Method for synergistically improving lycopene content and sugar-acid ratio in tomato fruits

Abstract

The invention discloses a method for synergistically improving the lycopene content and the sugar-acid ratio in tomato fruits, belongs to the technical field of biology, and particularly relates to a method for knocking out or silencing an INVINH1 gene to synergistically improve the lycopene content and the sugar-acid ratio in the tomato fruits, and a nucleotide sequence of a protein coding region of the INVINH1 gene is shown as SEQ ID NO.1. The invention further discloses a method for synergistically improving the lycopene content and the sugar-acid ratio in the tomato fruits. A carrier for knocking out or silencing the INVINH1 gene is constructed by utilizing a CRISPR / Cas9 gene editing technology, the carrier is transferred into tomato cotyledons through agrobacterium tumefaciens mediation, INVINH1 gene knockout homozygous strains invinh1-1 and invinh1-2 are obtained through screening by utilizing a tissue culture technology, the lycopene content and saccharic acid in tomato fruits of a mutant plant are remarkably improved compared with those of wild plants, and the gene knockout or silencing method is suitable for industrial production. The invention provides an important gene resource for cultivating tomato varieties for synergistically improving lycopene and sugar-acid ratio.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a method for synergistically increasing the lycopene content and sugar-acid ratio in tomato fruits. Background Art

[0002] Tomatoes, a member of the Solanaceae family, are both a fresh vegetable and a processing ingredient, enjoying widespread cultivation and a significant market share. Their delicious flavor and rich nutritional profile make them a popular choice among consumers. However, global climate change, frequent extreme weather events, adverse environmental conditions, and the resulting pests and diseases have severely impacted tomato production and cultivation, leading to deteriorating fruit quality. Furthermore, the facility tomato industry, primarily based in solar greenhouses and plastic sheds, suffers from poor environmental controllability, leading to reduced yields and reduced quality. This significantly limits the nutritional value and market competitiveness of these tomato plants.

[0003] Nowadays, with the deepening of health awareness and the improvement of living standards, consumers' demand for the quality of fruit and vegetable products has evolved from a single sensory experience to nutritional functionality. Tomatoes are a nutritious food, rich in various vitamins and minerals, as well as various plant compounds such as lycopene. Lycopene is an antioxidant that has functions such as preventing cardiovascular disease, fighting cancer, delaying aging, and reducing inflammation. Lycopene is also one of the strongest antioxidants currently found in nature, with an antioxidant effect 2 to 3.2 times that of beta-carotene and 100 times that of vitamin E. Today, lycopene content has become a prominent indicator in consumer decision-making, and increasing lycopene content is a core demand in the current tomato market.

[0004] Furthermore, the sugar-acid ratio of tomato fruit is a key factor influencing its palatability. This ratio refers to the ratio of soluble sugars to organic acids in the fruit, and it significantly impacts the flavor quality of tomatoes. Soluble sugars primarily include fructose, glucose, and sucrose, which are the main sugars influencing tomato sweetness, with fructose having the highest sweetness, followed by glucose, and sucrose the lowest. Soluble acids primarily include citric acid, malic acid, and trace amounts of oxalic acid, succinic acid, and tartaric acid. Citric acid has a strong sour flavor, while malic acid can enhance the human oral perception of sweetness. Citric and malic acids are the two most predominant organic acids in tomato fruit, accounting for approximately 80% of the total acid content. High sugar content and appropriate acidity create a suitable sugar-acid ratio, which significantly improves the sensory quality of tomatoes. It is generally believed that the appropriate sugar-acid ratio is 6.9 to 10.8 (Cheng Yuan et al., Comparative analysis of flavor quality-related indicators of 16 cherry tomato varieties, Journal of Zhejiang Agricultural Sciences, 2018, 30(11): 1859-1869). The sugar-acid ratio of most tomato fruits is estimated to be between 4 and 12.2, but in actual production, factors such as the growth environment and storage conditions often lead to a decrease in the sugar-acid ratio, resulting in poor tomato palatability. Therefore, synergistically increasing the lycopene content and sugar-acid ratio in tomato fruits is an effective way to simultaneously optimize tomato fruit quality and palatability, which is of great significance to the tomato industry.

