LsNAA15-16 gene, dsRNA and application of LsNAA15-16 gene in prevention and treatment of lasioderma serricorne

Abstract

The invention relates to an LsNAA15-16 gene, dsRNA and application of the LsNAA15-16 gene to prevention and treatment of lasioderma serricorne. The full-length ORF (Open Reading Frame) sequence of the LsNAA15-16 gene is as shown in SEQ ID NO. 1. The nucleotide sequence of the dsRNA is as shown in SEQ ID NO.3, and the dsRNA is used for targeted silencing of the LsNAA15-16 gene in the claim 1 or 2. Compared with the prior art, after the water-soluble RNA biopesticide preparation is used for feeding the lasioderma serricorne, the 20-day control effect on the lasioderma serricorne can reach 96% or above.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to an LsNAA15-16 gene, dsRNA and application in preventing and controlling tobacco beetles. Background Art

[0002] The RNAi (RNA interference) phenomenon was discovered by Fire et al. in 1998. Their research proved that double-stranded RNA (dsRNA) can silence the expression of target genes, and they won the Nobel Prize in 2006. Since then, it has been widely used as a tool for gene function research, especially in animals and plants where genetic manipulation tools are imperfect. In addition, it can also be used as a good tool for the development of targeted pesticides and drugs (Perrimon N, Ni JQ, Perkins L. In vivo RNAi: today and tomorrow. Cold Spring Harb Perspect Biol. 2010 Aug; 2(8): a003640. doi: 10.1101 / cshperspect.a003640.).

[0003] In the field of agricultural pest control, two studies in 2002 found that silencing specific target genes can lead to abnormal insect development, malformation of the next generation embryos, and even death (Bettencourt R, Terenius O, Faye I. Hemolingene silencing by ds-RNA injected into Cecropia pupae is lethal to nextgeneration embryos[J]. Insect Molecular Biology, 2002, 11(3): 267-271.; Bucher G, Scholten J, Klingler M. Parental RNAi in Tribolium (Coleoptera). Curr Biol. 2002 Feb 5; 12(3): R85-6. doi: 10.1016 / s0960-9822(02)00666-8.). This was the starting point for the use of RNAi technology in entomological research and application. Two reports in 2007 confirmed that the use of transgenic plants expressing insect dsRNA can achieve insecticidal effects (Baum JA, Bogaert T, Clinton W, Heck GR, Feldmann P, Ilagan O, Johnson S, Plaetinck G, Munyikwa T, Pleau M, Vaughn T, Roberts J. Control of coleopteran insect pests through RNA interference. Nat Biotechnol. 2007 Nov; 25(11): 1322-6. doi: 10.1038 / nbt1359.; Mao YB, Cai WJ, Wang JW, Hong GJ, Tao XY, Wang LJ, Huang YP, Chen XY. Silencing a cotton bollworm P450 monooxygenase gene by plant-mediated RNAi impairs larval tolerance of gossypol. Nat Biotechnol. 2007 Nov; 25(11): 1307-13. doi: 10.1038 / nbt1352.), these two studies provide strong evidence for the application of RNAi technology in pest control.Pesticides developed using this technology are called RNA biopesticides, also known as nucleic acid pesticides, RNA pesticides or RNA interference agents. They are new biopesticides developed based on RNA interference technology. Their core components are polynucleotides that can specifically bind to the mRNA transcribed from the target gene in the target organism (Wang M, Jin H. Spray-Induced Gene Silencing: a PowerfulInnovative Strategy for Crop Protection. Trends Microbiol. 2017 Jan; 25(1): 4-6. doi: 10.1016 / j.tim.2016.11.011.; Wang Zhiwen, Gao Xiang, Ma Dejun, Zhong Shan, Liu Xili, Xi Zhen. Nucleic acid pesticides - a new type of plant protection product with great potential. Journal of Pesticide Science, 2019, 21(5-6): 681-691.; Hu Shaoru, Guan Ruobing, Li Haichao, Miao Xuexia, 2019. Important progress and existing problems in the application of RNAi in pest control. Acta Entomologica Sinica, 62(4): 506–515.).RNA biopesticides can specifically silence the expression of target genes with high efficiency and strong specificity (Baum JA, Bogaert T, Clinton W, Heck GR, Feldmann P, Ilagan O, Johnson S, Plaetinck G, Munyikwa T, Pleau M, Vaughn T, Roberts J. Control of coleopteran insect pests through RNA interference. Nat Biotechnol. 2007 Nov; 25(11):1322-6. doi:10.1038 / nbt1359.; Mao YB, Cai WJ, Wang JW, Hong GJ, Tao XY, Wang LJ, Huang YP, Chen XY. Silencing a cotton bollworm P450 monooxygenase gene by plant-mediated RNAi impairs larval tolerance of gossypol. Nat Biotechnol.2007Nov;25(11):1307-13.doi:10.1038 / nbt1352.; Zhang J,Khan SA,Hasse C,RufS,Heckel DG,Bock R.Pestcontrol.Full crop protection from an insect pest by expression of longdouble-stranded RNAs in plastids.Science.2015Feb 27;347(6225):991-4.doi:10.1126 / science.1261680.). The principle is to use specific fragments of endogenous functional genes in organisms, synthesize them in vitro, and then introduce them into the target species to inhibit gene expression, thereby hindering gene function and ultimately affecting the growth and development of the target species and even the mechanism of death (Zhu KY, Palli SR. Mechanisms, Applications, and Challenges of Insect RNA Interference. Annu Rev Entomol. 2020 Jan 7; 65: 293-311. doi: 10.1146 / annurev-ento-011019-025224.).Due to its specificity for target species, ease of target development, and ease of degradation, SmartStax possesses most of the functions required of a green pesticide, attracting the attention of numerous scientists and pesticide companies and being hailed as the third revolution in pesticide production. Currently, many international pesticide companies, such as Bayer-Monsanto, Dow AgroSciences, and Syngenta, are leveraging this technology and investing significant human and material resources in the development of targeted insecticides. Reportedly, some products are already on the market or are about to be launched (Head GP, Carroll MW, Evans SP, Rule DM, Willse AR, Clark TL, et al. (2017). Evaluation of SmartStax and SmartStax PROmaize against western corn rootworm and northern corn rootworm: efficacy and resistance management. Pest. Manag. Sci. 73 1883–1899.10.1002 / ps.4554).

