Specific molecular detection gene, primer, method and application of phoma paeoniae

Abstract

The application discloses a gonythecium specific molecular detection gene, primer, method and application, and belongs to the technical field of molecular detection. In view of the problems of long time consumption, low accuracy and lack of specific molecular markers in traditional detection methods of the gonythecium specific molecular detection gene, the nucleotide sequence shown in SEQ ID NO:1 is provided as a specific molecular detection target. The sequence lays a foundation for designing high-specificity primers, supports the establishment of a detection system based on conventional PCR and real-time fluorescent quantitative PCR, and the minimum detection concentration reaches 0.5 fg / μL. The technology is mainly used for rapid qualitative and quantitative detection of gonythecium in ginseng plants, seeds and soil, early pathogen monitoring is realized, disease early warning is realized, and technical support is provided for safe production of ginseng.

Description

Technical Field

[0001] This invention belongs to the field of molecular detection technology, specifically relating to the specific molecular detection genes, primers, methods, and applications of ginseng black spot pathogen. Background Technology

[0002] Ginseng (Panax ginseng CA Meyer), belonging to the genus Panax in the family Araliaceae, is one of my country's most distinctive perennial medicinal plants, accounting for approximately 70% of global production annually. With the expansion of ginseng cultivation area and the increase in years of cultivation, it is frequently susceptible to infection by pathogenic fungi, resulting in various diseases such as ginseng black spot, ginseng rust rot, ginseng sclerotinia rot, ginseng gray mold, and ginseng anthracnose.

[0003] Ginseng black spot disease is caused by infection with three types of fungi: Deuteromycetes, Hyphomycetes, and Alternaria. These are Alternaria ginseng (…). Alternaria alternata ), Ginseng Alternaria ( A. panax ) and fine-particle-alternaria ( A. tenuissima ), including Alternaria ginseng ( A. panax This disease is the most virulent. Black spot disease can affect all parts of ginseng, but it is most common on the leaves. Initially, the lesions are yellowish-brown and water-soaked, gradually enlarging and turning brown or grayish-brown with slight concentric streaks. Once symptoms appear on the plant, the pathogen spreads more widely, leading to an epidemic. Therefore, it is necessary to detect and quantify pathogens in propagation materials and soil before ginseng planting. Compared with molecular biology techniques, traditional methods of pathogen isolation and microscopic observation are time-consuming, have low success rates, are inaccurate, and are easily affected by various factors. Summary of the Invention

[0004] In response to the widespread, serious, and difficult-to-control problem of ginseng black spot disease, this invention provides a ginseng Alternaria (… A. panax The molecular detection target gene of ginseng Alternaria was identified, and specific detection primers were designed using this gene to construct a real-time quantitative PCR detection method to determine the target gene of ginseng Alternaria. A. panax Under suitable conditions, the minimum infection threshold is determined, and qualitative and quantitative detection of residual pathogens in the soil is carried out to provide a basis for disease early warning.

[0005] To achieve the above-mentioned objectives, the present invention employs the following technical solution:

[0006] The specific molecular detection gene for ginseng black spot disease is the nucleotide sequence shown in SEQ ID NO: 1.

[0007] The specific detection primer of Alternaria panax of Alternaria panax includes a pair of primers with base sequences shown in SEQ ID NO: 2 and SEQ ID NO: 3.

[0008] Preferably, the specific detection primer further includes a pair of primers with base sequences shown in SEQ ID NO: 4 and SEQ ID NO: 5.

[0009] The detection method of Alternaria panax of Alternaria panax includes the following steps:

[0010] 1) Extracting the genomic DNA of microorganisms in the plant to be detected, seeds to be detected or soil;

[0011] 2) Using the genomic DNA in step 1) as a template, and using a pair of primers with base sequences shown in SEQ ID NO: 2 and SEQ ID NO: 3 to perform PCR amplification;

[0012] 3) Determining the length of the PCR amplification product obtained in step 2), and if a product with a detection value of 413 bp is detected in the PCR amplification product, it is determined that the sample containing the genomic DNA of the template contains Alternaria panax.

[0013] Preferably, in the detection method, the detection value is 413 bp.