[0005] Developing superior tomato varieties that significantly enhance their nutritional and flavorful qualities is a key approach to achieving sustainable agricultural development. For example, Chinese patent publication CN104004768A discloses a kiwifruit gene that can improve the nutritional quality of tomato fruit. The corresponding kiwifruit gene was cloned into a eukaryotic expression vector to generate a plasmid containing the kiwifruit gene sequence. This plasmid was then transformed with Agrobacterium tumefaciens and infected with tomato callus. The resulting transgenic plants exhibited significantly higher sugar, lycopene, β-carotene, and chlorophyll contents than wild-type tomato fruit. However, no studies have reported simultaneously increasing both lycopene content and the sugar-to-acid ratio in tomato fruit through non-GMO methods.

[0006] INVINH (invertase inhibitor) is a type of cell wall sucrose invertase inhibitor. Studies have reported that silencing the INVINH1 gene in tomatoes using RNAi can lead to increased seed size and delayed leaf senescence. Other studies have also found that the INVINH1 gene plays a key role in cold tolerance in tomatoes. Currently, no research reports clearly demonstrate the role of the INVINH1 gene in synergistically increasing lycopene content and sugar-to-acid ratio. Summary of the Invention

[0007] In order to improve the quality of tomato fruits and synergistically increase the lycopene content and sugar-acid ratio in tomato fruits, the present invention provides a method for synergistically increasing the lycopene content and sugar-acid ratio in tomato fruits by using the INVINH1 gene, so as to provide a basis for breeding tomato varieties with high lycopene and high sugar-acid ratio.

[0008] The specific technical solutions adopted are as follows:

[0009] The present invention provides an application of the INVINH1 gene in synergistically improving the lycopene content and sugar-acid ratio in tomato fruits. The nucleotide sequence of the protein coding region of the INVINH1 gene is shown in SEQ ID NO.1, the protein coding region is 516 bp in length, and the full gene DNA sequence is shown in SEQ ID NO.3.

[0010] The present invention also provides the use of a protein encoded by the INVINH1 gene in synergistically increasing the lycopene content and sugar-acid ratio in tomato fruit. The protein encoded by the INVINH1 gene is a protein located in the cell wall and is responsible for inhibiting the activity of cell wall sucrose invertase. It is composed of 171 amino acids, and the amino acid sequence of the protein encoded by the INVINH1 gene is shown in SEQ ID NO.2.

[0011] The protein encoded by the INVINH1 gene inhibits the activity of cell wall sucrose invertase, thereby reducing the soluble sugar content in storage organs such as fruits, and further leading to problems such as decreased fruit quality. Knocking out the INVINH1 gene can synergistically increase the lycopene content and sugar-acid ratio in tomato fruits by increasing the activity of cell wall sucrose invertase.

[0012] The present invention also provides a method for synergistically increasing the lycopene content and sugar-acid ratio in tomato fruits by utilizing the INVINH1 gene, wherein the lycopene content and sugar-acid ratio in tomato fruits are synergistically increased by knocking out or silencing the INVINH1 gene.

[0013] Specifically, the method of using the INVINH1 gene to synergistically increase the lycopene content and sugar-acid ratio in tomato fruit includes the following steps:

[0014] (1) Construct a vector for knocking out or silencing the INVINH1 gene;

[0015] (2) constructing an Agrobacterium genetically engineered bacterium containing the vector in step (1);

[0016] (3) The genetically engineered Agrobacterium constructed in step (2) is transformed into tomato cotyledons, and a homozygous mutant strain that does not contain exogenous proteins and is stably inherited is obtained through cultivation.

[0017] CRISPR / Cas9 gene editing technology can accurately and specifically identify target sites and obtain gene-edited materials, thereby accurately changing crop traits and quickly obtaining ideal germplasm. Offspring can be self-pollinated to screen strains in which the target gene has been edited and does not contain Cas9, avoiding the need for transgenic technology that requires the introduction of exogenous genes.

[0018] Furthermore, in step (1), the INVINH1 gene was sequenced on the CRISPR-P2.0 website, and a target sequence for gene knockout was selected in the protein coding region of the INVINH1 gene. Primers were designed based on this, and a tRNA plasmid was used as a template and primers were amplified to construct a CRISPR / Cas9 vector for knocking out the INVINH1 gene.

