Improved antibody expression vector as well as construction method and application thereof

By constructing an improved antibody expression vector and integrating a composite promoter and MAR sequence, the problems of low expression efficiency, poor stability and insufficient post-translational modification ability of existing vectors have been solved, and a significant improvement in antibody production and functionality has been achieved, making it suitable for the efficient production of a variety of antibodies.

CN120608080APending Publication Date: 2025-09-09GENERAL BIOL (ANHUI) CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510765336.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-10
Publication Date
2025-09-09

AI Technical Summary

Technical Problem

Existing antibody expression vectors have problems such as low expression efficiency, poor stability, insufficient post-translational modification capabilities, and single multiple cloning site design, making it difficult to adapt to the flexible construction of different antibodies.

Method used

A composite hybrid promoter was constructed by integrating the synergistic effects of CMV enhancer, SV40 enhancer, GC-rich sequence and hEF-1α promoter. The β-interferon MAR sequence and NeoR/Kan resistance gene were introduced into the vector. The vector pTT5 was transformed by homologous recombination technology to form pTT5-MAR-CHP.

Benefits of technology

It significantly improves antibody expression efficiency, enhances vector stability, optimizes post-translational modification capabilities, and increases antibody production by more than 2.5 times, ensuring antibody functionality and stability. It is suitable for the efficient production of monoclonal, bispecific, and polyclonal antibodies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120608080A_ABST
    Figure CN120608080A_ABST
Patent Text Reader

Abstract

The invention discloses an improved antibody expression vector as well as a construction method and application thereof, and belongs to the technical field of biology, the construction method comprises the following steps: step 1, designing and synthesizing a compound hybrid promoter with a simple structural formula of 5 '-[CMV enhancer]-[SV40 enhancer]-[GC-rich sequence]--[hEF-1alpha promoter]-3'; step 2, transforming a carrier pTT5, so as to obtain a carrier pTT5-MAR; 3, through homologous recombination, the composite hybrid promoter is inserted into a vector pTT5-MAR skeleton, and a vector pTT5-MAR-CHP is obtained; the vector pTT5-MAR-CHP is added into the competent cell DH5alpha, it is confirmed through sequencing that the final expression vector is constructed correctly, the constructed expression vector has the advantages of being high in expression efficiency and stability, and the yield of antibodies can be remarkably increased.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to an improved antibody expression vector and a construction method and application thereof. Background Art

[0002] Antibodies play an important role in disease diagnosis, treatment, and prevention. With the advancement of biotechnology, the demand for antibody drugs is increasing. Currently, antibody expression vectors are key tools for antibody production, but their expression efficiency, stability, and post-translational modification capabilities still need to be improved.

[0003] In the prior art, commonly used antibody expression vectors, such as the mammalian expression vector pCDNA3.1 / pTT5, have the following problems:

[0004] (1) Low expression efficiency and insufficient transcriptional activity of traditional promoters, resulting in insufficient antibody production;

[0005] (2) The vector has poor stability and is prone to gene loss or mutation in long-term passage in host cells;

[0006] (3) Insufficient post-translational modification ability, which affects the functionality and stability of the antibody;

[0007] (4) The design of multiple cloning sites is single, which makes it difficult to adapt to different antibodies (such as flexible construction of IgG / IgM) and lacks versatility.

[0008] Therefore, it is of great significance to develop an efficient, stable antibody expression vector with optimized post-translational modification capabilities. Summary of the Invention

[0009] The purpose of the present invention is to provide an improved antibody expression vector and its construction method and application, so as to solve the problem of low expression efficiency of antibody expression vectors in the background art.

[0010] The purpose of the present invention can be achieved through the following technical solutions:

[0011] In a first aspect, the present invention provides a method for constructing an improved antibody expression vector, comprising the following steps:

[0012] Step 1: Design and synthesize a composite hybrid promoter. The structure of the composite hybrid promoter is 5'-[CMV enhancer]-[SV40 enhancer]-[GC-rich sequence]--[hEF-1α promoter]-3'. The sequence information of the composite hybrid promoter is recorded as SEQ ID NO: 1.

[0013] Step 2: Modify the vector pTT5 to obtain the vector pTT5-MAR. The specific steps are as follows:

[0014] β-interferon MAR sequence was synthesized by gene synthesis;

[0015] Design primers to amplify the NeoR / Kan resistance gene sequence from the pEGFP-C1 vector;

[0016] Using homologous recombination, the interferon-β MAR sequence (GenBank: M83137.1, bases 1 to 2201) and the NeoR / Kan resistance gene sequence were inserted into the vector pTT5 to generate the vector pTT5-MAR.

