Application of lactobacillus johnsonii in prevention and treatment of radiation-induced lung injury

By using a drug prepared from Lactobacillus johnsonii, the problem of the ineffectiveness of existing treatments for radiation-induced lung injury was solved, and effective prevention and treatment of radiation-induced lung injury, especially radiation-induced lung fibrosis, was achieved. The drug significantly improved weight loss, respiratory function and lung tissue damage in mice.

CN120617328BActive Publication Date: 2025-11-18ACADEMY OF MILITARY MEDICAL SCIENCES
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511134224.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-08-14
Publication Date
2025-11-18
Estimated Expiration
2045-08-14

AI Technical Summary

Technical Problem

Existing treatments for radiation-induced lung injury, such as glucocorticoids and anti-infective therapies, can only improve symptoms and cannot effectively cure the condition. Furthermore, amifostine has significant side effects. Therefore, it is of great importance to find drug intervention targets without side effects.

Method used

The drug, prepared in oral or solution form using Lactobacillus johnsonii as the active ingredient, is used to prevent and treat radiation-induced lung injury, including radiation-induced pulmonary fibrosis, at a dose of not less than 10⁸ CFU/d.

Benefits of technology

Lactobacillus johnsonii significantly improves radiation-induced lung injury, including weight loss, respiratory dysfunction, and tissue inflammation. It effectively alleviates radiation-induced pulmonary fibrosis by improving lung coefficient, respiratory function, and lung tissue pathology results, which show reduced inflammation and collagen deposition.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120617328B_ABST
    Figure CN120617328B_ABST
Patent Text Reader

Abstract

The application provides application of lactobacillus johnsonii in prevention and treatment of radiation-induced lung injury, and belongs to the technical field of biological medicine. The application provides application of lactobacillus johnsonii in preparation of a medicine for preventing and / or treating radiation-induced injury. It is found that lactobacillus johnsonii can improve weight loss of mice caused by ionizing radiation, increase lung coefficient, and relieve physiological damage caused by ionizing radiation. After treatment with lactobacillus johnsonii, the damage of lung coefficient and respiratory function of mice caused by irradiation is improved. It is proved that administration of lactobacillus johnsonii can improve radiation-induced lung injury of mice.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biological medicine, and particularly relates to application of lactobacillus rhamnosus in prevention and treatment of radiation-induced lung injury. BACKGROUND

[0002] Radiation-induced lung injury (RILI) is a common complication of chest tumor radiotherapy, and is clinically divided into early radiation-induced pneumonia and late radiation-induced pulmonary fibrosis (RIPF). Clinical symptoms include vomiting, shortness of breath, chest pain, fever, and even respiratory failure and death. At present, the treatment mainly includes glucocorticoids, anti-infection and symptomatic support treatment, which can only improve symptoms and cannot be effectively treated.

[0003] Amifostine is the first pan-cell protective agent approved for listing by the US FDA. Through continuous research by clinicians, it is found that amifostine can protect normal cells from damage by radiotherapy and chemotherapy drugs, but amifostine has a large side effect, such as causing gastrointestinal dysfunction, hypotension, hypocalcemic tetany and other adverse reactions in the body. Therefore, it is of great clinical application value to find a drug intervention target with diagnostic potential for the prevention and treatment of radiation-induced lung injury. SUMMARY

[0004] The application provides application of lactobacillus rhamnosus in prevention and treatment of radiation-induced lung injury, and the lactobacillus rhamnosus has a significant prevention and treatment effect on radiation injury.

[0005] The application provides application of lactobacillus rhamnosus in preparation of a medicine for preventing and / or treating radiation injury.

[0006] In a preferred mode of the application, the dosage form of the medicine includes an oral preparation.

[0007] In a preferred mode of the application, the daily dosage of lactobacillus rhamnosus in the medicine is not less than 10 8 CFU / d in mice.

[0008] In a preferred mode of the application, the radiation injury includes radiation-induced weight loss and / or radiation-induced lung injury.

[0009] In a preferred mode of the application, the radiation-induced lung injury includes radiation-induced pulmonary fibrosis.

[0010] In a preferred mode of the present application, the prevention and / or treatment comprises at least one of the following: improving radiation-induced weight loss, improving radiation-induced respiratory dysfunction, reducing radiation-induced tissue inflammatory factor content, and improving radiation-induced pulmonary fibrosis.

[0011] In a preferred mode of the present application, the detection index of respiratory dysfunction comprises at least one of the following: conductive parameters maximum inspiratory flow, maximum expiratory flow, tidal volume, and airway obstruction parameters airway stenosis index.