[0014] Preferably, in the detection method, in step 2), the genomic DNA in step 1) can also be used as a template, and a pair of primers with base sequences shown in SEQ ID NO: 4 and SEQ ID NO: 5 can be used to perform real-time fluorescent quantitative PCR amplification.

[0015] Preferably, in the detection method, the following step is further performed: when real-time fluorescent quantitative PCR amplification is used for detection, the linear regression equation is y=-3.6597x+41.234, where y is the Ct value, x=lg[DNA concentration], the correlation coefficient R² of the standard DNA concentration logarithm value and the Ct value is greater than 0.99, when the Ct value is greater than or equal to 35, it is considered that the sample to be detected does not contain Alternaria panax, and when the Ct value is less than 35, it is considered that the sample to be detected contains Alternaria panax.

[0016] Preferably, in the detection method, the minimum concentration for real-time fluorescent quantitative PCR amplification detection is 0.5 fg / μL.

[0017] Preferably, in the detection method, an internal reference gene amplification system is simultaneously added in the PCR amplification step, the internal reference gene is a stable microbial housekeeping gene in soil, and when the internal reference gene Ct value deviates from the preset threshold value by ±1.5, DNA purification compensation is started.

[0018] The original soil sample is re-extracted by chemical lysis-silica gel membrane adsorption method, including adding humic acid scavenger;

[0019] The purified DNA is re-measured for nucleic acid concentration and purity, and meets A260 / A280=1.8-2.0 and A260 / A230≥1.8.

[0020] The purified DNA is used as a template for repeated real-time fluorescent quantitative PCR detection until the Ct value of the internal reference gene returns to the threshold value range.

[0021] Preferably, in the detection method, when 34.5≤Ct value<35.5, a recheck verification procedure is started, including any one or combination of the following steps:

[0022] a) using different batches, different manufacturers of PCR amplification reagents, re-performing real-time fluorescent quantitative PCR detection on the same sample DNA;

[0023] b) using another real-time fluorescent quantitative PCR instrument, re-performing real-time fluorescent quantitative PCR detection on the same sample DNA;

[0024] c) using the Ct value of the internal reference gene for correction:

[0025] calculating the difference between the measured Ct value of the internal reference gene and the preset threshold value;

[0026] adding the difference to the Ct value to obtain the corrected Ct value;

[0027] using the Ct value obtained after re-detection of steps a) and b), or the corrected Ct value calculated in step c), to re-determine whether the sample to be detected contains Alternaria panax.

[0028] The nucleotide sequence or the detection primer is used for detecting Alternaria panax or planting ginseng.

[0029] The present application aims to find a molecular detection target gene in the pathogenic fungus Alternaria panax of ginseng black spot disease, A. panax and design a specific detection primer for the black spot fungus using the gene, and develop a real-time fluorescent quantitative PCR detection method for the black spot fungus. Based on this method, the minimum threshold of black spot fungus infection under suitable conditions is determined, and qualitative and quantitative detection of residual pathogenic bacteria in soil is carried out, which provides a basis for disease early warning, technical support for early prevention and control of diseases, and protection for ginseng production.

[0030] Compared with the prior art, the present application has the following advantages and beneficial technical effects:

[0031] The application develops a molecular detection primer with strong specificity and high amplification efficiency for the human ginseng alternaria alternata through bioinformatics analysis comparison and further experimental screening. Through literature review and experimental verification, the primer and corresponding two-step quantitative amplification technology mode used in the application have better specificity, higher sensitivity, and high reliability of standard curve and regression equation. The application uses standard plasmids with different concentrations as templates, aiming to establish a rapid, stable and accurate real-time fluorescent quantitative PCR detection method for accurate determination of the content of human ginseng alternaria alternata in different tissues of ginseng and soil for ginseng planting. A. panax The method can not only effectively improve the detection efficiency, but also reduce the error in the operation process and ensure the stability of the results. On this basis, the application further discusses the relationship between the spore amount and the cycle threshold (Ct), and establishes a more scientific mathematical model. This research result provides strong technical support for ginseng soil treatment, early diagnosis and dynamic monitoring of black spot disease, and also provides more accurate and reliable technical basis for rapid molecular detection of ginseng seeds and seedlings with diseases, which is helpful for realizing precision prevention and control and more effective disease control in agricultural production.