[0017] Step 3: Insert the composite hybrid promoter into the pTT5-MAR backbone through homologous recombination to obtain the pTT5-MAR-CHP vector;

[0018] Step 4: Plasmid transformation: Add the vector pTT5-MAR-CHP into competent cells DH5α and confirm the correct construction of the final expression vector by sequencing.

[0019] In some embodiments, step 1 is specifically performed as follows:

[0020] First, the CMV enhancer, SV40 enhancer, and hEF1-α promoter sequences were synthesized by PCR, and a GC-rich sequence was synthesized by gene synthesis. Then, the CMV enhancer, SV40 enhancer, hEF1-α promoter, and GC-rich sequence were sequentially linked using overlap extension PCR to obtain a composite hybrid promoter.

[0021] Taking the CMV enhancer and SV40 enhancer as examples, primers containing homologous fragments are designed. After a first round of PCR amplification, complementary fragments of the CMV enhancer and SV40 enhancer are obtained, which can be used as primers for each other's amplification. Using the products obtained in the first round as templates, a second round of PCR amplification is performed to splice the CMV enhancer and SV40 enhancer together by extending the overlapping chains. The connection process of the hEF1-α promoter and the GC-rich is similar and is well known to those skilled in the art.

[0022] The sequence information of the CMV enhancer is recorded as SEQ ID NO: 2;

[0023] The sequence information of the SV40 enhancer is recorded as SEQ ID NO: 3;

[0024] The GC-rich sequence information is recorded as SEQ ID NO: 4;

[0025] The sequence information of the hEF1-α promoter is recorded as SEQ ID NO: 5.

[0026] In some embodiments, the pTT5 vector backbone in step 2 is obtained by enzyme digestion or PCR reaction.

[0027] In some embodiments, the specific steps for obtaining the vector pTT5-MAR in step 2 are as follows:

[0028] Using the Universal Biotechnology 2xGenRec Recombination Kit, add the pTT5 vector, the interferon-β MAR sequence, the NeoR / Kan resistance gene sequence, and the recombinase mixture from the homologous recombination kit to a sterile centrifuge tube. Gently pipette 5–10 times and place the reaction mixture in a 50°C water bath for 15–60 minutes. Remove the reaction mixture and place it on ice for 5 minutes before transforming competent DH5α cells. Finally, extract the plasmid, and confirm the correct construction of the final expression vector by sequencing. This vector is named pTT5-MAR.

[0029] In some embodiments, step 3 is specifically performed as follows:

[0030] Using the Universal Biotechnology 2xGenRec Recombination Kit, add the vector pTT5-MAR, the composite hybrid promoter, the enzymes and buffer from the homologous recombination kit to a sterile centrifuge tube. Immediately pipette gently vortex 5-10 times, then place the reaction solution in a 50°C water bath for 15-60 minutes. Remove the reaction solution promptly and place it on ice for transformation into competent DH5α cells. Extract the plasmid and confirm the correct construction of the final expression vector by sequencing. This vector contains the composite hybrid promoter designed in the above steps and the characteristic MAR sequence and is named pTT5-MAR-CHP.

[0031] In some embodiments, step 4 is specifically performed as follows:

[0032] Add the vector pTT5-MAR-CHP to competent DH5α cells, mix gently, place on ice for 30 minutes, heat shock in a 42°C water bath for 90 seconds, and immediately place on ice for 2 minutes. Add resistance-free LB liquid medium to the bacterial suspension and resuscitate at 37°C, 220 rpm, for 45 minutes. Spread an appropriate volume of the bacterial suspension evenly on ampicillin / kanamycin dual-resistance LB solid medium and incubate at 37°C, inverted, for 12-16 hours. Select a single colony and incubate in 3 mL of LB liquid medium containing ampicillin / kanamycin dual-resistance antibiotics at 37°C, 220 rpm, for 12-16 hours. Extract the plasmid and confirm the correct construction of the final expression vector by sequencing.

[0033] In some embodiments, the volume ratio of the vector pTT5-MAR-CHP, the competent cells DH5α and the resistance-free LB liquid culture medium is 1:10:40.