[0012] The present application also provides a medicine for preventing and / or treating radiation injury, taking the Lactobacillus sp. as an active ingredient, and further comprising a pharmaceutically acceptable adjuvant.

[0013] In a preferred mode of the present application, when the medicine is administered in the form of a solution, PBS is used as the solvent.

[0014] In a preferred mode of the present application, the daily dosage of the Lactobacillus sp. in the medicine is not less than 10 8 CFU / d for mice.

[0015] Beneficial effects: The present application provides the use of the Lactobacillus sp. in the preparation of a medicine for preventing and / or treating radiation injury. It is proved in the examples of the present application that the content of the Lactobacillus sp. in the feces of mice decreases four months after ionizing radiation. Meanwhile, it is found through experiments on mice subjected to ionizing radiation that the Lactobacillus sp. can improve the weight loss and increase the lung coefficient of mice caused by ionizing radiation, and can also relieve physiological damage caused by ionizing radiation. After treatment with the Lactobacillus sp., the damage of ionizing radiation to the lung coefficient and respiratory function of mice is improved. In order to further clarify the therapeutic effect of the Lactobacillus sp. on the inflammatory stage of radiation-induced pulmonary fibrosis, the inflammatory infiltration and alveolar structure damage of lung tissue of mice are analyzed through the results of lung tissue pathological section staining, and it is found that the inflammatory cell infiltration is improved and the alveolar septum gradually returns to normal after one month of treatment with the Lactobacillus sp. Subsequently, the lung tissue pathological section of mice is subjected to Masson staining and semi-quantitative scoring, and it is found that the collagen deposition is improved after administration of the Lactobacillus sp. It is proved in the present application that administration of the Lactobacillus sp. can improve the radiation-induced lung injury of mice. BRIEF DESCRIPTION OF DRAWINGS

[0016] Figure 1 Figure 1 is a result graph of the influence of irradiation on the intestinal flora of mice, in which A: Alpha analysis, B: Observed_species index, C: Shannon index, and D: Lactobacillus sp. content.

[0017] Figure 2The experimental flowchart and results of Lactobacillus johnsonii improving radiation-induced pulmonary fibrosis are shown in the figure. A: Experimental flowchart, B: Body weight, C: Lung coefficient.

[0018] Figure 3 The graph shows the improvement of physiological indicators in mice caused by irradiation with Lactobacillus johnsonii. In the graph, A: PIF, B: Penh, and C: PEF.

[0019] Figure 4 The figure shows the effect of irradiation on the lung coefficient and respiratory function of mice after treatment with Lactobacillus johnsonii. In the figure, A: expression level of inflammatory factor IL-1β in serum, B: expression level of inflammatory factor IL-6 in serum, C: expression level of inflammatory factor IL-1β in lung tissue, and D: expression level of inflammatory factor IL-6 in lung tissue.

[0020] Figure 5 The images show the pathological staining results of lung tissue sections. In the images, A: HE staining results, and B: semi-quantitative scoring results.

[0021] Figure 6 The images show the pathological staining results of lung tissue sections. In the images, A: MASSON staining results, and B: collagen quantitative results. Detailed Implementation

[0022] This invention provides the use of Lactobacillus johnsonii in the preparation of medicaments for the prevention and / or treatment of radiation damage.

[0023] The Lactobacillus johnsonii described in this invention ( Lactobacillus johnsonii Purchased from BNCC Beina Biotechnology, product number 186384, in 200μL lyophilized powder form.

[0024] In a preferred embodiment of the present invention, the dosage form of the drug includes an oral dosage form. In another preferred embodiment of the present invention, the daily dosage of *Lactobacillus johnsonii* in the drug, calculated in mice, is not less than 10... 8 CFU / d.

[0025] In a preferred embodiment of the present invention, the radiation damage includes radiation-induced weight loss and / or radiation-induced lung injury, specifically radiation-induced lung injury including radiation-induced pulmonary fibrosis.

[0026] In a preferred embodiment of the present invention, the prevention and / or treatment includes at least one of the following: improving radiation-induced weight loss, improving radiation-induced respiratory dysfunction, reducing the content of radiation-induced tissue inflammatory factors, and improving radiation-induced pulmonary fibrosis. The detection indicators for respiratory dysfunction in the present invention include at least one of the following: conductivity parameters such as maximum inspiratory flow rate, maximum expiratory flow rate, tidal volume, and airway obstruction parameter such as the airway stenosis index.

[0027] The application also provides a medicine for preventing and / or treating radiation injury, which takes the about Lactobacillus as an active ingredient and further comprises a pharmaceutically acceptable adjuvant.