[0032] Other advantages, objects and features of the embodiments of the application will be embodied partly through the following description, and partly will be understood by those skilled in the art through research and practice of the embodiments of the application. BRIEF DESCRIPTION OF DRAWINGS

[0033] Figure 1 For the primer specificity detection verification results in one of the schemes of the application, a is the verification results of 1-24, and b is the verification results of 25-28, wherein M: DNA molecular weight marker, 1-8: human ginseng alternaria alternata of different strains A. panax , 9-14: Alternaria tenuis of different strains A. tenuissima ; 15-20: Alternaria alternata of different strains A. alternata , 21: Alternaria solani A. solani , 22: Alternaria brassicae A. brassicicola , 23: Alternaria alternata A. alternata , 24: Alternaria tenuis A. tenuissima , 25: Alternaria alternata A. alternata , 26: Alternaria tenuis A. jacinthicola , 27: Alternaria helianthi A. helianthinficiens , 28: Alternaria helianthi A. helianthinficiens , 29: Alternaria longipes A. longipes , 30: Alternaria alternata A. alternata , 31: Alternaria tenuis A. tenuissima , 32: Alternaria alternata A. alternata , 33-39: Botrytis cinerea of different strains Botrytis cinerea , 40: Botrytis fabaeB. fabae 41: Pythium aphanidermatum Phytophthora cactorum 42: Cylindrocarpon destructans Colletotrichum panacicola 43: Neonectria ditissima Ilyonectria robusta 44: Rhizoctonia solani Rhizoctonia solani 45: Fusarium oxysporum Fusarium oxysporium 46: Pythium aphanidermatum P. cactorum 47: Sclerotinia sclerotiorum Sclerotia sclerotiorum, 48: ddH2O (negative control).

[0034] Figure 2 is a colony PCR verification chart in one of the schemes of the present application.

[0035] Figure 3 is an amplification curve chart of real-time fluorescent quantitative PCR of the recombinant plasmid in one of the schemes of the present application, wherein the abscissa is the cycle number, and the ordinate is the fluorescence signal intensity, and the curves on the chart are the amplification curves of the recombinant plasmid, other pathogenic fungi and ddH2O, respectively.

[0036] Figure 4 is a primer sensitivity detection verification result chart in one of the schemes of the present application, wherein M: DNA molecular weight marker, lanes 1-5 template concentrations are: 100 ng / μL, 10 ng / μL, 1 ng / μL, 10 ng / μL, 10 ng / μL, respectively. -1 -2

[0037] Figure 5 is a sensitivity test result chart of real-time fluorescent quantitative PCR detection of Alternaria panax Q2-1 by using Q2-1-F and Q2-1-R as real-time fluorescent quantitative specific primers in one of the schemes of the present application. A. panax

[0038] Figure 6 is a standard curve chart established in one of the schemes of the present application.

[0039] Figure 7 is an indoor artificial inoculation disease condition chart of Alternaria panax in one of the schemes of the present application.

[0040] Figure 8 is a curve of soil genome extracted after indoor inoculation of Alternaria panax in one of the schemes of the present application for quantitative amplification and a relationship equation chart of spore suspension inoculation soil and disease condition. DETAILED DESCRIPTION

[0041] ​​​To further illustrate the technical means and effects of this invention, the following description, in conjunction with embodiments and accompanying drawings, further explains the invention. The specific embodiments described herein are merely illustrative of the invention and not intended to limit it.

[0042] It should be noted that, unless otherwise specified, the experimental methods described in the following implementation plan are all conventional methods, and the reagents and materials described are all commercially available unless otherwise specified.

[0043] Real-time quantitative PCR is significantly superior to traditional methods and other molecular techniques in terms of detection time, sensitivity, and quantification.

