Amplification detection method of meloidogyne killing meloidogyne recombinase polymerase

The ribosomal 28S rRNA-D2/D3 fragment of the lethal nematode is detected by RPA technology and specific primers, which solves the problems of rapidity, accuracy and sensitivity of lethal nematode detection and is suitable for rapid customs clearance at ports and diagnosis of nematode diseases.

CN120608157APending Publication Date: 2025-09-09ANIMAL & PLANT & FOOD INSPECTION CENT OF TIANJIN ENTRY EXIT INSPECTION & QUARANTINE BUREAU
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410263633.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-03-08
Publication Date
2025-09-09

AI Technical Summary

Technical Problem

Existing technologies make it difficult to detect lethal grain nematodes efficiently, quickly and accurately, especially the demand for detecting lethal grain nematodes in imported annual ryegrass seeds during rapid customs clearance at ports has not been met.

Method used

Recombinase polymerase amplification (RPA) technology was used to design specific primers for the detection of lethal nematodes. Specific primers were designed using the conserved region of the 28S rRNA-D2/D3 fragment of the lethal nematode ribosome for RPA detection.

Benefits of technology

It achieves highly sensitive, rapid and specific detection of lethal nematodes with a short detection time and a sensitivity of up to 1/160 times the DNA of a single nematode, about 16 pg/μL, making it suitable for rapid detection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120608157A_ABST
    Figure CN120608157A_ABST
Patent Text Reader

Abstract

The invention provides a meloidogyne killing recombinase polymerase amplification detection method, meloidogyne killing recombinase polymerase amplification detection method, meloidogyne killing recombinase polymerase amplification detection is carried out by using an RPA specific primer, the nucleotide sequence of ZS-F in the RPA specific primer is as shown in SEQ ID NO.1 in a sequence table, the nucleotide sequence of ZS-R is as shown in SEQ ID NO.2 in the sequence table, and the nucleotide sequence of ZS-F in the RPA specific primer is as shown in SEQ ID NO.1 in the sequence table. According to the detection method, a specific primer is designed according to a conserved region of a ribosome 28S rRNA-D2 / D3 fragment of the meloidogyne killing meloidogyne killing meloidogyne killing meloidogyne killing meloidogyne killing meloidogyne killing meloidogyne killing meloidogyne killing meloidogyne killing meloidogyne killing meloidogyne killing meloidogyne killing meloidogyne killing meloidogyne killing meloidogyne killing meloidogyne killing meloidogyne killing meloidogyne killing meloidogyne killing meloidogyne killing The method is high in amplification efficiency, short in detection time, good in specificity, high in sensitivity and suitable for rapid detection of meloidogyne killing meloidogyne.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention relates to the technical field of foreign harmful organism detection, in particular to a lethal nematode recombinase polymerase amplification detection method. Background Art

[0002] The lethal nematode (Anguina funesta), belonging to the order Tylenchida, family Anguinidae, genus Anguina, is an invasive pest with a high risk of spread, posing a serious threat to livestock production. This nematode primarily infects the annual ryegrass (Lolium rigidum) and the grass Vulpia myuros. Its second-instar larvae infect the seeds, stems, leaves, and inflorescences of the host plant, forming galls that severely reduce the above-ground yield of the grass. The lethal nematode is also a vector for the toxigenic Rathayibacter toxicus, a bacterium that infects a variety of grasses and produces toxins that can cause poisoning and death in livestock, posing a significant threat to the livestock industry. Furthermore, this nematode is highly resistant to stress. Dormant second-instar larvae can survive for years in galls under dry conditions, allowing them to remain dormant in seeds for extended periods, enabling long-distance transmission. Currently, the occurrence and damage of the lethal grain nematode have been reported in Australia and the United States, but its distribution has not yet been reported in my country. Countries such as the United States, Chile, and Argentina have already listed it as a quarantine target. Since 2021, ports such as Shanghai and Tianjin have repeatedly intercepted lethal grain nematodes in imported annual ryegrass seeds, indicating that the risk of this nematode being transmitted with imported annual ryegrass seeds is extremely high. Therefore, effectively improving the efficient and accurate detection of lethal grain nematodes to meet the actual needs of rapid customs clearance at ports of entry is of great quarantine significance. Summary of the Invention

[0003] The technical problem to be solved by the present invention is to provide a method for amplifying and detecting the recombinase polymerase of lethal nematodes.

