Application of rice gene GL6.1 in grain shape and yield breeding

Abstract

The invention discloses application of a rice gene GL6.1 in grain shape and yield breeding, and belongs to the technical field of plant gene breeding application. According to the invention, a new gene GL6.1 for regulating and controlling the grain length of rice is cloned by utilizing a natural variation group. GL6.1 is knocked out by using a CRISPR / Cas9 technology, so that rice grains are remarkably lengthened, and the thousand grain weight is remarkably increased; overexpression of the GL6.1 results in significant shortening of rice grains. The action mechanism of the GL6.1 is further elaborated, cloning and functional research of the gene are beneficial to further understanding of the molecular mechanism of rice grain shape gene regulation and control, the gene can be directly applied to production practice, good gene resources and design elements are provided for molecular design breeding of rice grain shapes, and the gene has high application value in breeding.

Description

Technical Field

[0001] The present invention relates to the technical field of plant gene breeding applications, and in particular to the application of rice gene GL6.1 in grain shape and yield breeding. Background Art

[0002] Rice is one of the world's major food crops, serving as a staple food for over half of the world's population. Increasing rice yield is crucial for global food security. The three key components of rice yield are the number of panicles per plant, the number of grains per panicle, and grain weight. Therefore, improving grain length and weight, without compromising the number of grains per panicle or the number of effective panicles, is crucial for increasing rice yield. Numerous QTLs regulating grain shape have been discovered, but only a few have been cloned using forward genetics, including GW2, GS2, GS3, LGY3, GW5, GL6, GW7, GW8, GS9, GW10, and GL10. The currently cloned grain shape genes primarily participate in regulatory pathways including transcription factor pathways, G protein pathways, ubiquitin-proteasome pathways, plant hormone pathways, and MAPK pathways.

[0003] CC-NBS-LRR proteins are a type of resistance gene R gene, consisting of three main domains: the CC (coil-coil) domain, the NBS (nucleotide-binding site) domain, and the LRR (leucine-rich repeat) domain. This family plays a key role in pathogen resistance, primarily involved in biotic and abiotic stresses. Among them, BPH1 and BPH14 are involved in rice resistance to brown planthoppers, while pid4, pi64, and pijx are involved in regulating rice blast resistance. However, their application in rice yield traits has been rarely reported.

[0004] Using natural variation to locate and clone rice grain shape genes helps enrich the rice grain shape regulatory network, provides good genetic resources and design elements for rice molecular design breeding, and has important application value for improving and cultivating new rice varieties. Summary of the Invention

[0005] The present invention aims to overcome the shortcomings and deficiencies of the prior art and provides a method for the application of a rice gene allele, GL6.1. The present invention discovered that this allele, derived from a donor of American jasmine rice, elongates rice grains. Further research has shown that knocking out the GL6.1 gene through gene editing can lengthen rice grains, while overexpressing the gene shortens them. The present invention can be used to target the superior GL6.1 allele for improved rice varieties, thereby increasing rice yield.

[0006] The purpose of the present invention is achieved through the following technical solutions:

[0007] Applications of rice grain length gene GL6.1 alleles, including allele NIL-GL6.1, whose CDS sequence is shown in SEQ.ID NO: 1; and allele NIL-gl6.1, whose CDS sequence is shown in SEQ.ID NO: 2; the amino acid sequence encoded by allele NIL-GL6.1 is shown in SEQ.ID NO: 3; and the amino acid sequence encoded by allele NIL-gl6.1 is shown in SEQ.ID NO: 4; the application is any one or more of the following applications:

[0008] A. Application in regulating rice grain length;

[0009] B. Application in regulating rice thousand-grain weight;

[0010] C. Application in regulating rice yield;

[0011] D. Application in the cultivation of transgenic rice;

[0012] E. Application in rice grain shape improvement breeding.

[0013] The GL6.1 gene is located on rice chromosome 6, with the gene locus number Os06g0125000 (RAP-DB accession number). Its full-length genomic sequence is 6262bp, including a 5' untranslated region (5'UTR), two exons, four introns, and a 3' untranslated region (3'UTR).

[0014] Furthermore, the application A includes: 1) application of overexpression of the allele NIL-GL6.1 in reducing rice grain length, and / or, 2) application of knockout of the allele NIL-GL6.1 in increasing rice grain length.