[0004] The tobacco beetle (Lasioderma serricorne (Fabricius)), a Coleoptera-family beetle, also known as the date beetle or date borer, is a worldwide stored product pest with a complex diet. Due to its wide-ranging diet, the beetle can harm tobacco, tea, cereals, legumes, dried dates, oilseeds, animal and plant specimens, cocoa beans, leather, and rattan and bamboo products, with tobacco products being particularly vulnerable. The beetle particularly favors aging tobacco leaves and can enter cigarettes along with processed tobacco, eating into the tobacco and piercing the paper. Its carcasses and feces contaminate tobacco leaves and products, severely impacting their usability and cigarette quality.

[0005] N-acetyl-L-ornithine (AORN) is a substrate used to identify, differentiate, and characterize N(α)-acetyl-L-ornithine deacetylase and N-acetyl-L-ornithine transcarbamylase (AOTCase), enzymes found in plants, certain eubacteria, and some human pathogens. Its predicted function contributes to peptide α-N-acetyltransferase activity, participating in the acetylation of N-terminal peptidyl methionine as part of the NatA complex. Naa15, together with its catalytic subunit Naa10, constitutes the evolutionarily conserved NatA (N-acetyltransferase A) complex. Following cleavage of the initiator methionine by methionine aminopeptidase, this complex acetylates the α-amino group of the first amino acid residue of proteins with small side chains, including serine, glycine, alanine, threonine, and cysteine. Both Naa15 and Naa16 interact with ribosomes in yeast (via ribosomal proteins uL23 and uL29), humans, and rats, thereby tethering NatA / Naa10 to the ribosome and promoting co-translational acetylation of nascent polypeptide chains as they emerge from the exit tunnel. Furthermore, Naa15 may act as a scaffold for other factors, including the chaperone-like protein HYPK (huntingtin-interacting protein K) and Naa50 (the catalytic acetyltransferase subunit of NatE). In Saccharomyces cerevisiae, NAA15Δ and NAA10Δ knockout cells exhibit identical phenotypes, and biochemical data indicate that uncomplexed Naa15 is unstable and degraded. Therefore, the function of Naa15 is closely linked to the acetyltransferase activity of Naa10 as part of the NatA complex.