[0019] Furthermore, there are two target sequences for gene knockout, the first target sequence is shown as SEQ ID NO.4, and the second target sequence is shown as SEQ ID NO.5.

[0020] The nucleotide sequence of the upstream primer designed for the first target sequence is shown in SEQ ID NO.6, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.7; the nucleotide sequence of the upstream primer designed for the second target sequence is shown in SEQ ID NO.8, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.9.

[0021] Furthermore, the vector used in step (1) is a CRISPR vector pHEE401 having a Cas9 backbone.

[0022] Preferably, in step (2), the genetically engineered Agrobacterium is Agrobacterium tumefaciens GV3101 strain.

[0023] The present invention also provides the use of the method of utilizing the INVINH1 gene to synergistically increase the lycopene content and sugar-acid ratio in tomato fruits in cultivating tomatoes with high lycopene content and high sugar-acid ratio.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] (1) The present invention uses CRISPR / Cas9 gene editing technology to provide a method for synergistically increasing the lycopene content and sugar-acid ratio in tomato fruits, and obtains transgenic homozygous strains invinh1-1 and invinh1-2 tomatoes with high lycopene and high sugar-acid ratio. It has broad application prospects in the breeding of tomato germplasm with high fruit quality (especially high lycopene and high sugar-acid ratio).

[0026] (2) Compared with the wild type WT, the transgenic tomatoes invinh1-1 and invinh1-2 cultivated by the present invention have significantly increased lycopene content and sugar-acid ratio, indicating that knocking out the INVINH1 gene can synergistically increase the lycopene content and sugar-acid ratio in tomato fruits. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 This is a schematic diagram of the gene editing and protein translation of the two strains invinh1-1 and invinh1-2 obtained after the successful construction of the INVINH1 gene knockout plant in Example 2; among them, invinh1-1 lacks 2 bases compared to the non-gene-edited control and the protein length is only 19 amino acids, and invinh1-2 lacks 4 bases compared to the non-gene-edited control and the protein length is only 21 amino acids.

[0028] Figure 2 These are the fruit phenotypes and color index statistical graphs of the wild-type WT and INVINH1 gene knockout plants invinh1-1 and invinh1-2 in Example 3 8 days after the color breaking period, where A is the fruit phenotype, B is the color index statistical graph, and lowercase letters a and b represent significant differences between different plants at the 5% level.

[0029] Figure 3 The figure shows the statistical graph of lycopene content of the wild-type WT and INVINH1 gene knockout plants invinh1-1 and invinh1-2 in Example 3; lowercase letters a and b represent significant differences at the 5% level.

[0030] Figure 4 Statistical graph of sugar-acid ratios of the wild-type WT and INVINH1 gene knockout plants invinh1-1 and invinh1-2 in Example 4; lowercase letters a, b, and c represent significant differences at the 5% level.

[0031] Figure 5 This is a comparison of the transcription levels of carotenoid synthesis-related genes in the wild-type WT and INVINH1 gene knockout plants invinh1-1 and invinh1-2 in Example 5; lowercase letters a and b represent significant differences at the 5% level. DETAILED DESCRIPTION

[0032] The present invention will be further illustrated below in conjunction with the examples and accompanying drawings. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the invention. The operating methods in the following examples where specific conditions are not specified are generally based on conventional conditions or the conditions recommended by the manufacturer. Contents not described in detail in this specification sheet belong to the prior art known to those skilled in the art. The experimental materials used in the following examples, unless otherwise specified, can be purchased from conventional biochemical reagent companies.

[0033] The tomato variety used in the following examples is the conventional tomato variety CR (Condine Red), and the wild-type tomato plant WT without gene editing is used as a control.