[0044] Currently, research is underway on the use of real-time quantitative PCR technology to detect Alternaria alternata (Ginseng Alternaria). A. panax No relevant research has been reported. This invention aims to find Alternaria ginseng (… A. panax By identifying specific genes in ginseng and designing specific primers, a precise real-time quantitative PCR detection method was developed. This invention provides strong technical support for soil treatment of ginseng, early diagnosis and dynamic monitoring of black spot disease, and also provides a more accurate and reliable technical basis for rapid molecular detection of diseased ginseng seeds and seedlings, contributing to precise prevention and control and more effective disease management in agricultural production.

[0045] Alternaria ginseng, a fungus that causes black spot disease in ginseng ( A. panax A specific fragment of the gene was identified by pan-genome analysis of different species of Alternaria within the same genus. The sequence is shown in SEQ ID NO: 1.

[0046] SEQ ID NO: 1

[0047] ATGGCACCTCGCAATCACGGTACCCAACGCGAAACTCCTCAAGCACATGCTCGTGGTGCAGAAGATGTTTCTCGTCCGACCAATATGGGTATCAACGCTAGACGCCCAACTGTAGCAGATCGCAACATCCTTAGCGCAAACACTGGCGCGGGTATCGGTGCCAGACGCTCAACTGCACCTACCAGTCGTACCAGTCGCAGTGGCAGTGACAAGCATCCACAGCGATGTCAACGCACCCCCCGAGTCCGCGGAACCGCTACCGCTGCCGTAACTCGCCCCCAGAACGATCGCGCTACAAGCTCAAGAACCCAAGGTACTACCAGACATCGTACCGACGCCGCATTCCGTGGTACAATGGCTCCTCCCACGACCCCCGGTTCGGTACCTATCCTCCCCCCGATCAACCCAGCACCCGTATCCACACCCGCTGCCCATCCCACCACCATACTCCCCATCCGCCAAGTCAACTCGAGCCCAGGTCATGCGTCGCCTGCGTTCAGTGGCAGATTAACACGCGTCTTCCCGGAGTCTCAGCGCAGGCTGGATCAAATTTCGCCTATCGGTCGGGACACGTCGTTTACTGTGGTGCCGAGGCCTATTCGCCTGTTTGATAGTATTTTGTCTACTGCTGCTGGTGGTGGTACACCCAGCCATATCAACCTCATCACCGGTCAGGGGTATGTGTATGTTCTCCTTCTCCTTCCATCCTTCCATGTCTAACATACTAACCACCCAGCCCCCTCCCGGTCCCCAAACCTCGTTCTTCAACGTACCGCGACCCCTCCTCTATCAAACACGCCGTCTCAAACCCCAATCTACGCGCTATCCTGTCCGACAAACCGTATCCGAGGGAGCGCAAGAAGTCTGCTGGGGAGCGACCGGTGTTGAAGATGGGGATTAGTAGGGAGTATAAGTGA

[0048] To establish a prediction and forecasting mechanism for Alternaria panax, the present invention adopts the following technical solution: Alternaria panax, the pathogen of Alternaria panax disease in ginseng ( A. panaxSpecific molecular detection primers were developed using pan-genome comparison of different species of Alternaria within the same genus via the NCBI nr database to identify shared and unique genes. Primers were designed based on gene sequence alignment, and their amplification efficiency and specificity were experimentally verified. The sequences of the primer pairs are as follows:

[0049] 1-2-F: 5'-ATACGGGTGCTGGGTTGA-3' (SEQ ID NO: 2)

[0050] 1-2-R: 5'-ACCTCGCAATCACGGTAC-3' (SEQ ID NO: 3)

[0051] Q2-1-F: 5'-ATCGCTGTGGATGCTTGT-3' (SEQ ID NO: 4)

[0052] Q2-1-R: 5'-CGTCCGACCAATATGGGTATC-3' (SEQ ID NO: 5)

[0053] Specific molecular detection primers in ginseng Alternaria ( A. panax The detection method described in the text involves extracting DNA from microorganisms in the tested plant, seeds, or soil as a template for PCR amplification. The amplified products are then subjected to agarose gel electrophoresis and detected under ultraviolet light. The presence of a specific 413 bp band indicates the presence of *Alternaria ginseng* (Ginseng Alternaria) in the tested sample. A. panax ).

