Galactose yeast-like bacterium with fermentation product having multivitamin anti-aging effect, fermentation product filtrate of galactose yeast-like bacterium, and preparation method and application of fermentation product filtrate

Abstract

The invention discloses galactose yeast-like bacteria with a fermentation product having a multi-vitamin anti-aging effect, a fermentation product filtrate of the galactose yeast-like bacteria, and a preparation method and application of the fermentation product filtrate. The preparation method comprises the following steps: S1, preparing a single colony plate; s2, preparing a seed solution; s3, fermentation culture; and S4, preparing a galactose yeast-like bacterium fermentation product filtrate. Experiments prove that the fermentation product filtrate of the galactose yeast-like bacterium CFFSH021 obtained in the invention has multiple-effect and multi-dimensional anti-aging functions, including reduction of DNA damage, reduction of ROS level in cells, reduction of functional inactivation of mitochondrial mPTP protein, reduction of aging cell proportion, improvement of nuclear fiber layer protein expression level, reduction of nematode oxidative stress level and prolongation of nematode life; the anti-aging polypeptide has the effects of resisting aging, resisting saccharification, improving the fibroblast functionality to resist functional decline of cells and reducing expression of cell aging-related phenotypes, so that aging of cells, skin and individuals can be delayed in a multi-dimensional and multi-target manner, and the anti-aging polypeptide can be widely applied to cosmetics and skin care products.

Description

Technical Field

[0001] The present invention relates to the field of fermentation technology, in particular to a galactosaccharomyces-like bacterium whose fermentation products have multidimensional anti-aging effects, a fermentation product filtrate thereof, and a preparation method and application of the fermentation product filtrate. Background Art

[0002] In the field of skincare, common skincare benefits include moisturizing, soothing, repairing, whitening, and anti-wrinkle, among others, but the most crucial skincare benefit is delaying aging. Almost all skin problems stem from aging of the skin and its cells. For example, aging causes a decrease in the collagen synthesis capacity of fibroblasts and increases the secretion of metalloproteinases associated with apoptosis, which in turn exacerbates the breakdown of the extracellular matrix and the formation and exacerbation of wrinkles. Cellular aging causes cell atrophy and slows down cell proliferation, leading to increased intercellular spaces. This not only slows down the renewal of the stratum corneum but also reduces the cell barrier function, resulting in rough skin and a decrease in the skin's ability to retain and hold moisture. Cellular aging also exacerbates cellular pigmentation, leading to dark spots and dark spots on the skin. Therefore, the fundamental issue in skincare is how to delay the aging of the skin and its cells.

[0003] Galacto-Saccharomyces is a listed raw material in the "Catalogue of Used Cosmetic Raw Materials (2021 Edition)" and has a wide range of applications in the field of cosmetics and skin care. The most well-known one is Pitera, an ingredient added to SKII's Facial Treatment Essence. TM It is said that it originated from the fact that researchers found that the faces of old sake brewers with wrinkles were full of wrinkles, but they had a pair of young and delicate hands. Scientists believe that it was caused by some products produced during the fermentation process of sake. TM The inventor, Japanese scholar Kashiwayama, isolated and cultured more than 350 different microorganisms from sake, and finally found a microorganism called galactosaccharomyces (deposit number FERM-P N0.4821, PCT Pub.NO.W081 / 00723), whose fermentation products have the effect of promoting wound healing and repair. The filtrate of the fermentation product of Pitera galactosaccharomyces in SKII essence was also found to be able to inhibit aging factors in the epidermis, fight skin aging, and reduce skin wrinkles. However, cell and skin aging is the result of the joint action of multiple factors and multiple pathways. It is difficult to cope with the multiple and diverse aging-inducing factors and aging pathways by targeting a single link or aging factor of aging, thereby achieving the function of delaying skin aging in more application scenarios and user groups. In the prior art field, a galactosaccharomyces and its fermentation products have not yet been found that can play a multi-pathway, multi-site, and multi-effect anti-aging role against multiple anti-aging pathways and targets.

[0004] Currently, in-depth screening and research are underway on the preparation methods and strains of galactosidase-like fermentation product filtrates, in the hope of developing and identifying more effective galactosidase-like fermentation products and their preparation strains. The strain is crucial in determining the efficacy of galactosidase-like fermentation product filtrates.

[0005] Chinese patent CN116869870A discloses a galactosidase-like fermentation product filtrate with moisturizing, firming and soothing effects, as well as its preparation method and application. The method is to ferment the independently discovered and isolated Bethmus spp. (preservation number: CCTCC NO: M 2023647) in a fermentation matrix containing grain mash, lactose and milk powder to obtain a galactosidase-like fermentation product. The independently isolated Bethmus spp. and the prepared galactosidase-like fermentation product filtrate have good repair effects through testing and comparison.