[0004] In order to solve the above technical problems, the technical solution of the present invention is:

[0005] A method for detecting recombinase polymerase amplification of lethal granule nematodes is provided, wherein RPA detection of lethal granule nematodes is performed using RPA specific primers, wherein the nucleotide sequence of ZS-F in the RPA specific primers is shown in the sequence listing SEQ ID NO.1, and the nucleotide sequence of ZS-R is shown in the sequence listing SEQ ID NO.2.

[0006] Preferably, the above-mentioned lethal nematode recombinase polymerase amplification detection method comprises the following steps:

[0007] (1) Reaction system 50 μL: 2 μL of nematode DNA template, 29.5 μL of dry powder rehydration buffer, 2.4 μL each of RPA-specific primers ZS-F and ZS-R (10 μmol / L), 11.2 μL of ddH2O, and 2.5 μL of 280 mmol / L magnesium acetate to initiate the reaction;

[0008] (2) After mixing, incubate at 38°C in a PCR instrument for 40 minutes;

[0009] (3) After the RPA reaction is completed, 50 μL of phenol / chloroform solution is added to the RPA amplified product, and the mixture is thoroughly mixed and centrifuged at 12,000 rpm for 5 min. The supernatant is used for electrophoresis and gel imaging. The amplified product is recovered and sequenced using a recovery kit.

[0010] Preferably, in the above-mentioned lethal granule nematode recombinase polymerase amplification detection method, the RPA-specific primers are obtained by the following method: downloading the NCBI lethal granule nematode 28S rRNA-D2 / D3 nucleic acid sequence (accession number: MG321209) combined with the nucleic acid sequence obtained by sequencing the lethal granule nematode population preserved in the laboratory, and simultaneously retrieving the 28S rRNA-D2 / D3 sequence of the granule nematode (Anguina spp.) in the Genbank database, performing sequence alignment and analysis of differential sites using ClustalX1.81 software, and designing lethal granule nematode RPA-specific detection primers using Primer 5.0 according to the basic requirements of RPA detection primers.

[0011] Beneficial effects:

[0012] The above-mentioned recombinase polymerase amplification detection method for lethal nematodes utilizes recombinase polymerase isothermal amplification technology (RPA) to design specific primers based on the conserved region of the ribosomal 28S rRNA-D2 / D3 fragment of the lethal nematode, and establishes an RPA detection method for lethal nematodes. The established RPA detection method is highly specific for lethal nematodes, and the amplified 230bp specific target fragment has a detection sensitivity of up to 1 / 160 times that of a single nematode DNA, approximately 16pg / μL. The method has high amplification efficiency, short detection time, good specificity, and high sensitivity, and is suitable for the rapid detection of lethal nematodes. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 The results of RPA method detection of lethal nematodes, where M: DNA molecular marker (2000bp); lanes 1-2: lethal nematode AFA1; lanes 3-4: lethal nematode AFA2; lanes 5-6: lethal nematode AFA3; lane 7: negative control.

[0014] Figure 2 The results of specific detection of lethal nematode by RPA method are shown, where M: DNA molecular marker (2000 bp); lane 1: lethal nematode AFA1; lane 2: lethal nematode AFA2; lane 3: lethal nematode AFA3; lane 4: bentgrass nematode; lane 5: wheat nematode; lane 6: vibrio nematode; lane 7: potato destructor; lane 8: dipsaci; lane 9: negative control.