[0054] Ginseng Alternaria ( A. panax The application of specific molecular detection primers in PCR detection was verified through conventional PCR amplification. The primers can only be detected in samples containing *Alternaria ginseng* (Ginseng Alternaria). A. panax Under the DNA template of ), a 413 bp band was specifically amplified. This band can be used to qualitatively detect whether ginseng black spot fungus is present in healthy plants, other microorganisms in the soil, other ginseng diseases, and other pathogens present in the template. A. panax ).

[0055] Ginseng Alternaria ( A. panax The application of specific molecular detection primers in real-time quantitative PCR molecular detection, the standard curve equation based on quantified standard DNA samples, and the correlation coefficient R between the logarithm of the standard DNA concentration and the Ct value. 2 >0.99, the quantitative linear regression equation is y=-3.6597x+41.234, where y is the Ct value and x=lg[DNA concentration]. This allows for simultaneous qualitative and quantitative detection of the presence of *Alternaria ginseng* in samples. A. panaxThe presence of ginseng Alternaria ( ) is used to quantify the unknown amount of ginseng Alternaria in the sample. A. panax The DNA of ) provides a theoretical basis.

[0056] It can predict the incidence of ginseng black spot disease. The minimum detection concentration using real-time quantitative PCR is 0.5 fg / μL, and its sensitivity is higher than that of conventional PCR. It can detect Alternaria alternata (ginseng black spot disease). A. panax The detection amount was determined by inoculating soil with spore suspension, and the relationship between spore number and Ct value was established.

[0057] Example 1

[0058] DNA extraction and quantification

[0059] After culturing the tested strain in potato dextrose agar (PDA) at 25 °C for 5 days, approximately 50 mg of mycelia from the surface of the medium were gently scraped off for genomic DNA extraction. Total genomic DNA was extracted from tissue samples and soil using the CTAB method and a soil genomic DNA extraction kit (TIANGEN Biotech, Beijing Co., Ltd.), respectively. The extracted DNA was purified and recovered, and quantified using a NanoDrop 2000. Genomic DNA with an A260:A280 ratio of 1.8 to 2.0 was used for routine PCR and real-time quantitative PCR. Samples that passed the tests were stored at -20 °C for later use.

[0060] Example 2

[0061] Standard PCR methods for verifying primer specificity

[0062] The standard PCR reaction volume was 20 μL, containing 10 μL TaqSuperMix enzyme, 1 μL each of standard PCR forward and reverse primers, 1 μL template DNA, and 7 μL sterile water. The reaction conditions were: 95 °C pre-denaturation for 3 min, 95 °C denaturation for 10 s, annealing at the optimal temperature for the standard PCR primers for 10 s, 72 °C for 30 s, for a total of 34 cycles, followed by an extension at 72 °C for 5 min. ddH₂O was used as a negative control instead of template. The PCR amplification products were detected by 1% agarose gel electrophoresis. Figure 1 As shown, different species of ginseng pathogenic fungi from different regions were selected for PCR amplification. Primers capable of amplifying *Alternaria ginseng* were screened, but other ginseng pathogenic fungi were not amplified. The specificity of the selected primers was verified using ddH2O as a control.

[0063] Example 3

[0064] Preparation of standard plasmids and verification of primer specificity for real-time quantitative PCR

[0065] by A. panax Using strain sd3-3 as a template, the pathogen DNA was amplified by conventional PCR using primers. The PCR product was recovered by gel extraction using a standard agarose gel DNA recovery kit (Sangon Biotech Shanghai Co., Ltd.). The recovered fragment was ligated into the pUCm-T vector at 16 ℃ for 2 h, and then transformed into E. coli DH5α competent cells. The cells were plated on LB medium containing 100 μg / mL ampicillin and incubated at 37 ℃ for 12 h. After single colonies grew, the cells were... Figure 2 After successful colony PCR verification, single clones were screened. Positive clones were inoculated into LB liquid medium containing 100 μg / mL ampicillin and cultured for 16-24 h. Plasmids were extracted using a rapid plasmid DNA mini-kit (TIANGEN Biotech, Beijing Co., Ltd.), amplified by PCR using primers, identified by electrophoresis and enzyme digestion, and then sent to the company for sequencing verification. After correct plasmid identification, the plasmid concentration was determined. The plasmid was then detected by real-time quantitative PCR. Figure 3 It can be seen that primer Q2-1F / R is only effective against... A. panax The DNA template showed a unique product amplification curve, while no signal was detected in other pathogenic fungi, proving that the primer was specific.