[0015] Furthermore, the application B includes: 1) application of overexpression of the allele NIL-GL6.1 in reducing the 1000-grain weight of rice, and / or, 2) application of knockout of the allele NIL-GL6.1 in increasing the 1000-grain weight of rice.

[0016] Furthermore, the application C includes: application of the knockout allele NIL-GL6.1 in increasing rice yield.

[0017] Furthermore, the application D includes: 1) knocking out the allele NIL-GL6.1 in rice to obtain transgenic rice with improved quality and yield, and / or, 2) polymerizing the allele NIL-gl6.1 with materials carrying cloned grain shape genes to obtain a polymer line with improved quality and yield.

[0018] Furthermore, the application E comprises: knocking out the allele NIL-GL6.1 in rice to cultivate transgenic rice with improved grain shape.

[0019] Furthermore, the breeding methods include but are not limited to transgenic, hybridization, backcrossing, selfing or asexual reproduction.

[0020] Furthermore, the overexpression is achieved through an overexpression vector or a host bacteria containing the same.

[0021] Furthermore, the overexpression vector includes pMDC43.

[0022] Furthermore, the knockout is achieved through a CRISPR / Cas9 gene editing vector or a host bacteria containing the same.

[0023] Furthermore, the CRISPR / Cas9 gene editing vector includes pC1300-UBI-CAS9.

[0024] Furthermore, the host bacteria includes Agrobacterium EHA105.

[0025] Furthermore, the target sequence of the CRISPR / Cas9 gene editing vector is: 5'-GCATGGCGAGGTCCATGCTG-3'.

[0026] The present invention uses a single segment material of the donor parent derived from American Jasmine Rice as a basis, and found that the segment contains a QTL (quantitative trait locus) that controls grain length and does not affect other agronomic traits. While increasing yield, it also improves the appearance quality of rice. After multiple generations of backcrossing and selfing with the recipient parent HJX74 (Huajingxian 74), near-isogenic lines NIL-GL6.1 (HJX74) and NIL-gl6.1 (American Jasmine Rice) with purer backgrounds were developed. Using the technique of map-based cloning, a candidate gene Os06g0125000 was cloned. Genomic sequence analysis found that the gene in the NIL-gl6.1 material had 59 SNP mutations and 3 Indel mutations in the CDS region ( Figure 1 and Table 1). Knockout of GL6.1 in the NIL-GL6.1 background significantly increased rice grain length and 1000-grain weight; overexpression of GL6.1 in the NIL-GL6.1 background resulted in a significant decrease in rice grain length ( Figure 2 When NIL-gl6.1 was polymerized with materials carrying cloned grain shape genes, the grain length and 1000-grain weight of the polymerized line were significantly improved compared to the parent line ( Figure 3 These results suggest that GL6.1 is involved in the regulation of rice grain length, which not only increases yield but also improves the appearance quality of rice. Furthermore, superior alleles can be used to improve rice varieties to enhance both yield and quality.

[0027] The present invention has the following advantages and effects compared to the prior art:

[0028] The method of the present invention uses a map-based cloning method to clone a new grain length gene GL6.1 from a natural variation population. This gene is involved in the regulation of rice grain length. Plants with GL6.1 knockout exhibit longer grains, while plants with GL6.1 overexpression exhibit shorter grains.

[0029] The present invention utilizes the superior allele NIL-gl6.1 to polymerize with materials carrying cloned major effect grain shape genes, and the grain length and weight of the polymerized materials are significantly increased.

[0030] The present invention further understands the mechanism of action of GL6.1. The cloning and functional research of this gene helps to further understand the molecular mechanism of rice grain shape gene regulation and can be directly applied to production practice, providing a good material basis for molecular design breeding of rice grain shape and having great application value in breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 The results of the positional cloning of GL6.1 are shown. Note: (AB) Grain shape images of NIL-GL6.1 and NIL-gl6.1, scale bar is 1 cm; (C) Plant shape images of NIL-GL6.1 and NIL-gl6.1, scale bar is 10 cm; (DE) Spread ear shape images and straight ear shape images of NIL-GL6.1 and NIL-gl6.1, scale bar is 3 cm; (F) Chalkiness image of NIL-GL6.1 and NIL-gl6.1, scale bar is 1 cm;

[0032] Figure 2 The figures are grain shape images of transgenic GL6.1. Note: (AB) Grain shape images of GL6.1 knockout and overexpression lines, scale is 1 cm; (CF) Bar graphs of grain length, grain width, aspect ratio, and 1000-grain weight of GL6.1 knockout and overexpression lines; different letters indicate significance < 0.01, and NS indicates no significant difference.