[0015] Figure 3 The sensitivity test results of lethal nematode RPA and common PCR are shown, where M: DNA molecular marker (2000 bp); lanes 1-7: (1, 10 -1 , 20 -1 , 40 -1 , 80 -1 , 160 -1 , 320 -1 Lane 8: negative control; A: RPA detection sensitivity of lethal nematodes; B: conventional PCR detection sensitivity of lethal nematodes.

[0016] Figure 4 These are the RPA test results of annual ryegrass seeds and second-instar larvae of the lethal nematode, where M: DNA molecular marker (2000bp); lane 1: lethal nematode AFA1; lane 2: lethal nematode AFA2; lane 3: lethal nematode AFA3; lane 4: annual ryegrass seeds; lane 5: annual ryegrass seeds; lane 6: annual ryegrass seeds; lane 7: negative control. DETAILED DESCRIPTION

[0017] The following describes the polymerase amplification detection method for the lethal nematode recombinase in the present invention with reference to the examples and drawings.

[0018] Example 1

[0019] A method for amplification detection of a lethal granular nematode recombinase polymerase, comprising the following steps:

[0020] 1 Materials and Methods

[0021] 1.1 Materials

[0022] A total of eight nematode populations were used in this experiment, including three lethal nematode populations, as well as A. agrostis, A. tritici, A. wevelli, Ditylenchus destructor, and D. dipsaci. All nematode populations were collected and maintained in our laboratory (Table 1).

[0023] Table 1 Sources of tested nematodes

[0024]

[0025] 1.2 Methods

[0026] 1.2.1 Single nematode DNA extraction: Wash the nematodes in ddH2O, pick a single nematode and place it in a PCR tube containing 8μL ddH2O. Centrifuge quickly, cut it open with a small scalpel in the PCR tube, add 2μL lysis buffer, and place it in a PCR instrument for 1 hour at 56℃. After heating at 95℃ for 10 minutes, it can be used directly for PCR amplification or stored at -20℃ for later use.

[0027] 1.2.2 Design of RPA-specific primers The 28S rRNA-D2 / D3 nucleic acid sequence of Anguina spp. was downloaded from NCBI (accession number: MG321209). The nucleic acid sequence obtained by sequencing the Anguina spp. population preserved in the laboratory was combined with the 28S rRNA-D2 / D3 sequence of Anguina spp. in the Genbank database. The sequence alignment and differential site analysis were performed using ClustalX1.81 software. According to the basic requirements of RPA detection primers, Primer 5.0 was used to design the RPA-specific primers for the detection of Anguina spp.

[0028] 1.2.3 Establishment of RPA Detection Method The designed RPA-specific primers were used (wherein the nucleotide sequence of ZS-F is shown in SEQ ID NO. 1, and the nucleotide sequence of ZS-R is shown in SEQ ID NO. 2).

[0029] ZS-F (GATAGAGCCGACGTATCTAACTTGTATTCAG) / ZS-R (CTCTAACATTCAAACACAACAAACAGTCTTC) was tested for specificity in RPA against lethal nematodes, with a negative control (ddH2O) also included. The reaction system consisted of a 50 μL mixture consisting of 2 μL of nematode DNA template, 29.5 μL of rehydration buffer, 2.4 μL of each primer (10 μmol / L), and 11.2 μL of ddH2O. The reaction was initiated with 2.5 μL of 280 mmol / L magnesium acetate. After mixing, the mixture was incubated at 38°C in a PCR instrument for 40 minutes. After the RPA reaction, 50 μL of phenol / chloroform solution was added to the RPA amplified product, mixed thoroughly, and centrifuged at 12,000 rpm for 5 minutes. The supernatant was used for electrophoresis and gel imaging. The amplified product was then recovered using a recovery kit and sequenced.

[0030] 1.2.4 RPA Specificity Test The RPA specificity test was performed on four populations of Anguina and its similar species and two populations of Ditylenchus according to the detection reaction system described in 1.2.3. A negative control (ddH2O) was also set up to test the specificity of the established RPA detection method.