[0006] NatA also regulates cotranslational protein folding and protein targeting to the endoplasmic reticulum, possibly by competing with SRP and NAC for the same ribosome-binding sites or by interfering with other ribosome-associated protein biogenesis factors, such as MetAP, the molecular chaperones Hsp70 / Hsp40, SRP, and NAC, which act on newly synthesized proteins immediately after they emerge from the ribosome exit tunnel. However, the precise mechanism of this action remains unclear. Furthermore, Naa15 has been implicated in numerous cellular processes, including maintenance of a healthy retina, endothelial cell permeability, tumor progression, neuronal generation and differentiation, apoptosis, and transcriptional regulation; it is currently unclear whether these are NatA-independent or NatA-dependent functions of Naa15. Furthermore, it is unclear whether Naa15 and Naa16 contribute to the lethality of tobacco beetles. Summary of the Invention

[0007] Based on the lack of RNA biopesticides developed by efficiently utilizing RNA interference technology for use in the prevention and control of tobacco beetles in the prior art, the present invention provides a LsNAA15-16 gene, dsRNA and their use in the prevention and control of tobacco beetles.

[0008] The purpose of the present invention can be achieved by the following technical solutions:

[0009] The present invention first provides a LsNAA15-16 gene, the full-length ORF sequence of which is shown in SEQ ID NO.1.

[0010] Furthermore, the nucleotide sequence of the LsNAA15-16 gene is shown in SEQ ID NO.2.

[0011] The LsNAA15-16 gene provided by the present invention is a target gene, namely Nα-acetyl-L-ornithine (N(alpha)-acetyltransferase 15 / 16, LsNAA15-16).

[0012] The present invention further provides the use of the LsNAA15-16 gene in preparing a tobacco beetle control agent.

[0013] The present invention further provides a dsRNA, which is a double-stranded RNA composed of nucleotides shown in SEQ ID NO. 3 and nucleotides shown in its reverse complementary sequence, wherein "t" in the nucleotide sequence shown in SEQ ID NO. 3 represents uracil.

[0014] The dsRNA provided by the present invention is used to target and silence the LsNAA15-16 gene. Therefore, the dsRNA provided by the present invention is also referred to as dsLsNAA15-16, or dsNAA15-16.

[0015] The present invention further provides a pair of primers for amplifying the dsRNA, wherein the dsRNA F primer sequence is shown as SEQ ID NO.4, and the dsRNA R primer sequence is shown as SEQ ID NO.5.

[0016] The present invention further provides an expression vector containing the dsRNA.

[0017] The present invention also provides a host cell, wherein the host cell contains the expression vector or a DNA sequence corresponding to the dsRNA is integrated into the chromosome.

[0018] The present invention also provides a composition comprising the dsRNA and a carrier acceptable for insect feeding.

[0019] The present invention also provides a water-soluble RNA biopesticide preparation, comprising the dsRNA and water as a solvent for dissolving the dsRNA.

[0020] The present invention also provides a method for killing tobacco beetles, specifically spraying a water-soluble RNA biological pesticide preparation on an object or space where the tobacco beetles need to be killed.

[0021] The present invention provides the LsNAA15-16 gene, a target gene that is lethal to tobacco beetles. Based on this, and using RNA interference technology, a dsRNA and primers for synthesizing the dsRNA are provided. Also provided are a composition comprising the dsRNA, a water-soluble RNA biopesticide formulation, and a method for killing tobacco beetles.