[0033] Figure 3 These are the grain shape diagrams of NIL-gl6.1 and different rice material aggregates; Note: (A) Grain length phenotype diagram, scale is 1 cm; (BI) Bar graph of grain length, grain width, aspect ratio and 1000-grain weight of different aggregates; different letters above indicate significance <0.01. DETAILED DESCRIPTION

[0034] The various raw materials and equipment used in the present invention are all conventional commercially available products and can be directly purchased from the market. The primer sequences used are all synthesized by Sangon Biotech Co., Ltd.

[0035] The single segment materials from the donor American jasmine rice involved in the following examples were provided by the Guangdong Key Laboratory of Plant Molecular Breeding.

[0036] The gene editing vector pC1300-UBI-CAS9 involved in the following examples has been disclosed in the document “Hu X, Meng X, Liu Q, et al. Increasing the efficiency of CRISPR-Cas9-VQR precise genome editing in rice[J]. Plant Biotechnology Journal, 2018, 16(1). DOI: 10.1111 / pbi.12771.”

[0037] The overexpression vector pMDC43 involved in the following examples has been disclosed in the document "Luojiang H, Kai H, Ran X, et al. The LARGE2-APO1 / APO2 regulatory module controls panicle size and grain number in rice[J]. The Plant Cell, 2021. DOI: 10.1093 / plcell / koab041."

[0038] Example 1

[0039] Using a single-segment substitution line derived from American jasmine rice as the donor, we identified a QTL regulating grain length through marker-assisted selection, which increases grain length without altering other agronomic traits. We further cloned the candidate gene, Os06g0125000, through map-based cloning. Whole-genome sequencing of NIL-GL6.1 and NIL-gl6.1 revealed 21 variants in the promoter and 62 variants in the CDS. Figure 1 and Table 1 ).

[0040] The primer sequences used include:

[0041] Y1-F:5'-TGATATGTCATCGACTCATCGG-3'

[0042] Y1-R:5'-CCATGAGAAAAGTTGTCCCA-3'

[0043] Y2-F:5'-ATGTGCACACATATGCGTCATC-3'

[0044] Y2-R:5'-ATAACTTGGCCTTGTTGAGA-3'

[0045] <h2 style=";text-align:left;direction:ltr">Y3-F:5'-AAAGTGAACTTATTCCATGTCG-3'<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0046] <h2 style=";text-align:left;direction:ltr"> Y3-R:5'-TCCTAAATCTTGTTGCAATGC-3'<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0047] <h2 style=";text-align:left;direction:ltr"> Y4-F:5'-TTTAGAACGCAGTTACAAAGG-3'<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0048] <h2 style=";text-align:left;direction:ltr"> Y4-R:5'-CTTGTTGATTTGTTACACGTGC-3'<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0049] <h2 style=";text-align:left;direction:ltr"> Y5-F:5'-TTTATGATTGTTCTCTGGGG-3'<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0050] <h2 style=";text-align:left;direction:ltr"> Y5-R:5'-ATGTTCTCGAGTCCTAATCG-3'<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0051] <h2 style=";text-align:left;direction:ltr"> Y6-F:5'-TTAACACTGTTTCCGACCG-3'<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0052] <h2 style=";text-align:left;direction:ltr"> Y6-R:5'-CACTAGAGGTGAAAACTGTTGG-3'<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0053] <h2 style=";text-align:left;direction:ltr"> Y7-F:5'-GAAGGTGATCTTCTTCCTGG-3'<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0054] <h2 style=";text-align:left;direction:ltr"> Y7-R:5'-CTCCACATCGAGGTCATCC-3'<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0055] <h2 style=";text-align:left;direction:ltr"> Y8-F:5'-GAAGAGAACATGGTGCTCAA-3'<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0056] <h2 style=";text-align:left;direction:ltr"> Y8-R:5'-ACATGCCGTCCAAGATGAG-3'<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0057] <h2 style=";text-align:left;direction:ltr"> Y9-F:5'-ATCAGGGTTACGTTTTATGG-3'<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0058] <h2 style=";text-align:left;direction:ltr"> Y9-R:5'-TGAATTGGAGTCAGTAGTTGG-3'<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0059] <h2 style=";text-align:left;direction:ltr"> Y10-F:5'-GGTCGTCTACTACCGCTTTCT-3'<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0060] <h2 style=";text-align:left;direction:ltr"> Y10-R:5'-TAACGGCAGGTTGGTTCT-3'<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0061] <h2 style=";text-align:left;direction:ltr"> Y11-F:5'-TCCCACAGTTCAGTCACAT-3'<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr">