[0034] Example 1 Construction of CRISPR / Cas9 vector containing specific sgRNA

[0035] The sequence of the INVINH1 gene (Solyc12g099200.1) was obtained from the tomato genome database (https: / / solgenomics.net / ). The full gene DNA sequence is shown in SEQ ID NO.3, the nucleotide sequence of its protein coding region is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by the INVINH1 gene is shown in SEQ ID NO.2. First, target sequences for gene knockout were selected within the protein coding region of the INVINH1 gene using the CRISPR-P2.0 website (http: / / crispr.hzau.edu.cn / CRISPR2 / ). The selected target sequences are shown below:

[0036] The first target sequence selected for INVINH1 gene knockout (SEQ ID NO. 4):

[0037] CTATGTTGCTAGTAACAAGT;

[0038] The second target sequence selected for INVINH1 gene knockout (SEQ ID NO.5):

[0039] GCTATGTTGCTAGTAACAAG.

[0040] Next, refer to the pHEE401 CRISPR-Cas9 vector design method to construct a vector for knocking out the INVINH1 gene. Use the primer template and the selected target sequence to design primers, as shown below:

[0041] pHEE401-invinh1 vector construction: Upstream primer designed for the first target sequence (SEQ ID NO.6):

[0042] GGTCTCTATTGAACAAAGCACCAGTGGTCT;

[0043] pHEE401-invinh1 vector construction: Downstream primer designed for the first target sequence (SEQ ID NO.7):

[0044] GGTCTCTACTTGTTACTAGCAACATAGTGCACCAGCCGGGAATCG;

[0045] pHEE401-invinh1 vector construction: Upstream primer designed for the second target sequence (SEQ ID NO.8):

[0046] GGTCTCTAAGTGTTTTAGAGCTAGAAATAGCAAGTTAAAA;

[0047] pHEE401-invinh1 vector construction: Downstream primer designed for the second target sequence (SEQ ID NO.9):

[0048] GGTCTCTAAACCTTGTTACTAGCACATAGCtgcaccagccgggaatcg.

[0049] Using the tRNA plasmid as a template, PCR amplification was performed using the primers designed above and a high-fidelity enzyme at an annealing temperature of 58°C. If the amplified product showed a single, uniform band of the correct size after electrophoresis, it was recovered using a standard DNA purification kit and then adjusted to a concentration of 10 ng / μL using Nanodrop. Only 1 μL of each insert was added to the ligation reaction. The amplified product was ligated to the CRISPR vector pHEE401, which has a Cas9 backbone, and heat-shocked at 42°C for transformation. The plasmid was transformed into a kanamycin-resistant Agrobacterium tumefaciens strain (GV3101) by electroporation, yielding engineered Agrobacterium strains useful for constructing INVINH1 knockout material.

[0050] Example 2 Construction of INVINH1 gene knockout vector and transgenic tomato

[0051] Take an appropriate amount of CR tomato seeds, shake them at 28°C for 6-8 hours, disinfect them with 70% alcohol for 20-30 seconds, and then shake and disinfect them with 10% sodium hypochlorite solution for 15 minutes. Then, sow them into sterilized 1 / 2 MS seeding medium. After 3 days of darkness, place them under normal light. After 7 days, cut the cotyledons and transfer them to KC medium. Use Agrobacterium infection to transform the final plasmid prepared in Example 1 into the cotyledons. Utilizing the totipotency of plant cells, T0 generation gene-edited tomatoes are obtained.

[0052] The tomato genome DNA sequence of a portion of the INVINH1 gene was amplified by PCR and sequenced to test T0 transgenic tomato seedlings. A small amount of tomato leaf tissue was extracted and the whole genome DNA was obtained using Fast Plant DNAzol. The following primers were designed for the INVINH1 gene to test for gene editing:

[0053] Upstream primer for transgenic tomato seedling test (SEQ ID NO.10):

[0054] CACACTATACTCCATACAAA;

[0055] Downstream primer for transgenic tomato seedling test (SEQ ID NO.11):

[0056] GCAGCTTGATTAGCTTTAGA.

[0057] The amplified product was sent to the company for sequencing, and the gene sequence was returned. The wild-type plant WT was used as a control to compare the INVINH1 gene editing in the T0 generation plants. The lines with 4 and 2 bases missing in the INVINH1 gene compared with the wild-type WT plants were selected, and continuously self-pollinated to obtain two homozygous T2 generation lines, invinh1-1 and invinh1-2, both encoding proteins with premature translation termination (such as Figure 1 shown).

[0058] In the following examples, T2 generation plants of the homozygous invinh1-1 and invinh1-2 lines were used as materials for experiments.