[0028] In a preferred mode of the application, when the medicine is administered in the form of a solution, PBS is used as a solvent, and during preparation, the bacterial solution is centrifuged at 3000 rpm for 5 min, and then resuspended with PBS.

[0029] In a preferred mode of the application, the daily dose of the about Lactobacillus in the medicine is not less than 10 8 CFU / d for mice.

[0030] In order to further illustrate the application, the application of the about Lactobacillus provided by the application in preventing and treating radiation-induced lung injury is described in detail below in combination with examples, but they should not be understood as limiting the protection scope of the application.

[0031] Example 1

[0032] High-throughput 16S rRNA gene sequencing was performed on the feces of 1-month-old C57BL / 6J mice using irradiation (20 Gy γ-ray single whole chest local irradiation), and Alpha analysis of the generalized linear model found that there were 277 OTUs (Operational Taxonomic Units) common to the NC group without irradiation and the IR group with irradiation, 243 OTUs specific to the NC group, and 95 OTUs specific to the IR group (Fig. 1A). Figure 1 The Alpha Diversity method was used to analyze the diversity of microbial communities. Compared with the NC group, the Observed_species and Shannon index of the IR group decreased significantly (Fig. 1B and Fig. 1C), indicating that the number of intestinal flora species in the radiation-induced lung fibrosis mice decreased. Figure 1 RT-qPCR was performed on the whole genome extracted from the feces of the radiation-induced lung fibrosis mice, and it was found that the content of the about Lactobacillus in the feces of the mice decreased after four months of ionizing radiation (Fig. 1D). Figure 1

[0033] The primers used for RT-qPCR detection are as follows:

[0034] M-L-F (SEQ ID No. 1): TCGAGCGAGCTTGCCTAGATGA;

[0035] M-L-R (SEQ ID No. 2): TCCGGACAACGCTTGCCACC.

[0036] Example 2​

[0037] 1. Animal experiment: Each mouse was force-fed 5×10 for seven consecutive days. 8 The bacterial culture was administered at a rate of 200 μL per day via gavage. After one week of gavage, a single 20 Gy gamma irradiation of the entire chest was performed.

[0038] The experimental animals were divided into three groups:

[0039] NC+Vehicle: PBS administered via gavage only;

[0040] IR+Vehicle: PBS administered via gavage plus irradiation group;

[0041] IR+LJ: Lactobacillus thymosus administered by gavage + irradiation group;

[0042] For Lactobacillus johnsonii administered via gavage: the bacterial culture solution was allowed to stand and then quantified to 5 × 10⁻⁶. 8 After quantification (CFU / mL), the bacterial culture was centrifuged at 3000 rpm for 5 min, the culture medium was discarded, and 2 mL of PBS was added for resuspending.

[0043] 2. Experimental procedure:

[0044] NC+Vehicle group: After one week of acclimatization, PBS was administered by gavage for one week;

[0045] IR+Vehicle group: After one week of acclimatization, the animals were given PBS by gavage for one week and 20 Gy gamma rays for one local irradiation of the whole chest.

[0046] IR+LJ group: After one week of acclimatization, the patient was given Lactobacillus thymosus by gavage for one week, followed by one 20 Gy gamma ray irradiation of the whole chest area.

[0047] After 30 days of feeding following irradiation, samples were collected to observe mouse body weight, lung coefficient, and HE and Masson staining results of lung tissue.

[0048] 4. Experimental Results

[0049] 4.1 Lactobacillus johnsonii improves radiation-induced pulmonary fibrosis

[0050] This invention uses 8-week-old male C57BL / 6J mice to establish a mouse model of radiation-induced pulmonary fibrosis. First, the C57BL / 6J mice were administered Lactobacillus johnsonii via gavage for one week, followed by a 20 Gy... 60 Mice were subjected to a single whole-chest irradiation with Co-γ rays, and their body weight was dynamically monitored at different time points after irradiation. One month post-irradiation, the mice's body weight and respiratory function were assessed, and the results are as follows: Figure 2As shown, the weight of the mice decreased significantly after one month of irradiation, and the weight of the mice increased after administration of the Lactobacillus casei; the lung coefficient of the mice increased significantly after one month of irradiation, and the lung coefficient decreased after administration of the Lactobacillus casei, indicating that the Lactobacillus casei can improve the weight loss of the mice caused by IR Figure 2 The lung coefficient increased (Fig. 2B). Figure 2

[0051] 4.2 Improvement of physiological indicators of mice caused by irradiation by Lactobacillus casei