[0062] Y11-R:5'-CGGGTCGGACTTACTTTTAT-3'

[0063] Y12-F:5'-CATCGATTAGCTTACATGGCAACG-3'

[0064] Y12-R:5'-ACTAGTGCGACCGTCTTCAATGG-3'

[0065] Y13-F:5'-CTACGACTCCAGTTGCTATCC-3'

[0066] Y13-R:5'-CGGTTGTGTTTAGTTTGTTACC-3'

[0067] Y14-F:5'-CCAGCTGCTTGTGATCAAGTCG-3'

[0068] Y14-R:5'-TGCTAGTGCATGCCAATACTACTGC-3'

[0069] Y15-F:5'-TGCCTCTCTACCGCAACACAGC-3'

[0070] Y15-R:5'-CCCTTCCCTTACCTCTCCATTCC-3'

[0071] Y17-F:5'-TGTCTGCTGGAGTACAAGTG-3'

[0072] Y17-R:5'-ACAATGAAGCACCAAAGG-3'

[0073] Y18-F:5'-CTACATCCCCGGCGTATTA-3'

[0074] Y18-R:5'-CGTGAGTCGTTGTAACTTTGA-3'

[0075] Y19-F:5'-GGTGGATAGTAGAGGAGGTTG-3'

[0076] Y19-R:5'-CCTCCAAAACGATTGAGC-3'

[0077] GL6.1-1-F:5'-CTTATATTGTGGGATGGATGG-3'

[0078] GL6.1-1-R:5'-GGCGATCTTTGAGATTCATC-3'

[0079] GL6.1-2-F:5'-AGAAAAGTACGCCGAGTCAC-3'

[0080] GL6.1-2-R:5'-TCCCAATAGAGCTTGGAAGT-3'

[0081] GL6.1-3-F:5'-CCATTAGTGATGTCGGAGAA-3'

[0082] GL6.1-3-R:5'-ACATGAGCAGTGGTGGTATT-3'

[0083] GL6.1-Pro-F:5'-GCTTAGTATTAAGTTAACATG-3'

[0084] GL6.1-Pro-R:5'-ATTAATTGGGGAGTGGGTAG-3'

[0085] Table 1 Allelic variation of GL6.1 in NIL-GL6.1 and NIL-gl6.1

[0086]

[0087]

[0088]

[0089] Example 2: Construction of GL6.1 transgenic plants

[0090] 1. Construction of knockout vectors and overexpression vectors

[0091] (1) The method for constructing the knockout vector for knocking out the GL6.1 gene is as follows:

[0092] PCR amplification was performed using pC1300-UBI-CAS9 as a template and primers gRNA-F1 and GL6.1-R1, and GL6.1-F2 and gRNA-R2, to generate the PCR amplification products pC1300-gRNA-GL6.1-N and pC1300-gRNA-GL6.1-C, respectively. PCR amplification was performed using pC1300-gRNA-GL6.1-N and pC1300-gRNA-GL6.1-C as templates and primers gRNA-F1 and gRNA-R2 to generate the PCR amplification product pC1300-gRNA-GL6.1. The pC1300-UBI-CAS9 plasmid was digested with the Acc65 I restriction endonuclease, and the digestion product was recovered from a gel to obtain the linearized pC1300-UBI-CAS9 plasmid. The pC1300-gRNA-GL6.1 sequence was ligated with the linearized pC1300-UBI-CAS9 plasmid using a homologous recombination kit (Beijing Biomed Gene Technology Co., Ltd., CL116-01) to generate the recombinant vector pC1300-UBI-CAS9-GL6.1 for subsequent rice genetic transformation.