[0031] 1.2.5 RPA sensitivity test: DNA of a single lethal nematode was extracted and the DNA concentration was determined. The DNA was diluted to (10 -1 , 20 -1 , 40 -1 , 80 -1 , 160 -1 , 320 -1 ) 5 concentration gradients were used, and the reaction system was tested according to 1.2.3 to test the sensitivity of the RPA detection method. In addition, conventional PCR amplification reactions were performed with the same dilutions to compare the sensitivity of RPA and conventional PCR. The conventional PCR reaction system consisted of 25 μL: 2 μL DNA template, 1 μL each of forward and reverse primers (10 μmol / L), 12.5 μL of 2× Taq PCR Master Mix, and 8.5 μL of ddH2O. The PCR reaction procedure was as follows: 94°C pre-denaturation for 5 min; 35 cycles of denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s; and extension at 72°C for 10 min. Amplified products were detected by electrophoresis on a 2% agarose gel.

[0032] 1.2.6 RPA of annual ryegrass seeds and second-instar larvae of the lethal grain nematode To test the practicality of the RPA detection method, second-instar larvae of three laboratory-stored samples of annual ryegrass seeds from the United States carrying the lethal grain nematode were separated and total DNA was directly extracted from the positive seeds for RPA detection according to 1.2.3.

[0033] 2 Results and Analysis

[0034] 2.2 Establishment of the RPA detection method for lethal granulosa nematodes

[0035] According to the RPA detection results of the specific primers ZS-F / ZS-R for the lethal nematode, the primers can amplify a specific fragment of about 230bp for the lethal nematode, while no band appears in the negative control (ddH2O). Figure 1 Specific fragments were recovered and sequenced, and then sequence alignment analysis was performed to confirm that the PCR product was the corresponding target fragment, indicating that this method can be used for RPA detection of lethal nematodes.

[0036] 2.3 RPA detection method specificity test

[0037] The established RPA detection system was used to detect the lethal grain nematode and its similar species. The results showed that the primers could only amplify a specific fragment of about 230 bp for the lethal grain nematode, while no bands were seen in the populations of A. agrostis, A. tritici, A. wevelli, Ditylenchus destructor, D. dipsaci and the negative control (ddH2O). Figure 2 ), which proved that the detection method has good specificity.

[0038] 2.4 Sensitivity test

[0039] After dilution with single nematode DNA (10 -1 , 20 -1 , 40 -1 , 80 -1 , 160 -1 , 320 -1 ) was used as a template to conduct RPA and conventional PCR detection sensitivity tests. The results showed that the specific band of a single lethal nematode DNA was clear and bright. -1 times to 160 -1 After times, RPA ( Figure 3 -A) and conventional PCR method ( Figure 3 -B) The amplified specific product band is still clearly visible, diluted to 320 -1 When the sensitivity of the amplified bands of the two detection methods was reduced, the sensitivity of the RPA detection system for lethal nematodes established by the present invention could reach about 160 -1 The detection sensitivity of this method is basically equivalent to that of ordinary PCR, and it still maintains good detection efficiency even when the sample DNA concentration is low.

[0040] 2.5 RPA detection of annual ryegrass seeds (L. rigidum seeds) and second-instar larvae of the lethal nematode

[0041] The RPA detection method established in the present invention was used to identify the second-instar larvae and seed samples directly extracted from three laboratory-stored samples of American annual ryegrass seeds carrying lethal nematodes. The results showed that the corresponding specific bands were amplified from the three directly isolated second-instar larvae of lethal nematodes and the two seed samples directly extracted from the total DNA, while no amplified bands were found in the negative control (ddH2O). Figure 4This indicates that the RPA detection method for lethal nematodes established in this invention has good accuracy and stability and can be applied to the detection of actual samples. Furthermore, direct extraction of total DNA from one seed sample did not detect specific bands. This may be because lethal nematodes do not show obvious disease symptoms or galls in diseased seeds. The test seeds were randomly selected by the experimenters, and a small amount of seeds without lethal nematodes may have been mixed in with the positive samples.