[0034] In a second aspect, the present invention provides an improved antibody expression vector obtained by the above-mentioned construction method.

[0035] In a second aspect, the present invention provides use of the above-mentioned improved antibody expression vector in the expression of monoclonal antibodies, bispecific antibodies or polyclonal antibodies.

[0036] In some embodiments, the method for using the improved antibody expression vector comprises the following steps:

[0037] S1. Amplify the antibody protein sequence by PCR, prepare a linearized vector by enzyme digestion, construct the antibody protein sequence into the vector pTT5-MAR-CHP by homologous recombination, transform the recombinant plasmid into the cloning strain DH5α, extract the plasmid, and confirm the correct construction of the final expression vector by sequencing;

[0038] S2. Extract transfection-grade plasmid using a plasmid extraction kit; test the extracted plasmid to confirm that the plasmid test results meet the transfection requirements before proceeding to the next transfection experiment;

[0039] S3, transfection of CHO-S cells or HEK-293T cells;

[0040] S4. Centrifuge the cell culture medium after several days of transfection. Filter the supernatant through a 0.22 μm membrane, dialyze into buffer at 4°C, and purify using a Protein A column. Verify the expression efficiency of the vector and the antibody function by ELISA and Western blotting.

[0041] In some embodiments, the steps of transfecting CHO-S cells are as follows:

[0042] CHO-S cells were cultured at a rate of 2 to 3 × 10 5 Cells were inoculated and cultured at a density of 100 cel l / mL. Cells were collected after 72 h, at which point the cell density was 4-6×10 6 1 cel / mL, perform subculture, and then perform cell electroporation. Set the electroporation program and parameters: voltage 1400V, pulse 20ms, and add the recombinant plasmid to the electroporation cuvette. Add CHO-S cells to the electroporation cuvette and mix thoroughly. Place the cuvette in the electroporation tank and pulse once. After the pulse, transfer the cells to wells containing 0.5mL of culture medium. Gently shake the plate to evenly distribute the cells and place in the incubator for incubation.

[0043] In some embodiments, the steps for transfecting HEK-293T cells are as follows:

[0044] HEK293 cells were seeded and cultured in a 37°C, 5% CO2 incubator. When the cell confluence reached 80%, HEK293 cells were plated at 4×10 5The cells were seeded at a density of 100 cells / well in a 6-well culture plate. When the cells grew to about 70% to 80%, they were transfected with PEI. A PEI / vector pTT5-MAR-CHP mixture was prepared at a mass ratio of 4:1. The mixture was added to the cell culture wells while shaking the culture plate. After thorough mixing, the cells were placed in a cell culture incubator for culture.

[0045] Beneficial effects of the present invention:

[0046] 1. The present invention significantly enhances transcriptional activity and expression efficiency by constructing a composite hybrid promoter and integrating the synergistic effects of the CMV enhancer, SV40 enhancer, GC-rich sequence, and hEF-1α promoter. This can significantly increase antibody production. Experiments have shown that compared with the traditional pTT5 vector, the antibody expression level is increased by more than 2.5 times, and the peak yield can reach 8.0g / L.

[0047] 2. The present invention introduces the β-interferon MAR sequence and NeoR / Kan resistance gene into the vector, effectively maintaining the long-term stability of the vector in the host cell, reducing gene loss or mutation during long-term passage, ensuring the continuity and stability of antibody production, and overcoming the defect of poor vector stability in the prior art.

[0048] 3. The expression vector provided by the present invention is more conducive to the correct post-translational modification of antibodies by host cells (such as CHO-S cells and HEK-293T cells). High-quality and efficient promoters can promote the correct folding and modification of antibody proteins. GC-rich sequences help maintain the stability of the transcription process, thereby ensuring the normal expression and function of enzymes related to post-translational modification, thereby improving the functionality and stability of antibodies and compensating for the insufficient post-translational modification capabilities of existing vectors.

[0049] 4. In applications involving the expression of monoclonal, bispecific, or polyclonal antibodies, the improved vectors of this invention can significantly improve the production efficiency and quality of antibodies. Through optimized promoter and vector structures, the expression of antibodies in host cells is significantly increased while maintaining antibody functionality and stability. This reduces the cost of antibody production and improves the production efficiency of antibody drugs, which has important practical significance for promoting the research, development, and production of antibody drugs.