[0059] Example 3 Study on lycopene content in tomato fruits of INVINH1 gene knockout homozygous plants

[0060] Tomatoes entering the color-breaking stage were marked. Eight days later, fully ripened tomatoes were harvested, photographed, and their chromaticity index (a) was measured using a colorimeter (the chromaticity index in the figure is specifically the chromaticity index, which describes the hue and saturation of a color, with positive a values ​​indicating red and negative values ​​indicating green). The peel of the tomato fruit was then quickly frozen in liquid nitrogen and ground into a powder for lycopene content determination.

[0061] Lycopene content determination method: Take 0.1 g of ground fruit powder sample, add 350 μL of methanol, 700 μL of chloroform, and 350 μL of double-distilled water, and vortex to mix thoroughly. Centrifuge at 10,000 g at 4°C for 10 min, and collect the chloroform phase. Repeat the addition of 700 μL of chloroform to the remaining pellet, vortex for at least 30 seconds, and then centrifuge at 10,000 rpm at 4°C for 10 min. Combine the collected chloroform phases and blow dry using a nitrogen blower. Add 350 μL of 6% KOH in methanol, vortex to mix thoroughly, and place in a 60°C metal bath in the dark for 30 min. Then add 350 μL of double-distilled water and 700 μL of chloroform, vortex to mix thoroughly, and centrifuge at 10,000 g at 4°C for 10 min. Collect the chloroform phase. Repeat the addition of 700 μL of chloroform to the remaining pellet, vortex for at least 30 seconds, and then centrifuge at 10,000 rpm at 4°C for 10 min. Add 700 μL of water (to remove chlorophyll) to the collected chloroform phase, vortex for 30 seconds, then centrifuge at 10,000 rpm at 4°C for 5-10 minutes. Aspirate the upper aqueous phase. Centrifuge a final time at 10,000 g for 10 minutes at 4°C, collect the chloroform phase, and blow dry using a nitrogen blower. Add 200 μL of a 1:1 mixture of DMSO (dimethyl sulfoxide):isopropanol to reconstitute the solution and vortex. After centrifugation at maximum speed for 10 minutes, aspirate 50 μL of the supernatant and analyze by ultra-performance liquid chromatography (UPLC).

[0062] The results are as follows Figure 2 and Figure 3 As shown, there was no significant difference in fruit size between wild-type WT plants and INVINH1 gene knockout homozygous plants grown under normal conditions, but the mutant tomatoes were significantly redder than wild-type WT; and the results of lycopene content determination also showed that the lycopene content in the fruits of INVINH1 gene knockout homozygous plants was significantly higher than that of wild-type WT.

[0063] Example 4 Study on the sugar-acid ratio of tomato fruit from homozygous INVINH1 gene knockout plants

[0064] The peel of tomato fruit 8 days after the color breaking period was taken, quickly frozen in liquid nitrogen and then ground into powder for the determination of sugar and acid content.

[0065] Sugar and acid content determination method: Take 0.1 g of ground fruit powder sample, add 1 mL of ddH2O, and extract in an 80°C waterbath for 30 minutes, shaking the sample every 5 minutes to mix thoroughly. Centrifuge at 12,000 g for 10 minutes at 4°C, and collect the supernatant. Dilute the supernatant 25-fold with 80% acetonitrile, filter through a 0.22 μm nylon membrane, and analyze by high-performance liquid chromatography (HPLC).

[0066] The results are as follows Figure 4As shown, based on the measured sugar and acid contents (the contents of fructose, glucose and sucrose were significantly increased, while the contents of citric acid and malic acid did not change significantly), the sugar-acid ratio was calculated and the results showed that the sugar-acid ratio of the fruit of the INVINH1 gene knockout homozygous plants was significantly higher than that of the wild type WT.