[0052] The present application dynamically monitors the respiratory function indicators of mice within five minutes at different time points after irradiation. The results are shown in Fig. 3. Figure 3 As shown, the maximum inspiratory flow (PIF) and the maximum expiratory flow (PEF) of the mice decreased after one month of irradiation, and the maximum inspiratory flow and the tidal volume increased after administration of the Lactobacillus casei (Fig. 3A and C); the airway obstruction parameter airway narrowing index (Penh) increased after irradiation, and decreased after administration of the Lactobacillus casei (Fig. 3B). It indicates that the Lactobacillus casei can alleviate the physiological damage caused by ionizing radiation. Figure 3 Figure 3 4.3 Improvement of lung coefficient and respiratory function of mice caused by irradiation after treatment by Lactobacillus casei

[0053] After one month of 20 Gy 60 Co γ-ray whole chest single irradiation, the serum and lung tissue of the mice were collected, and the expression levels of inflammatory factors IL-1β and IL-6 were detected by ELISA and RT-qPCR.

[0054] Primer information is as follows:

[0055] Primer information is as follows:

[0056] Internal reference-F (SEQ ID No. 3): TGCTGTCCCTGTATGCCTCT;

[0057] Internal reference-R (SEQ ID No. 4): TTTGATGTCACGCACGATTT;

[0058] IL-1β-F (SEQ ID No. 5): GAAATGCCACCTTTTGACAGTG;

[0059] IL-1β-R (SEQ ID No. 6): TGGATGCTCTCATCAGGACAG;

[0060] IL-6-F (SEQ ID No. 7): CTGCAAGAGACTTCCATCCAG;

[0061] ​​IL-6-R (SEQ ID No. 8): AGTGGTATAGACAGGTCTGTTGG.

[0062] Results as shown in Figure 4 Lactobacillus johnsonii can improve the increase of serum inflammatory factors in mice caused by irradiation (Fig. 1A, B), and can also alleviate the increase of inflammatory factors in lung tissue of mice caused by irradiation (Fig. 1C, D), indicating that Lactobacillus johnsonii can alleviate lung injury caused by ionizing radiation. Figure 4 Figure 4 Results as shown in

[0063] 4.4 Therapeutic effect of Lactobacillus johnsonii on the inflammatory stage of radiation-induced pulmonary fibrosis

[0064] The present application analyzes the inflammatory infiltration and alveolar structure damage of mouse lung tissue by staining the pathological sections of mouse lung tissue. Results as shown in Figure 5 Fig. 2A, B, C, D, H&E staining of lung tissue shows that the alveolar septum of mice after irradiation is widened, and the degree of inflammatory cell infiltration is significantly increased. After Lactobacillus johnsonii treatment for 1 month, the inflammatory cell infiltration is improved, and the alveolar septum gradually returns to normal.

[0065] Masson staining was performed on the pathological sections of mouse lung tissue and semi-quantitative scoring was performed. Results as shown in Figure 6 Fig. 3A, B, C, D, collagen deposition after Lactobacillus johnsonii administration was improved.

[0066] In summary, administration of Lactobacillus johnsonii can improve the radiation-induced lung injury in mice.

[0067] Although the above embodiments have made a detailed description of the present application, it is only a part of the embodiments of the present application, not all the embodiments, and other embodiments can be obtained according to the present embodiments without creativity, which are within the protection scope of the present application.​

Claims

1. The use of *Lactobacillus johnsonii* in the preparation of medicaments for the prevention and / or treatment of radiation damage, characterized in that, The Lactobacillus johnsonii was purchased from BNCC Beina Biotechnology, with the serial number 186384. The radiation damage includes radiation-induced weight loss and / or radiation-induced pulmonary fibrosis. The prevention and / or treatment include at least one of the following: improving radiation-induced weight loss, improving radiation-induced respiratory dysfunction, reducing the content of radiation-induced tissue inflammatory factors, and improving radiation-induced pulmonary fibrosis.

2. The application according to claim 1, characterized in that, The dosage form of the drug includes oral dosage forms.

3. The application according to claim 1 or 2, characterized in that, The daily dosage of *Lactobacillus johnsonii* in the drug, calculated in mice, is not less than 10 mg / day. 8 CFU / d.

4. The application according to claim 1, characterized in that, The indicators for detecting respiratory dysfunction include at least one of the following: conductivity parameters, maximum inspiratory flow rate, maximum expiratory flow rate, tidal volume, and airway obstruction parameter, airway stenosis index.

Citation Information

Patent Citations

  • Lactic Acid Producing Bacteria and Lung Function

    US20090257993A1