[0022] Compared with the prior art, after feeding tobacco beetles with the water-soluble RNA biopesticide preparation of the present invention, the 20-day control effect on tobacco beetles can reach more than 96%. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 .Survival rate of tobacco beetles 26 days after feeding dsLsNAA15-16.

[0024] Figure 2 .The death phenotype of tobacco beetles 26 days after feeding dsLsNAA15-16.

[0025] Figure 3 .The mRNA expression level of tobacco beetle was significantly downregulated after feeding dsLsNAA15-16. DETAILED DESCRIPTION

[0026] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0027] Example 1

[0028] One of the purposes of this embodiment is to obtain the target gene sequence, and the steps include:

[0029] (1) Extraction of total RNA from Nicotiana tabacum

[0030] Using tobacco beetle as the material, conventional Trizol method was used for extraction, conventional method for purification, and DNAse treatment to obtain Total RNA samples with a concentration of ≥300ng / ul, a total amount of ≥6ug, and an OD260 / 280 of 1.8-2.2.

[0031] (2) Isolation of mRNA and synthesis of cDNA

[0032] PolyA-containing mRNA was isolated using oligo-dT magnetic beads (Cat. No. S1419S, NEB), and then the first-strand cDNA was synthesized using random hexamer primers (Cat. No. SO142, Thermo Scientific) and the Superscript II reverse transcriptase kit purchased from Invitrogen.

[0033] (3) Gene amplification and sequencing

[0034] Specific primers for the LsNAA15-16 gene were used for amplification. The resulting gene fragment was purified and ligated into the PMD-18 vector (produced by Takara). Top10 strains were then transformed, screened for blue-white spots, and positive strains were sequenced. The specific primers for amplifying the target gene LsNAA15-16 were LsNAA15-16 Primer F, whose nucleotide sequence is shown in SEQ ID NO. 6, specifically: ATGGGGATGGCAGCTC; and LsNAA15-16 Primer R, whose nucleotide sequence is shown in SEQ ID NO. 7, specifically: GAGTTACTATAAAC.

[0035] (4) dsRNA synthesis

[0036] The dsRNA was synthesized using the UltraClean T7 RNA Transcription Kit (SJ001B) from Shanghai Zhisheng Yougu Biotechnology Co., Ltd. For detailed instructions, see the kit. Primers for amplifying dsRNA (dsLsNAA15-16) included dsRNA F primer and dsRNA R primer. The dsRNA F primer sequence is shown in SEQ ID NO. 4, and the dsRNA R primer sequence is shown in SEQ ID NO. 5.

[0037] (5) Prevention and control effect test

[0038] 30 μg of the synthesized dsRNA was dissolved in water to a final concentration of 500 ng / μL, and then evenly sprayed on the surface of tobacco leaves. After drying, tobacco beetle larvae were inoculated and allowed to feed. Data were collected 20 days after treatment.

[0039] (6) Statistical analysis

[0040] The significance of the differences between the data was analyzed using T.Test, and the corresponding results were obtained by calculating the mean and the standard deviation (SD) between the data.

[0041] Example 2

[0042] Control effect of RNA biological pesticide solution on tobacco beetle

[0043] The dsRNA (dsLsNAA15-16) synthesized in Example 1 was dissolved in water at a concentration of 1.500 μg / μl, serving as the experimental group. A control group was also established. dsGFP P (double-stranded green fluorescent protein, a known biomaterial and commonly used as a positive control in control experiments) was dissolved in water and evenly sprayed onto the surface of tobacco leaves using a sprayer. After drying, 30 tobacco beetle larvae were inoculated onto each leaf. Each treatment was repeated five times. Survival of tobacco beetles was recorded 20 days after treatment.

[0044] The results showed that compared with the control dsGFP, tobacco beetle larvae began to show death phenotype on the 5th day after feeding on tobacco leaves treated with dsLsNAA15-16, and the mortality rate was 96.67±3.33% after 20 days ( Figure 1 ), achieving a more effective control effect. At the same time, the tobacco beetles treated with dsLsNAA15-16 showed a phenotype of being unable to pupate normally ( Figure 2 ), and its mRNA expression level was significantly downregulated ( Figure 3 ).