[0067] Example 5 Study on the transcriptional levels of carotenoid synthesis-related genes in tomato fruits of INVINH1 gene knockout homozygous plants

[0068] Tomato fruit peels were collected 8 days after the fruit color break, quickly frozen in liquid nitrogen, and then ground into a powder for RNA extraction. RNA from the tomato fruit was extracted and reverse transcribed to generate cDNA. Using the cDNA as a template, the following primers were designed for the DXR, PSY1, LCYB, and Actin genes to measure gene expression levels:

[0069] DXR gene qRT-PCR forward primer (SEQ ID NO.12):

[0070] TCGATGGTGGAAACACAGGA;

[0071] DXR gene qRT-PCR primer (SEQ ID NO.13):

[0072] CAAGCCGAGGCCAAGTAATC;

[0073] PSY1 gene qRT-PCR forward primer (SEQ ID NO.14):

[0074] ACAGGCAGGTCTATCCGATG;

[0075] PSY1 gene qRT-PCR primer (SEQ ID NO.15):

[0076] GCTCAATTCTGTCACGCCTT;

[0077] LCYB gene qRT-PCR forward primer (SEQ ID NO.16):

[0078] CCTTGTAGCTCGTCCTGGAT;

[0079] LCYB gene qRT-PCR primer (SEQ ID NO.17):

[0080] TGGGATCACACACTGCTCAT;

[0081] CCCGATGCAACAGTCACAAA;

[0082] Actin gene qRT-PCR forward primer (SEQ ID NO.18):

[0083] ATCCAGGCTGTGCTTTCTCT;

[0084] Actin gene qRT-PCR primer (SEQ ID NO.19):

[0085] AGTAAGGTCACGACCAGCAA.

[0086] The wild-type plant WT was used as the control group, and the Actin gene was used as the internal reference to normalize the expression levels of each target gene. Figure 5 As shown in the results, the transcription levels of DXR and PSY1, the key carotenoid synthesis genes, were significantly increased in invinh1-2. Notably, the lycopene degradation gene LCYB was significantly decreased in both invinh1-1 and invinh1-2, which provides molecular evidence to explain the increase in lycopene content in the fruits of invinh1 gene knockout homozygous plants.

[0087] The embodiments described above provide a detailed description of the technical solutions of the present invention. It should be understood that the above are only specific embodiments of the present invention and are not intended to limit the present invention. Any modifications, supplements or similar substitutions made within the scope of the principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. Application of the INVINH1 gene in synergistically increasing the lycopene content and sugar-acid ratio in tomato fruit, characterized in that: The nucleotide sequence of the protein coding region of the INVINH1 gene is shown in SEQ ID NO.

1.

2. Use of the protein encoded by the INVINH1 gene in synergistically increasing the lycopene content and sugar-acid ratio in tomato fruit, characterized in that: The amino acid sequence of the protein encoded by the INVINH1 gene is shown in SEQ ID NO.

2.

3. A method for synergistically increasing the lycopene content and sugar-acid ratio in tomato fruit using the INVINH1 gene, characterized in that: Knocking out or silencing the INVINH1 gene synergistically improves lycopene content and sugar-acid ratio in tomato fruit.

4. The method according to claim 3, characterized in that The specific steps include: (1) Construct a vector for knocking out or silencing the INVINH1 gene; (2) constructing an Agrobacterium genetically engineered bacterium containing the vector in step (1); (3) The genetically engineered Agrobacterium constructed in step (2) is transformed into tomato cotyledons, and a homozygous mutant strain that does not contain exogenous proteins and is stably inherited is obtained through cultivation.

5. The method according to claim 4, characterized in that In step (1), a target sequence for gene knockout is selected in the protein coding region of the INVINH1 gene, primers are designed, and a CRISPR / Cas9 vector for knocking out the INVINH1 gene is constructed.

6. The method according to claim 5, characterized in that There are two target sequences for gene knockout, the first target sequence is shown as SEQ ID NO.4, and the second target sequence is shown as SEQ ID NO.

5.

7. The method according to claim 6, characterized in that The nucleotide sequence of the upstream primer designed for the first target sequence is shown in SEQ ID NO.6, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.7; the nucleotide sequence of the upstream primer designed for the second target sequence is shown in SEQ ID NO.8, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

9.

8. The method according to claim 6, characterized in that In step (2), the genetically engineered Agrobacterium is Agrobacterium tumefaciens GV3101 strain.

9. Use of the method according to any one of claims 3 to 8 in cultivating tomatoes with high lycopene content and high sugar-acid ratio.

Images