[0050] 5. The vector construction method of the present invention is simple and easy. The vector modification and antibody gene cloning can be achieved through conventional molecular biology techniques such as homologous recombination, which is convenient for promotion and application in laboratories and industrial production, and is conducive to accelerating the development process of antibody drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] The present invention will be further described below with reference to the accompanying drawings.

[0052] Figure 1 Schematic diagram of the construction of the vector pTT5-MAR-CHP of the present invention;

[0053] Figure 2 Graphs showing the expression results of different antibodies using vectors provided in Examples and Comparative Examples of the present invention. DETAILED DESCRIPTION

[0054] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts shall fall within the scope of protection of the present invention.

[0055] Preparation Example 1

[0056] The present invention provides a method for constructing an improved antibody expression vector, comprising the following steps:

[0057] Step 1: Design and synthesize a composite hybrid promoter. First, the CMV enhancer, SV40 enhancer, and hEF1-α promoter sequences are synthesized by PCR, and a GC-rich sequence is synthesized by gene synthesis. The CMV enhancer, SV40 enhancer, hEF1-α promoter, and GC-rich sequence are sequentially linked using overlap extension PCR to obtain a composite hybrid promoter. The simplified structural formula of the composite hybrid promoter is 5'-[CMV enhancer]-[SV40 enhancer]-[GC-rich sequence]--[hEF-1α promoter]-3'. The sequence information of the composite hybrid promoter is recorded as SEQ ID NO: 1, as shown below:

[0058] GACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTCCGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTACGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGGTGTGGAAAGTCCCCAGGCTCCCCAGCGGGTCGCCCCATTTTGGAGGCGGGGAAAACCGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCGGTGTGGAAAGTCCCCAGGCTCCCCAGCGGGTCGCCCCATTTTGGAGGCGGGGAAAACCGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCGCGCCGGCGCCCGGCGCCGGCGCCTCCGGCGCCGGCGCCGGAGCCGGCGCCGGCGCCGGAGCCGGCGCCGGCGCCGGAGCCGGCGCCGGCGCCGGCGCCGGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAG;

[0059] Step 2: Modify the vector pTT5 to obtain the vector pTT5-MAR. The specific operation steps are as follows:

[0060] β-interferon MAR sequence was synthesized by gene synthesis;

[0061] Design primers to amplify the NeoR / Kan resistance gene sequence from the pEGFP-C1 vector;

[0062] Using the Universal Biotechnology 2xGenRec Recombination Kit, add the vector pTT5, the β-interferon MAR sequence (GenBank: M83137.1, bases 1 to 2201), the NeoR / Kan resistance gene sequence, and the recombinase mixture in the homologous recombination kit to a sterile centrifuge tube for recombination reaction. The recombination reaction system is as follows:

[0063]

[0064]

[0065] Note:

[0066] The 2×GenRecAssembly Master Mix in the kit is premixed with the recombinase and the buffer required for the recombination reaction.

[0067] A or B (ng) = 0.02 × number of base pairs (bp) of additive, where the additive is the pTT5 linearized cloning vector or insert fragment, and the insert fragment is the β-interferon MAR sequence and the NeoR / Kan resistance gene sequence; (the corresponding fragment concentration is 0.03 pmol);

[0068] Gently pipette 10 times, then place the reaction solution in a 50°C water bath for 15 minutes. According to the instructions for the recombination kit, 15 minutes is sufficient for the recombination of 2-3 fragments, and 60 minutes is required for 4-6 fragments. The reaction solution is then promptly removed and placed on ice for 5 minutes before transformation into competent DH5α cells. Finally, the plasmid is extracted, and the correct construction of the final expression vector is confirmed by sequencing. It is named pTT5-MAR.

[0069] Step 3: Insert the composite hybrid promoter into the pTT5-MAR backbone vector through homologous recombination to obtain the pTT5-MAR-CHP vector. The specific steps are as follows:

[0070] Using the Universal Biotechnology 2xGenRec Recombination Kit, add the vector pTT5-MAR, the composite hybrid promoter, the enzymes from the homologous recombination kit, and the buffer to a sterile centrifuge tube. Immediately pipette gently 10 times and place the reaction solution in a 50°C water bath for 15 minutes. Remove the reaction solution promptly and place it on ice for transformation into competent DH5α cells. Extract the plasmid and confirm the correct construction of the final expression vector by sequencing. This vector, containing the composite hybrid promoter designed in the above steps and the characteristic MAR sequence, is named pTT5-MAR-CHP.

