Method for treating phosphorus-containing sewage

Abstract

The invention relates to the technical field of biotechnology sewage treatment, in particular to a phosphorus-containing sewage treatment method. The method comprises the following steps: 1) adjusting the pH value of phosphorus-containing sewage to 7.0-7.5, and supplementing sodium acetate and ammonium salt until the concentrations are 0.1-0.2 g / L and 0.01-0.04 g / L respectively; 2) inoculating phosphorus-accumulating bacteria into the sewage, wherein the inoculation concentration is 2-5%; and (3) detecting phosphorus pollutants in the sewage, and discharging the sewage after the phosphorus pollutants meet the pollution discharge standard. According to the invention, microorganisms are modified, so that the level of polyphosphates in thalli is remarkably improved, and compared with a wild type, the modification level is improved by 87.6%; after the RcsA gene is introduced, the capsule yield of the RcsA gene is obviously improved, and the content of phosphorus in severely phosphorus-polluted sewage is reduced to 8.4 mg / L, so that a foundation is laid for commercial use of the RcsA gene.

Description

Technical Field

[0001] The present invention relates to the technical field of biotechnology wastewater treatment, and in particular to a method for treating phosphorus-containing wastewater. Background Art

[0002] Eutrophication refers to a phenomenon in which nutrients in a water body change from an oligotrophic state to a eutrophic state. Eutrophication refers to an excess of nutrients in lakes, reservoirs, rivers, and even offshore oceans, which causes algae and aquatic plants to grow in large quantities in the water body, causing a phenomenon in which water quality deteriorates. Nutrients are mainly composed of nitrogen and phosphorus. Since phosphorus is the limiting factor for the growth of algae in water bodies, controlling the discharge of phosphorus is more practical than controlling the discharge of nitrogen. The phosphorus removal methods widely used at home and abroad are mainly physical and chemical phosphorus removal methods, but there are still various problems, mainly that phosphorus removal is not thorough enough, and the chemicals added in phosphorus removal cause secondary pollution. With the discovery of phosphorus-accumulating microorganisms, it is possible to use microorganisms to treat phosphorus-containing wastewater, and research on microbial phosphorus accumulation has become a hot topic.

[0003] In recent years, more and more bacterial genera have been identified as phosphate-accumulating bacteria, and microbial strains with good phosphate-accumulating effects have been continuously isolated. At the same time, as humans further study the phosphate-accumulating mechanism of phosphate-accumulating bacteria, in addition to making great achievements in obtaining efficient phosphate-accumulating bacteria, they have also made certain progress in the construction of genetically recombinant bacteria of efficient phosphate-accumulating bacteria, mainly focusing on the preparation of recombinant bacteria by overexpressing polyphosphate kinase or introducing polyphosphate kinase encoding genes.

[0004] At present, there are still the following problems in microbial phosphorus removal: the activity of polyphosphate enzymes is not high enough, and the accumulation level of polyphosphate in bacteria is still relatively low; in addition, polyphosphate-producing microorganisms contain polyphosphate esterases that decompose polyphosphate. When the polyphosphate in the bacteria reaches a certain level, it reaches a saturated state, and the accumulated polyphosphate will be at risk of being released again.

[0005] Therefore, those skilled in the art are committed to genetically engineering existing microorganisms to increase the accumulation level of polyphosphate in their bodies and improve their ability to remove phosphorus pollutants. Summary of the Invention

[0006] In view of the above-mentioned defects of the prior art, the technical problem to be solved by the present invention is how to improve the removal ability of polyphosphate bacteria for phosphorus pollutants to treat phosphorus-containing wastewater.

[0007] To achieve the above object, the present invention provides a method for treating phosphorus-containing wastewater, comprising the following steps: 1) Adjust the pH value of phosphorus-containing wastewater to 7.0-7.5, and add sodium acetate and ammonium salt to concentrations of 0.1-0.2 g / L and 0.01-0.04 g / L respectively; 2) Inoculate the above wastewater with polyphosphate bacteria at a concentration of 2-5%; 3) Detect phosphorus pollutants in sewage and discharge it if it meets the discharge standards.

[0008] Preferably, the polyphosphate bacteria are filtered using a 0.45 μm filter membrane before the sewage is discharged.

[0009] Preferably, the polyphosphate-accumulating bacteria are introduced with an expression vector of the PPK enzyme or its variant, and the PPK enzyme or its variant significantly improves the ability of the engineered bacteria to accumulate polyphosphate.

[0010] Preferably, the amino acid sequence of the PPK enzyme is shown in SEQ NO ID: 1.

[0011] Preferably, the mutation sites of the PPK enzyme variant are A257, E351, D379 and A421.