[0042] 3 Conclusion

[0043] The present invention uses the 28S rRNA-D2 / D3 of the lethal nematode as the target region and designs RPA primers, which can achieve specific detection of the lethal nematode within 30 minutes under isothermal conditions at 38°C, generate a specific fragment of about 230bp, and establish an RPA detection method for the lethal nematode. Compared with detection methods such as PCR-RFLP, real-time fluorescence PCR, and DNA barcodes, the detection time is effectively shortened. In terms of detection sensitivity, this method not only realizes the detection of a single nematode, but also amplifies specific bands when the template DNA concentration is diluted to 1 / 160 of a single nematode, and the detection limit can reach about 16pg / μL, which is basically consistent with the detection sensitivity of ordinary PCR. In terms of detection stability and practicality, the present invention has achieved the following results by detecting 5 similar nematode species and 3 samples of the lethal nematode.

[0044] The actual detection of retained positive samples has yielded good results, with good specificity and stability. Furthermore, the RPA detection method uses a recombinase and a long primer (consisting of 30-35 bases) to form a polymer that is fully complementary to the template DNA. Therefore, the RPA detection amplification product has strong specificity and is less likely to produce false positive results. Furthermore, RPA can be deeply integrated with CRISPR / Cas12a technology and RKDNA-graphene oxide (GO) probe systems to further enhance the sensitivity and specificity of detection.

[0045] In summary, the lethal granular nematode recombinase polymerase amplification detection method described in the present invention uses the lethal granular nematode rDNA-28S (D2 / D3) as the targeting sequence, designs specific RPA primers, and establishes a lethal granular nematode RPA detection and identification technology system, which can not only effectively shorten the detection time, but also has good sensitivity, stability and practicality, providing a simpler, faster and more efficient method for the detection and identification of lethal granular nematodes, and is suitable for practical applications in scenarios such as port quarantine identification and rapid diagnosis of nematode diseases.

[0046] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A method for detecting the lethal granular nematode recombinase polymerase amplification, characterized by: RPA detection of lethal nematodes was performed using RPA specific primers, wherein the nucleotide sequence of ZS-F in the RPA specific primers is shown in the sequence listing SEQ ID NO.1, and the nucleotide sequence of ZS-R is shown in the sequence listing SEQ ID NO.

2.

2. The method for detecting the lethal granule nematode recombinase polymerase amplification according to claim 1, characterized in that: The specific steps are as follows: (1) Reaction system 50 μL: 2 μL of nematode DNA template, 29.5 μL of dry powder dissolution buffer, 2.4 μL each of RPA-specific primers ZS-F and ZS-R, 11.2 μL of ddH2O, and 2.5 μL of 280 mmol / L magnesium acetate to start the reaction; (2) After mixing, incubate at 38°C in a PCR instrument for 40 minutes; (3) After the RPA reaction is completed, 50 μL of phenol / chloroform solution is added to the RPA amplified product, mixed thoroughly, and centrifuged at 12,000 rpm for 5 min. The supernatant is used for electrophoresis and gel imaging. The amplified product is recovered using a recovery kit for sequencing.

3. The method for amplification and detection of the lethal granule nematode recombinase polymerase according to claim 1, characterized in that: The RPA-specific primers were obtained by the following method: downloading the 28SrRNA-D2 / D3 nucleic acid sequence of the lethal granule nematode from NCBI and combining it with the nucleic acid sequence obtained by sequencing the lethal granule nematode population preserved in the laboratory, and simultaneously searching the 28SrRNA-D2 / D3 sequence of the granule nematode in the Genbank database, performing sequence alignment and analysis of differential sites using ClustalX1.81 software, and designing the lethal granule nematode RPA-specific detection primers using Primer 5.0 according to the basic requirements of RPA detection primers.