[0071] Step 4: Plasmid transformation: Add the vector pTT5-MAR-CHP to competent cells DH5α and confirm the correct construction of the final expression vector by sequencing. The specific steps are as follows:

[0072] Add 10 μL of the vector pTT5-MAR-CHP to 100 μL of competent DH5α cells, mix gently, place on ice for 30 minutes, heat shock in a 42°C water bath for 90 seconds, and quickly place on ice for 2 minutes. Then, add 400 μL of resistance-free LB liquid medium to the bacterial suspension and resuscitate at 37°C, 220 rpm, for 45 minutes. Take an appropriate volume of the bacterial suspension and evenly spread it on LB solid medium containing ampicillin / kanamycin dual resistance and incubate inverted at 37°C for 12 hours. Pick a single colony and incubate in 3 mL of LB liquid medium containing ampicillin / kanamycin dual antibiotics at 37°C, 220 rpm, for 12 hours. Extract the plasmid, and confirm the correct construction of the final expression vector by sequencing.

[0073] The sequence information of the CMV enhancer is recorded as SEQ ID NO: 2, as shown below:

[0074] GACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTCCGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTACGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATG;

[0075] The sequence information of the SV40 enhancer is denoted as SEQ ID NO: 3 and is as follows:

[0076] GGTGTGGAAAGTCCCCAGGCTCCCCAGCGGGTCGCCCCATTTTGGAGGCGGGGAAAACCGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCGGTGTGGAAAGTCCCCAGGCTCCCCAGCGGGTCGCCCCATTTTGGAGGCGGGGAAAACCGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGC;

[0077] The sequence information of the GC-rich sequence is denoted as SEQ ID NO: 4 and is as follows:

[0078] GCGCCGGCGCCCGGCGCCGGCGCCTCCGGCGCCGGCGCCGGAGCCGGCGCCGGCGCCGG AGCCGGCGCCGGCGCCGGAGCCGGCGCCGGCGCCGGCGCCG;

[0079] The sequence information of the hEF1-α promoter is denoted as SEQ ID NO: 5 and is as follows:

[0080] GGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAG.

[0081] Example 1

[0082] Using anti-HER2 monoclonal antibody as the antibody to be expressed, the expression efficiency of the vector pTT5-MAR-CHP obtained in Preparation Example 1 was tested. The specific test steps are as follows:

[0083] S1. Clone the anti-HER2 monoclonal antibody into the expression vector pTT5-MAR-CHP to obtain a recombinant plasmid. The specific steps are as follows:

[0084] Primers were designed to amplify the anti-HER2 monoclonal antibody fragment. The 5' and 3' ends of the primers contained sequences that were completely identical to the corresponding ends of the linearized cloning vector. The anti-HER2 monoclonal antibody PCR product with vector end sequences at both ends was mixed with the linearized pTT5-MAR-CHP vector and transformed using the Universal Biological 2xGenRec recombination kit to complete directional cloning. Based on the above method, the recombinant plasmids of the anti-HER2 antibody heavy chain and light chain were obtained respectively;

[0085] S2. Extract transfection-grade plasmid using a plasmid extraction kit; test the extracted plasmid to confirm that the plasmid test results meet the transfection requirements before proceeding to the next transfection experiment;

[0086] S3, CHO-S cells were cultured at 2×10 5 The cells were inoculated and cultured at a density of 4 × 10 1 / mL. The cells were collected after 72 h, at which point the cell density was 4 × 10 6 cel l / mL, after subculture treatment, cell electroporation experiment was performed; the electroporation program and electroporation parameters were set as follows: voltage 1400V, pulse 20ms, 30ug recombinant plasmid was added to the electroporation cup (pTT5-MAR-CHP-her2 LC: 20μg, pTT5-MAR-CHP-her2 HC: 10μg); CHO-S cells were added to the electroporation cup, at which time the cell density was 5×10 6cel l / mL, mix well, place the electroporation cup into the electroporation tank, and pulse once; after pulsing, transfer to the wells containing 0.5mL culture medium, gently shake the well plate to evenly distribute the cells, and place in the incubator for culture;

[0087] S4. Centrifuge the cell culture medium after several days of transfection at 1000 × g for 30 minutes. Filter the supernatant through a 0.22 μm membrane, dialyze into buffer at 4°C, and purify using a Protein A column. Verify the expression of the vector by ELISA and Western blotting.