[0012] Preferably, the PPK enzyme variant is a variant in which the negatively charged amino acids at positions A257, E351, D379 and A421 are mutated into positively charged amino acids.

[0013] Preferably, the PPK enzyme variant is A257K, E351R, D379K, A421H.

[0014] Preferably, the amino acid sequence of the PPK enzyme variant is shown in SEQ NO ID: 3-6.

[0015] Preferably, the polyphosphate bacteria is also introduced with the RcsA gene.

[0016] Preferably, the RcsA gene is from Klebsiella pneumoniae 、 Salmonella enterica 、 Providencia alcalifaciens、Enterobacter hormaechei .

[0017] Preferably, the amino acid sequence of the protein encoded by the RcsA gene is shown in SEQ NO ID: 7-10.

[0018] Preferably, the polyphosphate-accumulating bacteria include eukaryotes and prokaryotes.

[0019] Preferably, the polyphosphate-accumulating bacteria comprise prokaryotic bacteria.

[0020] Preferably, the polyphosphate bacteria is E. coli BL21(DE3) .

[0021] In a preferred embodiment of the present invention, the present invention provides a bacterial agent for treating phosphorus-containing wastewater, which comprises polyphosphate bacteria, an expression vector of PPK enzyme or its variant is introduced into the polyphosphate bacteria, and the amino acid sequence of the PPK enzyme variant is shown in SEQ NO ID: 3-6.

[0022] Preferably, the polyphosphate-accumulating bacteria are further introduced with the RcsA gene, and the amino acid sequence of the protein encoded by the RcsA gene is shown in SEQ NO ID: 7-10.

[0023] The present invention transforms microorganisms and significantly increases the level of polyphosphates in the bacteria, which is 87.6% higher than the wild type. The introduction of the RcsA gene significantly increases the capsule production and reduces the phosphorus content in heavily phosphorus-polluted wastewater to 8.4 mg / L, laying the foundation for its commercial use.

[0024] The concept, specific structure and technical effects of the present invention will be further described below in conjunction with the accompanying drawings to fully understand the purpose, characteristics and effects of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 It is the result of detecting the polyphosphate level in vivo of the recombinant expression strain of the PPK enzyme mutant; Figure 2 It is a bar graph showing the capsule weight growth rate of WT, E. coli BL21(DE3) / pET-30a(+)-muA421H-Kp, E. coli BL21(DE3) / pET-30a(+)-muA421H-Se, E. coli BL21(DE3) / pET-30a(+)-muA421H-Pa and E. coli BL21(DE3) / pET-30a(+)-muA421H-Eh after 1 day of culture; Figure 3 These are the test results of the phosphorus removal ability of E.coli BL21(DE3) / pET-30a(+)-muA421H-Kp, E.coliBL21(DE3) / pET-30a(+)-muA421H-Se, E.coli BL21(DE3) / pET-30a(+)-muA421H-Pa and E.coliBL21(DE3) / pET-30a(+)-muA421H-Eh for heavy phosphorus wastewater. DETAILED DESCRIPTION

[0026] The following describes several preferred embodiments of the present invention with reference to the accompanying drawings to make its technical content clearer and easier to understand. The present invention can be embodied in many different forms of embodiments, and the scope of protection of the present invention is not limited to the embodiments mentioned herein.

[0027] The enzymes used in the examples of the present invention include: Taq DNA polymerase, ScaI restriction endonuclease, and T4 DNA ligase, all purchased from Takara Biotechnology (Dalian) Co., Ltd.; lysozyme, purchased from Tiangen Company; L-arabinose, ampicillin, and kanamycin, purchased from Sangon Biotechnology (Shanghai) Co., Ltd.; E. coli BL21 (DE3), plasmid pET-30a (+), and plasmid pET-28a (+), purchased from Novagen.

[0028] Example 1 Cloning and molecular construction of PPK gene PPK enzyme is Escherichia coli (GenBank: EHC8202420.1), the coding nucleotide sequence of PPK enzyme was codon optimized to obtain PPK gene clone, the nucleotide sequence is shown in SEQ NO ID: 2, and restriction endonuclease sites were added to the forward primer when designing primers. Hindi III. Add restriction endonuclease sites to the reverse primer Bam HI, primers F (5'-3') (CGGGATCCCAAAATGGGCCAGGAAAAACTGT) / R (5'-3') (CCCAAGCTTAAATTATTCCGGCTGTTCCAGG) were designed based on the PPK gene sequence and genomic DNA was used as a template to amplify the target gene PPK.