[0045] The above examples demonstrate that dsLsNAA15-16 can effectively eliminate tobacco beetles.

[0046] The above description of the embodiments is intended to facilitate understanding and use of the invention by those skilled in the art. It will be apparent that those skilled in the art can readily make various modifications to these embodiments and apply the general principles described herein to other embodiments without requiring inventive effort. Therefore, the present invention is not limited to the above-described embodiments. Improvements and modifications made by those skilled in the art based on the disclosure of the present invention, without departing from the scope of the present invention, should be within the scope of protection of the present invention.

[0047] The sequence information involved in the present invention is as follows:

[0048] SEQ ID NO.1: Full-length ORF sequence of LsNAA15-16:

[0049]

[0050] SEQ ID NO.2: Nucleotide sequence of LsNAA15-16 gene:

[0051]

[0052] SEQ ID NO.3: dsRNA nucleotide sequence:

[0053] AAGGGCTTCCTGGATAGGTTATGCGATGTCTTTTCACCTATTAGAAGACTACAAAAATGCTCTGAATATTTTAGAAACTTTTCTGGACCAACAACAAAAGGGGAGTAACTTTGATTACGAGCACAGTGAACTGCTACTTTACCAGAACATGGTTATAAGGGAATCGGGTGAACTGAAACAGGCTCTGGCCCATCTTGAAAGCTCCTCTGATCAGATCGTAGATAAGCTGACCCTCAAAGAAAACCTAGCCGAGTTGAATCTCCAGCTCAAAAATTATGATAAAGCGCAACAATACTTTAAGGAACTGATTAAGAGGAATCCCGAAAACACTATTTACTATAGAAAACTGATAGAATCAAAACGCTTAGTAGACTCTGAAGATATTGTTAAGCTTTACGCCGAATACGAGCAGCAATATCCACGTGCCATGCCTCCCCGTCGACTTCCATTGAAT

[0054] SEQ ID NO.4: dsRNA F primer sequence:

[0055] TAATACGACTCACTATAGGGAAGGGCTTCCTGGATAGGTT

[0056] SEQ ID NO.5: dsRNA R primer sequence:

[0057] TAATACGACTCACTATAGGGATTCAATGGAAGTCGACGGG SEQ ID NO.6: LsNAA15-16Primer F sequence: ATGGGGATGGCAGCTC

[0058] SEQ ID NO.7: LsNAA15-16 Primer R sequence: GAGTTACTATAAAC.

Claims

1. A LsNAA15-16 gene, characterized in that The full-length ORF sequence is shown in SEQ ID NO.

1.

2. The LsNAA15-16 gene according to claim 1, characterized in that Its nucleotide sequence is shown in SEQ ID NO.

2.

3. Use of the LsNAA15-16 gene according to claim 1 or 2 in the preparation of a tobacco beetle control agent.

4. A dsRNA, characterized in that It is a double-stranded RNA composed of the nucleotides shown in SEQ ID NO. 3 and the nucleotides shown in its reverse complementary sequence. The dsRNA is used for targeted silencing of the LsNAA15-16 gene according to claim 1 or 2.

5. A pair of primers for amplifying the dsRNA according to claim 4, characterized in that: The dsRNA F primer sequence is shown in SEQ ID NO.4, and the dsRNA R primer sequence is shown in SEQ ID NO.

5.

6. An expression vector, characterized in that The expression vector contains the dsRNA according to claim 4.

7. A host cell, characterized in that The host cell contains the expression vector according to claim 6 or has a DNA sequence corresponding to the dsRNA according to claim 4 integrated into its chromosome.

8. A composition, characterized in that The composition comprises the dsRNA according to claim 4 and a carrier acceptable for insect feeding.

9. A water-soluble RNA biopesticide preparation, characterized in that: The method comprises the dsRNA according to claim 4 and water as a solvent for dissolving the dsRNA.

10. A method for killing tobacco beetles, characterized in that: The water-soluble RNA biopesticide preparation according to claim 9 is sprayed on objects or spaces where tobacco beetles need to be killed.

Images