[0088] Comparative Example 1

[0089] The expression efficiency of the vector pTT5 was tested using the anti-HER2 monoclonal antibody as the antibody to be expressed, and the test steps were the same as those in Example 1.

[0090] Depend on Figure 2 The statistical results show that the expression level of the vector antibody provided in Example 1 is 6.2 g / L, and that in Comparative Example 1 is 1.8 g / L. Mass spectrometry analysis shows that the proportion of low fucose in the glycosylation at position N297 in Example 1 is >80%, and that in Comparative Example 1 is 40%.

[0091] Example 2

[0092] The anti-PD-1 monoclonal antibody was used as the antibody to be expressed, and the expression efficiency of the vector pTT5-MAR-CHP obtained in Preparation Example 1 was tested. The test steps were the same as those in Example 1.

[0093] Comparative Example 2

[0094] The expression efficiency of the vector pTT5 was tested using the anti-PD-1 monoclonal antibody as the antibody to be expressed, and the test steps were the same as those in Example 1.

[0095] Depend on Figure 2 The statistical results show that the antibody expression level of the vector provided in Example 2 is increased by nearly 4 times compared with that of the vector pTT5 under the same conditions.

[0096] Example 3

[0097] The anti-PD-L1 monoclonal antibody was used as the antibody to be expressed, and the expression efficiency of the vector pTT5-MAR-CHP obtained in Preparation Example 1 was tested. The test steps were the same as in Example 1.

[0098] Comparative Example 3

[0099] The expression efficiency of the vector pTT5 was tested using the anti-PD-L1 monoclonal antibody as the antibody to be expressed, and the test steps were the same as those in Example 1.

[0100] Depend on Figure 2The statistical results show that the antibody expression level of the vector provided in Example 3 is increased by nearly 3.5 times compared with the vector pTT5 under the same conditions.

[0101] Example 4

[0102] The expression efficiency of the vector pTT5-MAR-CHP obtained in Preparation Example 1 was tested using the anti-TIM3 monoclonal antibody as the antibody to be expressed, and the test steps were the same as in Example 1.

[0103] Comparative Example 4

[0104] The expression efficiency of the vector pTT5 was tested using the anti-TIM3 monoclonal antibody as the antibody to be expressed, and the test steps were the same as those in Example 1.

[0105] Depend on Figure 2 The statistical results show that the antibody expression level of the vector provided in Example 4 is nearly 4 times higher than that of the vector pTT5 under the same conditions.

[0106] Example 5

[0107] The anti-VISTA monoclonal antibody was used as the antibody to be expressed, and the expression efficiency of the vector pTT5-MAR-CHP obtained in Preparation Example 1 was tested, and the test steps were the same as in Example 1.

[0108] Comparative Example 5

[0109] The expression efficiency of the vector pTT5 was tested using the anti-VISTA monoclonal antibody as the antibody to be expressed, and the test steps were the same as in Example 1.

[0110] Depend on Figure 2 The statistical results show that the antibody expression level of the vector provided in Example 5 is nearly 3 times higher than that of the vector pTT5 under the same conditions.

[0111] Example 6

[0112] Using anti-CTLA-4 monoclonal antibody as the antibody to be expressed, the expression efficiency of the vector pTT5-MAR-CHP obtained in Preparation Example 1 was tested. The specific test steps are as follows:

[0113] S1. Clone the anti-CTLA-4 monoclonal antibody into the expression vector pTT5-MAR-CHP to obtain a recombinant plasmid;

[0114] S2. Extract transfection-grade plasmid using a plasmid extraction kit; test the extracted plasmid to confirm that the plasmid test results meet the transfection requirements before proceeding to the next transfection experiment;

[0115] S3. Inoculate HEK293 cells and culture them in a 37°C, 5% CO2 incubator. When the cell confluence reaches 80%, plate HEK293 cells at 4×10 5 The cells were seeded at a density of 100 cells / well in a 6-well culture plate. When the cells grew to 70% to 80%, they were transfected with PEI. A PEI / recombinant plasmid mixture was prepared at a mass ratio of 4:1. The mixture was added to the cell culture wells while shaking the culture plate. After thorough mixing, the cells were placed in a cell culture incubator for culture.

[0116] S4. Centrifuge the cell culture medium after several days of transfection at 1000 × g for 30 minutes. Filter the supernatant through a 0.22 μm membrane, dialyze into buffer at 4°C, and purify using a Protein A column. Verify the expression of the vector by ELISA and Western blotting.