[0029] The PCR reaction conditions were: 95°C, initial denaturation for 5 min; 94°C, denaturation for 45 sec; 60°C, annealing for 30 sec; 72°C, extension for 2 min; 30 cycles; and a final extension at 72°C for 10 min. The enzyme used in the PCR was Pyrobest TM DNA polymerase.

[0030] The PCR amplification product was detected by 1% agarose gel electrophoresis, and then the PCR product was ligated into the pET28a vector.

[0031] Example 2 Construction of PPK enzyme mutants and recombinant expression strains According to the amino acid map, a group of negatively charged amino acids A257, E351, D379 and A421 that may affect the spatial structure of the PPK enzyme were screened out and mutated to obtain variants: A257K, E351R, D379K and A421H. The nucleotide sequences of muA257K, muE351R, muD379K and muA421H were obtained by site-directed mutagenesis. The wt and its variants were successfully cloned into the plasmid pET-30a(+), and six His tags were added to the N-terminus of the gene during the construction of the expression plasmid. The successfully constructed recombinant plasmids were transformed into Escherichia coli BL21(DE3) cells and recorded as E. coli BL21(DE3) / pET-30a(+)-WT, E. coli BL21(DE3) / pET-30a(+)-muA257K and E. coli BL21(DE3) / pET-30a(+)-muE351R, E.coli BL21(DE3) / pET-30a(+)-muD379K, E.coli BL21(DE3) / pET-30a(+)-muA421H.

[0032] Example 3 Detection of polyphosphate levels in vivo A single colony of the strain constructed in Example 2 was inoculated into 10 ml of LB liquid culture and cultured at 37°C for 12 hours. A 1% inoculum was inoculated into 50 ml of LB liquid culture medium and cultured until OD600 was approximately 0.8. IPTG was added and cultured at 16°C for 16 hours. The cells were washed three times with PBS, collected by centrifugation, and resuspended in lysis buffer. After lysis for 10 minutes, the cells were eluted, separated, and impurities removed, and the protein material was precipitated. The resulting protein was decomposed by polyspecific phosphatase PPX1 and incubated at 37°C for 20 minutes. The content of free phosphate obtained was detected by malachite green colorimetry, as shown in FIG. Figure 1 As shown, muA257K and muE351R showed a certain improvement in polyphosphate levels compared with the wt type, and muD379K showed a slight decrease in polyphosphate levels compared with the wt type. This mutant failed to improve the accumulation of polyphosphate in the bacteria. MuA421H showed the most obvious improvement in polyphosphate levels compared with the wt type, and the accumulation of polyphosphate levels increased to 87.6%, reaching 7.6 polyphosphates / protein (µmol / g).

[0033] In the experiment, the applicant found that after 3 days of culture, the polyphosphate level in the strain constructed in Example 2 no longer accumulated and reached saturation, which greatly limited the ability of the bacteria to further remove phosphorus pollutants. Polyphosphate is an important component of the Escherichia coli capsule. If a large amount of polyphosphate can be converted into capsule and stored, it will significantly enhance the ability of the strain to purify phosphorus pollutants.

[0034] The expression of bacterial capsule is regulated by genes expressed by the EPS gene group, among which the intracellular RcsC-RcsB dual signal transduction system activates the EPS gene group. RcsC is a sensor kinase and a transmembrane protein located on the cell membrane. It responds to environmental signals. A histidine residue on it is automatically phosphorylated, and through a series of phosphate relay systems, the phosphoryl group is transferred to the response regulatory protein - RcsB, making it an active transcriptional regulatory protein, thereby regulating the expression of the EPS gene group. The applicant further explored regulatory factors that can enhance EPS expression. After screening, RcsA from different species was selected to explore its role in regulating the expression of EPS, and then its impact on the ability to purify phosphorus pollutants.

[0035] Example 4 RcsA gene cloning and construction of recombinant strains Will Klebsiella pneumoniae 、 Salmonella enterica 、 Providence alcalifaciens、Enterobacter hormaechei The RcsA gene clone was inserted into the plasmid pET-32a(+), and the resulting plasmids were respectively introduced into the E. coli BL21(DE3) / pET-30a(+)-muA421H in Example 2, and were recorded as E. coli BL21(DE3) / pET-30a(+)-muA421H-Kp, E. coli BL21(DE3) / pET-30a(+)-muA421H-Se, E. coli BL21(DE3) / pET-30a(+)-muA421H-Pa and E. coli BL21(DE3) / pET-30a(+)-muA421H-Eh, wherein Klebsiella pneumoniae 、 Salmonella enterica 、 Providencia alcalifaciens, Enterobacter hormaechei The amino acid sequence of the RcsA protein encoded by the RcsA gene is shown in SEQ NO ID: 7-10.

