0009] (1) Extraction of genomic DNA from fig varieties: 0.05 g of young leaves of the tested fig varieties were collected and thoroughly ground with liquid nitrogen. Genomic DNA from the leaves was extracted using the CTAB method. After multiple extractions, the genomic DNA extract of the fig varieties was obtained. The DNA extract was then subjected to 1.5% agarose gel electrophoresis to test the integrity, purity, and concentration. The brightness of the bands was determined for subsequent PCR amplification. The DNA extract was stored in a refrigerator at -20°C until use. (2) Design specific PCR amplification primers. The sequences of the primer pairs are: 1) Primer set 16793_104: 16793_104LFATTTTTAGAACTTTCACCAGCCG 16793_104RRGTTGACACCCACTAAAATGTCTG 16793_104SF GCCCTAAATACCCTAAAAAAATTTCAAACT 2) Primer set 19115_113: 19115_113LF AATAACAATCGTTCGCATTCGAG 19115_113RR CACCGTTCGTGGCTTAAATTAG 19115_113SF GCTTGTTGTCCTTTGGGGACAT Synthesized by Shanghai Bioengineering Technology Co., Ltd.; (3) PCR amplification: PCR reaction solution composition (15 μL): 2×TsingKE master mix (Qingke Biotechnology, Beijing) 7.5μL 0.2 μL each of 10 μM upstream and downstream primers 2 μL 20 ng / μL template DNA dd H2O 5.1 μL; The amplification reaction was performed on a TC-XP thermal amplification instrument. The amplification conditions were as follows: 94°C pre-denaturation for 300 s, 95°C denaturation for 10 s, 56°C annealing for 50 s, and 72°C extension for 40 s, for a total of 30 cycles, followed by a final fill-in at 72°C for 300 s. The termination temperature was 4°C. (4) Electrophoresis detection: Take 3 μL of the PCR amplification product from step (3), mix it with 1 μL of 0.25% bromophenol blue buffer, apply it to a 1.5% agarose gel, and run electrophoresis in 1×TAE buffer at 5 V / cm. After the electrophoresis, stain it in an aqueous solution containing 0.5 μg / ml EB for 30 minutes, and then photograph it on the Bio-rad gel imaging system Gel Doc; According to the above method, 23 fig varieties (numbered 1-23, representing fig varieties, are as follows: 1, Brooke Red; 2, Grace; 3, Brunswick; 4, Early Yellow; 5, Masyi Dauphin; 6, Strawberry; 7, B1011; 8, Huishankou; 9, Jinaofen; 10, Qinghua; 11, Hongyan; 12, Papa John's; 13, BNR; 14, Hardy; 15, BBR; 16, Baishan; 17, Sala; 18, Rockery; 19, Green Anti-1; 20, Dela; 21, Baiya; 22, California Black; 23, Balaonai) were detected by electrophoresis. The marker used was Takara DL2000. The results of electrophoresis are shown in the table. Figure 3 , Figure 4 ; Electrophoresis results showed that only the fig variety Huishankou, numbered 8, showed two specific DNA bands amplified with primer set 16793_104, and only one specific DNA band amplified with primer set 19115_113. This demonstrates that the molecular-specific marker primer pair developed by the present invention is highly stable and specific for early identification of the fig variety Huishankou.

Claims

1. The characteristic sequence of the fig variety Huishankou, which is composed of two coexisting specific DNA fragments, has the following sequence: 1) 16793_104: 5'-CCGACCTTCAATTAGTGCCAAATCCCCGATTTGCCCTCATCTCCCACCCGCCTAAAAGTCACTATCCCTCGAATGCCCTAAATACCCTAAAAAAATTTCAAACCATCTTCTACAGTGTTTTAG AGANNNNNNNNNNACCGAATTTTTAGAACTTTCACCAGCCGATGACCTTTTGGATGACTTAGCCGTAACTCGGACTGACCTCTTCTCGGGACGAGTGTTTTTCTCAGACATTTTAGTGGGTGTCAACATGGGTAGTTTT -3' 2) 19115_113: 5'-CCAAAAAAGGTCCTTCTGATTAGGGGTCTTCCTCTATTTATAGAGGAAGGACCGTGGGTTTGAATCAGTAACCGATGATGAACGGTTTTCGCTTGTTGTCCTTTGGGGACACATGTCACGAT GTGNNNNNNNNNCCGAACCCAATTTACAATCCTAATTCATTTCGTCATGAATAACAATCGTTCGCATTCGAGCTTCGAATCAATCAGTTCAAACATGATTGGACATACATCGAATCTAATTTAAGCCACGAACGGTGC -3' Where NNNNNNNNNN is an unknown sequence within 300bp.

2. A primer set for detecting the characteristic sequence of the fig variety Huishankou according to claim 1, wherein the primer set is composed of the following primer sequences: 1) Primer set 16793_104: 16793_104LF:ATTTTTAGAACTTTCACCAGCCG 16793_104RR:GTTGACACCCACTAAAATGTCTG 16793_104SF:GCCCTAAATACCCTAAAAAAATTTCAAACT 2) Primer set 19115_113: 19115_113LF:AATAACAATCGTTCGCATTCGAG 19115_113RR:CACCGTTCGTGGCTTAAATTAG 19115_113SF:GCTTGTGTCCTTTGGGGACAT.

3. A method for rapidly identifying the fig variety Huishankou using the molecular specific marker primer set described in claim 2, the method comprising: extracting genomic DNA from leaves of the fig variety Huishankou to be tested as a template, performing PCR amplification using the characteristic sequence primers in groups, and performing electrophoresis detection on the amplified products. If the electrophoresis results show that the 16793_104 primer set amplifies two specific DNA bands and the 19115_113 primer set amplifies only one specific DNA band, then the fig variety to be tested is the fig variety Huishankou; otherwise, it is not. The primer sequences are as follows: 1) Primer set 16793_104: 16793_104LF:ATTTTTAGAACTTTCACCAGCCG 16793_104RR:GTTGACACCCACTAAAATGTCTG 16793_104SF:GCCCTAAATACCCTAAAAAAATTTCAAACT 2) Primer set 19115_113: 19115_113LF:AATAACAATCGTTCGCATTCGAG 19115_113RR:CACCGTTCGTGGCTTAAATTAG 19115_113SF:GCTTGTGTCCTTTGGGGACAT.

4. The method according to claim 3, wherein The PCR amplification conditions were as follows: pre-denaturation at 94°C for 300 s; denaturation at 95°C for 30 s, annealing at 56°C for 60 s, and extension at 72°C for 50 s, for a total of 30-40 cycles; and a final fill-in at 72°C for 300 s, with a termination temperature of 4°C.

5. The method according to claim 3, wherein The method is as follows: 1) Take the fig leaves to be tested, grind them in liquid nitrogen, and extract the genomic DNA from the fig leaves using the CTAB method; 2) performing PCR amplification using the genomic DNA extracted in step 1) as a template and the primers in the molecular-specific marker primer set as amplification primers; 3) Take 3 μL of the amplified product from step 2) and mix it with 1 μL of 0.25% bromophenol blue buffer. Blot the sample onto a 1.5% agarose gel and electrophorese in 1×TAE buffer at 5 V / cm. After electrophoresis, stain with EB and photograph the gel using an automated gel image analyzer. If the electrophoresis results show the characteristic band described in claim 3, the fig variety being tested is Huishankou; if the aforementioned characteristic band is absent, the fig variety being tested is not.