[0117] Comparative Example 6

[0118] The expression efficiency of the vector pTT5 was tested using the anti-CTLA-4 monoclonal antibody as the antibody to be expressed. The specific testing steps were the same as those in Example 6.

[0119] Depend on Figure 2 The statistical results show that the antibody expression level of the vector provided in Example 6 is nearly 3 times higher than that of the vector pTT5 under the same conditions.

[0120] Example 7

[0121] The expression efficiency of the vector pTT5-MAR-CHP obtained in Preparation Example 1 was tested using the anti-CD20 monoclonal antibody as the antibody to be expressed. The specific testing steps were the same as those in Example 6.

[0122] Comparative Example 7

[0123] The expression efficiency of the vector pTT5 was tested using the anti-CD20 monoclonal antibody as the antibody to be expressed. The specific test steps were the same as those in Example 6.

[0124] Depend on Figure 2 The statistical results show that the antibody expression level of the vector provided in Example 7 is nearly 3 times higher than that of the vector pTT5 under the same conditions.

[0125] Example 8

[0126] The expression efficiency of the vector pTT5-MAR-CHP obtained in Preparation Example 1 was tested using the anti-VEGF monoclonal antibody as the antibody to be expressed. The specific testing steps were the same as those in Example 6.

[0127] Comparative Example 8

[0128] The expression efficiency of the vector pTT5 was tested using the anti-VEGF monoclonal antibody as the antibody to be expressed. The specific test steps were the same as those in Example 6.

[0129] Depend on Figure 2 The statistical results show that the antibody expression level of the vector provided in Example 8 is increased by nearly 3.5 times compared with the vector pTT5 under the same conditions.

[0130] Example 9

[0131] The expression efficiency of the vector pTT5-MAR-CHP obtained in Preparation Example 1 was tested using the anti-EGFR monoclonal antibody as the antibody to be expressed. The specific testing steps were the same as those in Example 6.

[0132] Comparative Example 9

[0133] The expression efficiency of the vector pTT5 was tested using the anti-EGFR monoclonal antibody as the antibody to be expressed. The specific test steps were the same as those in Example 6.

[0134] Depend on Figure 2 The statistical results show that the antibody expression level of the vector provided in Example 9 is nearly 3 times higher than that of the vector pTT5 under the same conditions.

[0135] Example 10

[0136] The expression efficiency of the vector pTT5-MAR-CHP obtained in Preparation Example 1 was tested using the anti-TNFα monoclonal antibody as the antibody to be expressed. The specific test steps were the same as those in Example 6.

[0137] Comparative Example 10

[0138] The expression efficiency of the vector pTT5 was tested using the anti-TNFα monoclonal antibody as the antibody to be expressed. The specific test steps were the same as those in Example 6.

[0139] Depend on Figure 2 The statistical results show that the antibody expression level of the vector provided in Example 10 is nearly 2 times higher than that of the vector pTT5 under the same conditions.

[0140] Example 11

[0141] The expression efficiency of the vector pTT5-MAR-CHP obtained in Preparation Example 1 was tested using the anti-HER2 monoclonal antibody as the antibody to be expressed. The specific testing steps were the same as those in Example 6.

[0142] Comparative Example 11

[0143] The expression efficiency of the vector pTT5 was tested using the anti-HER2 monoclonal antibody as the antibody to be expressed. The specific test steps were the same as those in Example 6.

[0144] Depend on Figure 2The statistical results show that the expression level of the vector antibody provided in Example 11 is 6 g / L, and the antibody product of Comparative Example 11 is 2.3 g / L.

[0145] Note: Figure 2 The middle optimization refers to the vector pTT5, and the optimization refers to the vector pTT5-MAR-CHP.

[0146] It should be noted that, in this document, relational terms such as first and second, etc., are used only to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any actual relationship or order between these entities or operations. Moreover, the terms "comprises," "comprising," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that includes a list of elements includes not only those elements but also other elements not explicitly listed, or elements inherent to such process, method, article, or apparatus.

[0147] While embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions, and variations may be made to these embodiments without departing from the principles and spirit of the invention, and that the scope of the invention is defined by the appended claims and their equivalents.