[0093] The sequences of the primers are:

[0094] The sequences of gRNA-F1 and gRNA-R2 are as follows:

[0095] GRNA-F1: 5'-TGATTACGAATTCGAGCTCGGTACCAAGGAATCTTTAAACATACG-3'

[0096] GRNA-R2: 5'-TCAGGTCGACGGATCCTTGGTACCTCTAGACTCGAGGATTATGTG-3'

[0097] The sequences of GL6.1-R1 and GL6.1-F2 are as follows:

[0098] GL6.1-F2:5'- GCATGGCGAGGTCCATGCTG GTTTTAGAGCTAGAAATAGC-3'

[0099] GL6.1-R1:5'- CAGCATGGACCTCGCCATGC TGCCACGGATCATCTGCACAAC-3'

[0100] (2) The method for constructing the overexpression vector used in the overexpression material is as follows:

[0101] The cDNA of Huajingxian 74 was used as a template for amplification, and the amplified product was ligated with the pMDC43 vector double-digested with SacI and AscI to obtain the overexpression vector for subsequent rice genetic transformation.

[0102] The primer sequences used for amplification are:

[0103] OE-GL6.1-F:5'-ATGGATGAACTATACAAAGGC ATGGCGGAGACGGCGCTGAG -3'

[0104] OE-GL6.1-R: 5'-TGAACGATCGGGGAAATTCGAGCTC TCACTTGCCAGAGCTCTCT -3'.

[0105] 2. Rice genetic transformation

[0106] (1) Induction and culture of rice callus: Mature Huajingxian 74 rice seeds were shelled and sterilized in 70% alcohol for 3 min. The seeds were then transferred to a 30% sodium hypochlorite solution and soaked for 45 min. The sodium hypochlorite solution was rinsed with sterile water and the seeds were evenly sown on N6D medium to induce callus. Callus grew in about 20 days and was subcultured to NB medium. The callus was subcultured every two weeks, and callus with better color was selected each time.

[0107] (2) Agrobacterium culture: The constructed plasmid vector was transformed into Agrobacterium tumefaciens EHA105 strain, spread on LB medium containing 50 mg / L kanamycin and 25 mg / L rifampicin, and cultured at 28°C for 2 days. Single colonies were picked for colony PCR to identify positive strains. The positive strains were transferred to LB liquid medium and cultured overnight at 28°C and 200 rpm. 500 μl of the cells were inoculated into 50 ml of AAM liquid co-culture medium and suspended to an OD600 of 0.5-0.6 for rice material transformation.

[0108] (3) Co-cultivation of rice callus and Agrobacterium: Transfer the rice callus pre-cultured for 4 days to a 100 ml conical flask, pour in the resuspension in step 2, let it stand at room temperature for 20 minutes, gently remove the callus, absorb the remaining bacterial solution on sterile filter paper, and then transfer it to sterile filter paper soaked with AAM, and culture it in the dark at 25°C for 2-3 days;

[0109] (4) Screening of resistant callus and plant regeneration: After co-cultivation, the callus was transferred to a selection medium containing 50 mg / L kanamycin and hygromycin for screening culture. After the first round of screening, the callus was transferred to a second round of selection medium for further screening for 2 weeks. Then, the vigorously growing resistant callus was transferred to a differentiation medium. The regenerated seedlings were rooted and grown on 1 / 2 MS. When they grew to 10 cm, they were moved out of the greenhouse.

[0110] (5) Identification of positive plants: Extract the total DNA of transgenic rice, use DNA as a template, design specific primers based on the tag gene of the vector and our target gene for PCR amplification, and judge the positive transgenic plants based on the amplified bands and sequencing, and set up positive and negative controls.

[0111] The results are as follows Figure 2 As shown in the data, knocking out GL6.1 in the Huajingxian 74 background significantly lengthened the rice grain length and increased the 1000-grain weight; overexpressing GL6.1 in the Huajingxian 74 background resulted in a significant shortening of the rice grain length.