[0066] Example 4

[0067] Evaluation of real-time quantitative PCR system and generation of real-time quantitative PCR standard curve

[0068] The pathogen's genomic DNA was diluted 10-fold to obtain five concentration gradients (100 ng / μL, 10 ng / μL, 1 ng / μL, 10...). -1 ng / μL, 10 -2 PCR amplification was performed using ng / μL. The weakest band observed was used as the limit of detection to determine the sensitivity of the PCR primers for detecting pathogens. Serial dilutions were performed according to the following formula for calculating plasmid copy number. After 10-fold serial dilutions, nine concentration gradients of standard plasmids (1.65 × 10⁻⁶ ng / μL) were obtained. −2 1.65 × 10 −1 1.65 × 10 0 1.65 × 10 1 1.65 × 10 2 1.65 × 10 3 1.65 × 10 4 1.65 × 10 5 and 1.65 × 10 6(Copies / μL) were used for real-time quantitative PCR amplification. The lowest detection limit was determined by the smoothness and repeatability of the amplification curve, thus assessing the sensitivity of the real-time quantitative PCR primers for detecting pathogens. For example... Figure 4 As shown, the lowest detectable DNA concentration by PCR is 10. -1 The limit of detection for real-time quantitative PCR is 1.65 × 10⁻⁶ ng / µL. 1 copies / μL ( Figure 5 This is equivalent to a DNA concentration of 0.5 fg / μL.

[0069] The formula for calculating plasmid copy number is: Plasmid copy number (copies / μL) = (6.02 × 10⁻⁶) / (6.02 × 10⁻⁶) -9 ×10 23 / molar)×plasmid concentration (g / mL) / [(vector length + fragment length)×660]

[0070] With 1.65 × 10 1 -1.65 × 10 5 Using standard plasmids of copies / µL as templates, real-time quantitative PCR amplification was performed for intra-group (three replicates of the same qPCR experiment) and inter-group (three qPCR experiments) replicates. The standard deviation (SD) and coefficient of variation (cv) of the Ct value were used as the judgment criteria. The analysis results are shown in Table 1. The maximum coefficient of variation for intra-group replicates in the established qPCR system was 1.06%, and the maximum coefficient of variation for inter-group replicates was 1.67% (Table 1), indicating that the established qPCR system has good reproducibility.

[0071] With 1.65 × 10 −2 -1.65 × 10 5 Using standard plasmids at a concentration of copies / μL as templates, a qPCR standard curve was generated. Each plasmid concentration was amplified three times using real-time quantitative PCR. The standard curve was plotted with the logarithm of the plasmid DNA concentration on the x-axis and Ct values ​​on the y-axis. The standard curve equation is y = -3.6597x + 41.234, and the correlation coefficient R0 is [value missing]. 2 =0.9968 ( Figure 6 This indicates that the linear relationship is good.

[0072] Based on the above experimental results, a Ct value <35 was determined to be the threshold for whether or not ginseng Alternaria is present.

[0073] Example 5

[0074] Detection of black spot pathogen and infection threshold in artificially inoculated ginseng

[0075] Healthy ginseng leaf surfaces were disinfected with 75% alcohol for 2 min, followed by 2% sodium hypochlorite for 1 min, and rinsed repeatedly with sterile water. Spore suspensions of the tested strains were prepared by culturing in PDA medium for 1-2 weeks. Individual healthy ginseng leaves were inoculated with 20 μL of the spore suspension. The inoculated ginseng leaves were cultured at room temperature, and DNA was extracted at 0 h, 3 h, 6 h, 12 h, 24 h, 2 d, 3 d, 4 d, 5 d, 6 d, 7 d, and 8 d post-infection, and verified by real-time quantitative PCR. The results showed that within 12 h post-inoculation, the Ct value was >28.02, and the DNA abundance was <2.47 fg / μL; after 4 days post-inoculation, A. panax The content of pathogens in ginseng leaves increased significantly to 89.26 fg / μL; the pathogens detected on day 8 after inoculation... A. panax The highest content (1071.17 fg / μL) was observed, with the affected area becoming darker and larger. Figure 7 ).