Claims

1. A method for constructing an improved antibody expression vector, characterized in that: The following steps are involved: Step 1: Design and synthesize a composite hybrid promoter. The structure of the composite hybrid promoter is 5'-[CMV enhancer]-[SV40 enhancer]-[GC-rich sequence]--[hEF-1α promoter]-3'. The sequence information of the composite hybrid promoter is recorded as SEQ ID NO:

1. Step 2: Transform the vector pTT5 to obtain the vector pTT5-MAR; Step 3: Insert the composite hybrid promoter into the pTT5-MAR backbone through homologous recombination to obtain the pTT5-MAR-CHP vector; Step 4: Add the vector pTT5-MAR-CHP to the competent cells DH5α and confirm the correct construction of the final expression vector by sequencing.

2. The method for constructing an improved antibody expression vector according to claim 1, characterized in that: Step 2: The specific steps are as follows: β-interferon MAR sequence was synthesized by gene synthesis; Design primers to amplify the NeoR / Kan resistance gene sequence from the pEGFP-C1 vector; Using homologous recombination, the interferon-β MAR sequence and the NeoR / Kan resistance gene sequence were inserted into the vector pTT5 to obtain the vector pTT5-MAR.

3. The method for constructing an improved antibody expression vector according to claim 1, characterized in that: Step 1: First, the CMV enhancer, SV40 enhancer and hEF1-α promoter sequences were synthesized by PCR, and the GC-rich sequence was synthesized by gene synthesis; using the overlap extension PCR method, the CMV enhancer, SV40 enhancer, hEF1-α promoter and GC-rich sequence were connected in sequence to obtain a composite hybrid promoter.

4. The method for constructing an improved antibody expression vector according to claim 3, wherein: The sequence information of the CMV enhancer is recorded as SEQ ID NO: 2, the sequence information of the SV40 enhancer is recorded as SEQ ID NO: 3, the sequence information of GC-rich is recorded as SEQ ID NO: 4, and the sequence information of the hEF1-α promoter is recorded as SEQ ID NO:

5.

5. The method for constructing an improved antibody expression vector according to claim 1 or 2, characterized in that: The specific steps for obtaining the vector pTT5-MAR in step 2 are as follows: Using a homologous recombination kit, add the vector pTT5, β-interferon MAR sequence, NeoR / Kan resistance gene sequence, and the recombinase mixture in the homologous recombination kit into a sterile centrifuge tube. Pipette 5 to 10 times, then place the reaction solution in a 50°C water bath for 15 to 60 minutes. Then take out the reaction solution and place it on ice for 5 minutes. Use it to transform competent cells DH5α, and finally extract the plasmid. The final expression vector construction is confirmed to be correct by sequencing and named pTT5-MAR.

6. The method for constructing an improved antibody expression vector according to claim 1, characterized in that: The specific operations of step 3 are as follows: Using a homologous recombination kit, add the vector pTT5-MAR, a composite hybrid promoter, the enzymes in the homologous recombination kit, and the buffer to a sterile centrifuge tube. Pipette up and down 5 to 10 times and place the reaction solution in a 50°C water bath for 15 to 60 minutes. Remove the reaction solution and place it on ice for transformation into competent DH5α cells. Extract the plasmid and confirm that the final expression vector is correctly constructed by sequencing.

7. The method for constructing an improved antibody expression vector according to claim 1, characterized in that: Step 4: The vector pTT5-MAR-CHP was added to the competent cells DH5α, mixed, placed on ice for 30 minutes, heat-shocked in a 42°C water bath for 90 seconds, and placed on ice for 2 minutes. Then, LB liquid medium without resistance was added to the bacterial solution, and the culture was revived at 37°C and 220 rpm for 45 minutes. The bacterial solution was evenly spread on the LB solid medium with the corresponding resistance, and incubated upside down at 37°C for 12 to 16 hours. A single clone was picked and placed in 3 mL LB liquid medium containing the corresponding antibiotic, and cultured at 37°C and 220 rpm for 12 to 16 hours. The plasmid was extracted, and the correct construction of the final expression vector was confirmed by sequencing.

8. The method for constructing an improved antibody expression vector according to claim 7, characterized in that: The volume ratio of vector pTT5-MAR-CHP, competent cells DH5α and resistance-free LB liquid culture medium is 1:10:

40.

9. An improved antibody expression vector, characterized in that: Obtained by the construction method according to any one of claims 1 to 8.

10. Use of the improved antibody expression vector according to claim 9 in the expression of monoclonal antibodies, bispecific antibodies or polyclonal antibodies.