[0112] Example 3: Aggregation Application of GL6.1

[0113] Field hybridization: 1. Sampling of female parents: NIL-gs3 and NIL-gw8 (Table 2) were selected as female parents (all of the above materials were derived from the single-segment substitution line (SSSL) library, which has been published in the document "Zhang Guiquan. A rice breeding platform based on the SSSL library [J]. Heredity, 2019, 41(8)"). Select unflowered glume, cut off 1 / 2 of the glume, spray water to make the anther absorb water and burst, remove the anther, and be careful not to damage the stigma. 2. Pollination: Cut the panicle of the male parent NIL-gl6.1, remove the glume that has already flowered, fill with CO2 gas to promote flowering, place the flowering male parent spikelet on the female parent, shake the panicle to make the pollen fall evenly on the female parent stigma, seal the pollination bag, and record the material number. 3. The obtained true hybrids were grown in the field and developed to the F2 generation. The genotypes were identified using polymorphic markers and homozygous polymeric materials were obtained for grain shape phenotype investigation ( Figure 3 ).

[0114] Table 2 Single segment substitution line materials carrying grain shape genes

[0115]

[0116] Note: Materials provided by Guangdong Key Laboratory of Plant Molecular Breeding

[0117] The sequences of the primers are:

[0118] NIL-gs3-F:5'-GGCCTCCGTCCACCTTTT-3'

[0119] NIL-gs3-R:5'-CCTGAGCTACCTGTCATTCC-3'

[0120] NIL-gw8-F:5'-GCCAGCCAAGAAAAGCGACA-3'

[0121] NIL-gw8-R:5'-TCTTGAGATCCCACTCCATG-3'.

[0122] The results are as follows Figure 3 As shown, when NIL-gl6.1 was polymerized with materials carrying cloned grain shape genes, the grain length and 1000-grain weight of the polymerized line were significantly improved compared with the parents.

[0123] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. Application of the rice grain length gene GL6.1 allele, characterized by: The alleles include the allele NIL-GL6.1, whose CDS sequence is shown in SEQ ID NO: 1; and the allele NIL-gl6.1, whose CDS sequence is shown in SEQ ID NO: 2; and the application is any one or more of the following applications: A. Application in regulating rice grain length; B. Application in regulating rice thousand-grain weight; C. Application in regulating rice yield; D. Application in the cultivation of transgenic rice; E. Application in rice grain shape improvement breeding.

2. The use of the rice grain length gene GL6.1 allele according to claim 1, characterized in that: Application A includes: 1) using the overexpression allele NIL-GL6.1 to reduce rice grain length, and / or, 2) using the knockout allele NIL-GL6.1 to increase rice grain length.

3. The use of the rice grain length gene GL6.1 allele according to claim 1, characterized in that: Application B includes: 1) use of the overexpression allele NIL-GL6.1 in reducing the thousand-grain weight of rice, and / or, 2) use of the knockout allele NIL-GL6.1 in increasing the thousand-grain weight of rice.

4. The use of the rice grain length gene GL6.1 allele according to claim 1, characterized in that: Application C includes: application of the knockout allele NIL-GL6.1 in increasing rice yield.

5. The use of the rice grain length gene GL6.1 allele according to claim 1, characterized in that: Application D includes: 1) knocking out the allele NIL-GL6.1 in rice to obtain transgenic rice with improved quality and yield, and / or, 2) polymerizing the allele NIL-gl6.1 with materials carrying cloned grain shape genes to obtain a polymer line with improved quality and yield.

6. The use of the rice grain length gene GL6.1 allele according to claim 1, characterized in that: Application E includes: knocking out the allele NIL-GL6.1 in rice to cultivate transgenic rice with improved grain shape.

7. Use of the rice grain length gene GL6.1 allele according to any one of claims 1 to 6, characterized in that: The breeding methods include transgenic, hybridization, backcrossing, self-pollination or asexual reproduction.

8. The use of the rice grain length gene GL6.1 allele according to claim 2 or 3, characterized in that: The overexpression is achieved by an overexpression vector or a host bacteria containing the same; The overexpression vector includes pMDC43.

9. Use of the rice grain length gene GL6.1 allele according to any one of claims 2 to 6, characterized in that: The knockout is achieved by a CRISPR / Cas9 gene editing vector or a host bacteria containing the same; The CRISPR / Cas9 gene editing vector includes pC1300-UBI-CAS9; The host bacteria include Agrobacterium EHA105.

10. The use of the rice grain length gene GL6.1 allele according to claim 9, characterized in that: The target sequence of the CRISPR / Cas9 gene editing vector is: 5'-GCATGGCGAGGTCCATGCTG-3'.

Images