[0076] Table 1. Repeatability analysis of real-time quantitative PCR

[0077]

[0078] Table 2. Soil test results after spore inoculation

[0079] Serial number Spore amount (spores / mL) Ct mean DNA concentration (fg / μL) 1 50 30.12 0.659746357 2 100 29.13 1.22995997 3 200 28.38 1.971631772 4 500 27.46 3.517325282

[0080] Example 6

[0081] Field sampling and testing of ginseng black spot pathogen

[0082] Soil samples were collected from seven areas in Jilin Province where black spot disease frequently occurs. DNA was extracted from the samples, and conventional PCR and real-time quantitative PCR were performed using specific primers. ddH2O was used as a negative control for each amplification. Conventional PCR products were subjected to 1% agarose gel electrophoresis, and the electrophoresis results were detected using a gel imaging system. The suitability of the real-time quantitative PCR primers was also tested, and the real-time quantitative PCR amplification curves were observed. Figure 8 As shown in Table 3, Alternaria ginseng was detected in the soil of Tonghua City, Jilin Province.

[0083] Table 3. Quantitative detection results of ginseng black spot fungus in soil samples collected from different regions.

[0084] Serial number Sample number Collection site Ginseng growth age Sample sending date Black spot detection result Ct value 1 BSZ Changbai Town, Baishan City, Jilin Province 4 2025.4.18 No 2 JLTH1 Jilin Tonghua 4 2025.4.18 Yes 33.89±0.22 3 JLTH2 Jilin Tonghua 4 2025.4.18 Yes 33.64±0.19 4 BSFSX Songjianghe Town, Fusong County, Baishan City, Jilin Province 4 2025.4.18 No 5 NMGKEQ Inner Mongolia, Kerqin 4 2025.3.19 No 6 DD Dandong 4 2025.3.19 No 7 JLJA Jilin Jilin City 4 2025.3.19 No 8 SBS Shenbi 4 2025.3.19 No

[0085] Example 7

[0086] DNA purification compensation

[0087] Step 1: Soil DNA Extraction and Internal Control Monitoring

[0088] Soil samples from the 0-20 cm layer of ginseng cultivation sites in Tonghua, Jilin Province, were collected and initially extracted using the TIANGEN Soil Genomic DNA Extraction Kit. Simultaneously, internal control primers targeting the soil microbial housekeeping gene (16S rRNA) were added for real-time quantitative PCR amplification. The normal threshold for the internal control gene Ct value was set at 28.5 ± 1.5 (i.e., the 27.0-30.0 range).

[0089] Step 2: Trigger the compensation procedure

[0090] When the internal reference Ct value of a sample reaches 31.2 (offset +2.7), it is determined that there is interference from inhibitors, and the DNA purification compensation program is initiated:

[0091] Take 1 g of the original soil sample, add CTAB lysis buffer containing 5% polyvinylpyrrolidone, lyse in a 65℃ water bath for 2 h, and purify by silica gel membrane adsorption column.

[0092] Add a humic acid remover (sodium citrate-EDTA mixture) during the elution stage.

[0093] After purification, the DNA was analyzed using NanoDrop, and the ratios were A260 / A280 = 1.92 and A260 / A230 = 1.85.

[0094] Step 3: The internal reference gene was repeatedly amplified using the purified DNA as a template, with a Ct value of 29.1, within the regression threshold range. Subsequently, ginseng Alternaria specificity detection was performed, detecting a Ct value of 33.8 (not detected before correction).