[0036] E. coli BL21(DE3) / pET-30a(+)-muA421H-Kp, E. coli BL21(DE3) / pET-30a(+)-muA421H-Se, E. coli BL21(DE3) / pET-30a(+)-muA421H-Pa and E. coli BL21(DE3) / pET-30a(+)-muA421H-Eh were cultured for 1 day as described in Example 3, and the weight of their capsules was measured.

[0037] like Figure 2As shown in the figure, after the introduction of the RcsA gene, the capsule weights of E. coli BL21(DE3) / pET-30a(+)-muA421H-Kp, E. coli BL21(DE3) / pET-30a(+)-muA421H-Se and E. coli BL21(DE3) / pET-30a(+)-muA421H-Eh did not change significantly after 1 day of culture, while the capsule weight of the E. coli BL21(DE3) / pET-30a(+)-muA421H-Pa group increased by 21.5%.

[0038] Furthermore, in order to detect the purification effect of Example 4 on phosphorus pollutants, 100 mg / L of phosphate was added to the culture medium of the bacteria, and the recombinant strain prepared in Example 4 was cultured for 3 days. The concentration of phosphate in the culture medium was detected. Figure 3 As shown, the phosphate content in the culture medium treated with E. coli BL21(DE3) / pET-30a(+)-muA421H-Pa decreased to 8.4 mg / L.

[0039] Example 5 Phosphorus-containing wastewater treatment process Adjust the pH value of phosphorus-containing wastewater to 7.0-7.5, and add sodium acetate and ammonium salt to concentrations of 0.1-0.2 g / L and 0.01-0.04 g / L respectively; The above sewage was inoculated with the polyphosphate-accumulating bacteria (E. coli BL21(DE3) / pET-30a(+)-muA421H-Pa) prepared in Example 4 at an inoculation concentration of 2-5%; The phosphorus pollutants in the sewage are tested. Once they meet the sewage discharge standards, the polyphosphate bacteria are filtered out using a 0.45μm filter membrane and the sewage is discharged.

[0040] The preferred embodiments of the present invention have been described in detail above. It should be understood that numerous modifications and variations based on the concepts of the present invention are possible without inventive effort by those skilled in the art. Therefore, any technical solution that can be derived by one skilled in the art through logical analysis, reasoning, or limited experimentation based on the concepts of the present invention and the prior art should be within the scope of protection defined by the claims.

Claims

1. A method for treating phosphorus-containing wastewater, comprising the following steps: 1) Adjust the pH value of phosphorus-containing wastewater to 7.0-7.5, and add sodium acetate and ammonium salt to concentrations of 0.1-0.2 g / L and 0.01-0.04 g / L respectively; 2) Inoculate the above wastewater with polyphosphate bacteria at a concentration of 2-5%; 3) Detect phosphorus pollutants in sewage and discharge it if it meets the discharge standards.

2. The method according to claim 1, characterized in that The polyphosphate bacteria were filtered using a 0.45 μm filter membrane before the sewage was discharged.

3. The method according to claim 1, characterized in that The polyphosphate bacteria are introduced into an expression vector of the PPK enzyme or its variant, and the PPK enzyme or its variant significantly improves the ability of the engineered bacteria to accumulate polyphosphate; The amino acid sequence of the PPK enzyme is shown in SEQ NO ID: 1, and the mutation sites of the PPK enzyme variant are A257, E351, D379 and A421.

4. The method according to claim 3, characterized in that The PPK enzyme variants are A257K, E351R, D379K, and A421H.

5. The method according to claim 3, characterized in that The amino acid sequences of the PPK enzyme variants are shown in SEQ NOIDs: 3-6.

6. The method according to claim 5, characterized in that The polyphosphate bacteria also introduced the RcsA gene, which is derived from Klebsiella pneumoniae 、 Salmonella enterica 、 Providencia alcalifaciens, Enterobacter hormaechei .

7. The method according to claim 6, characterized in that The amino acid sequence of the protein encoded by the RcsA gene is shown in SEQ NO ID: 7-10.

8. The method according to claim 3, characterized in that The polyphosphate bacteria are E. coli BL21(DE3) .

9. A bacterial agent for treating phosphorus-containing wastewater, comprising polyphosphate-accumulating bacteria, wherein the polyphosphate-accumulating bacteria is introduced into an expression vector for PPK enzyme or a variant thereof, wherein the amino acid sequence of the PPK enzyme variant is shown in SEQ NO ID: 3-6.

10. The microbial agent according to claim 9, characterized in that The polyphosphate-accumulating bacteria are also introduced with the RcsA gene, and the amino acid sequence of the protein encoded by the RcsA gene is shown in SEQ NO ID: 7-10.

Images