[0095] Example 8

[0096] During the testing process, when a soil sample from the Changbai Mountain ginseng growing area had a Ct value of 34.8 (within the critical range of 34.5 ≤ Ct < 35.5), a verification procedure was initiated. First, the same DNA template was retested using a different batch of PCR reagents, yielding a Ct value of 34.6. Subsequently, the sample was retested using a real-time quantitative PCR instrument from a different manufacturer, resulting in a Ct value of 34.9. Simultaneously, using the internal reference gene correction method, the measured Ct value of the internal reference gene in this sample was 29.3, differing from the preset threshold of 28.5 by +0.8. This difference was added to the original Ct value of 34.8, resulting in a corrected Ct value of 35.6. Based on the combined results of the three tests, it was determined that the sample did not contain *Alternaria ginseng*. This procedure significantly reduced the risk of false positives and ensured the reliability of the test results.

[0097] Although embodiments of the present invention have been disclosed above, they are not limited to the applications listed in the specification and embodiments. It can be applied to various fields suitable for embodiments of the present invention. Other modifications can be readily implemented by those skilled in the art. Therefore, without departing from the general concept defined by the claims and their equivalents, embodiments of the present invention are not limited to the specific details and illustrations shown and described herein.

Claims

1. Specific detection primers for Alternaria ginseng, the pathogen causing black spot in ginseng, characterized in that, The primers are: a pair of primers with base sequences as shown in SEQ ID NO: 2 and SEQ ID NO: 3 and a pair of primers with base sequences as shown in SEQ ID NO: 4 and SEQ ID NO:

5.

2. A method for detecting Alternaria ginseng, the pathogen causing black spot in ginseng, characterized in that, 1) Extract genomic DNA from the microorganisms in the plants, seeds, or soil to be tested; 2) Using the genomic DNA from step 1) as a template, perform PCR amplification using a pair of primers such as SEQ ID NO: 2 and SEQ ID NO: 3; Using the genomic DNA from step 1) as a template, real-time quantitative PCR amplification was performed using a pair of primers such as SEQ ID NO: 4 and SEQ ID NO: 5; 3) Determine the length of the PCR amplification product obtained in step 2). If a product with the target detection value is detected in the PCR amplification product, it is determined that the source sample of the template genomic DNA contains Alternaria ginseng, and the target detection value is 413 bp. When using real-time quantitative PCR amplification detection, the following steps are performed: The quantitative linear regression equation is y = -3.6597x + 41.234, where y is the Ct value and x = lg[DNA concentration]. The correlation coefficient R² between the logarithm of the standard DNA concentration and the Ct value is > 0.

99. When the Ct value is ≥ 35, the sample is considered to be free of Alternaria ginseng, and when the Ct value is < 35, the sample is considered to contain Alternaria ginseng.

3. The detection method as described in claim 2, characterized in that, The lowest concentration for detection using real-time quantitative PCR amplification is 0.5 fg / μL.

4. The detection method as described in claim 2, characterized in that, During the PCR amplification step, an internal reference gene amplification system was simultaneously added. This internal reference gene is a housekeeping gene of microorganisms stably present in soil. When the Ct value of the internal reference gene deviates from a preset threshold by ±1.5, DNA purification compensation was initiated. DNA was re-extracted from the original soil sample using a chemical lysis-silica membrane adsorption method, including the addition of a humic acid scavenger. The purified DNA was retested for nucleic acid concentration and purity, and the A260 / A280 ratio was 1.8-2.0 and the A260 / A230 ratio was ≥1.

8. The purified DNA was used as a template for repeated real-time quantitative PCR detection until the Ct value of the internal reference gene returned to the threshold range.

5. The detection method as described in claim 4, characterized in that, When 34.5 ≤ Ct value < 35.5, initiate the verification procedure, which includes any one or a combination of the following steps: a) Use PCR amplification reagents from different batches and manufacturers to re-perform real-time quantitative PCR detection on the same sample DNA; b) Use another real-time quantitative PCR instrument to re-perform real-time quantitative PCR detection on the same sample DNA; c) Correction using the Ct value of the internal reference gene: Calculate the difference between the measured Ct value of the internal reference gene and its median value at a preset threshold; Add this difference to the Ct value to obtain the corrected Ct value; The Ct values ​​obtained after retesting in steps a) and b), or the corrected Ct values ​​calculated in step c), are used to re-determine whether the sample to be tested contains Alternaria ginseng.

6. The application of the specific detection primers as described in claim 1 in the detection of Alternaria ginseng.

Images