[0006] Chinese patent CN115125153A discloses the use of Trichosporon asahii in the preparation of a galactosaccharomyces-like fermentation product filtrate. The galactosaccharomyces-like fermentation product filtrate prepared by fermentation of Trichosporon asahii activates the antioxidant system to inhibit the oxidative stress of pro-inflammatory cytokines, has excellent antioxidant and anti-inflammatory properties, and can be used to produce antioxidant and anti-inflammatory products.

[0007] Chinese patent CN116218694A discloses a galactosaccharomyces fermentation product filtrate prepared by the fungus Coccidioides cingulosus (deposit number CCTCC NO: M20221857) and its application. The galactosaccharomyces fermentation product filtrate prepared by fermenting the fungus Coccidioides cingulosus has better skin firming and rejuvenation, brightening and repairing effects.

[0008] Chinese patent CN119564566A discloses a filtrate of a galactosidase-like fermentation product prepared by a microorganism called fermentation factor, which is an unknown species with a preservation number of CGMCC No. 31156. The fermentation product filtrate does not contain ethanol, and the filtrate can significantly increase the content of active ingredients such as exopolysaccharides, small molecule peptides, and organic acids, so that the obtained fermentation liquid has a significant improvement effect on skin repair and inflammation repair.

[0009] Unfortunately, although the filtrates of galactosidase-like fermentation products have been found to have a variety of skin care benefits, and some have been found to have inhibitory effects on certain aging factors, there has not yet been found a galactosidase-like bacteria and its filtrate that has multi-dimensional anti-aging functions and can delay cell aging.

[0010] In view of this, the present application provides a new galactose yeast-like bacteria and its fermentation products. The fermentation products or fermentation product filtrate of this strain can act on multiple pathways and factors that lead to skin and cell aging, achieving the effect of delaying skin and cell aging under multiple effects. Summary of the Invention

[0011] The purpose of the present invention is to provide a galactosaccharomyces-like fungus whose fermentation products have multidimensional anti-aging effects, its fermentation product filtrate, and a preparation method and application of the fermentation product filtrate. By integrating fermentation technology with the galactosaccharomyces-like fungus strain CFFSH021, etc., a galactosaccharomyces-like fungus fermentation product filtrate with multidimensional anti-aging effects is produced, which acts on multiple aging-related targets and pathways to delay aging, and is used in skin care products.

[0012] To achieve the above-mentioned purpose, the present invention provides, on the one hand, a galactosaccharomyces-like fungus whose fermentation products have multidimensional anti-aging effects. The galactosaccharomyces-like fungus is galactosaccharomyces-like fungus CFFSH021, and its taxonomic Latin name is Galactomycescandidus CFFSH021. The galactosaccharomyces-like fungus CFFSH021 was deposited in the China Center for Type Culture Collection on April 11, 2025, with a deposit number of CCTCC NO: M 2025750.

[0013] Another aspect of the present invention provides a method for preparing the fermentation product filtrate of the galactosidase-like bacteria as described above, comprising the following steps:

[0014] S1: Preparation of single colony plates: Activate the frozen stored Galacto-Saccharomyces cerevisiae-like bacteria CFFSH021, inoculate it onto a plate medium by streak method, and culture it to obtain a single colony plate of Galacto-Saccharomyces cerevisiae-like bacteria CFFSH021;

[0015] S2: Seed solution preparation: Pick a bacterial lawn of the galactosomal yeast CFFSH021 and inoculate the bacterial lawn into a liquid culture medium to obtain a seed solution;

[0016] S3: Fermentation culture: The seed liquid is inoculated into the liquid culture medium. The fermentation liquid obtained after the fermentation is the fermentation product of the galactose yeast-like bacteria;

[0017] S4: Preparation of a filtrate of a fermentation product of a galactosidase-like yeast: centrifuging the fermentation broth obtained in step S3 to obtain a supernatant, and then filtering and sterilizing the supernatant to obtain a filtrate of a fermentation product of a galactosidase-like yeast;

[0018] Wherein, in step S3, the seed liquid is inoculated into the liquid culture medium at an inoculum amount of 1-10% by weight for propagation.

[0019] According to an embodiment of the present application, the liquid culture medium used in step S3 is any one of the following combinations:

[0020] Combination 1: glucose, yeast powder, peptone

[0021] Combination 2: glucose, milk powder, yeast extract powder

[0022] Combination 3: malt extract, milk powder, yeast extract powder

[0023] Combination 4: rice flour and milk powder.

[0024] According to an embodiment of the present application, the liquid culture medium may further be supplemented with one of alanine, methionine, whey protein, animal milk and milk powder.

[0025] According to an embodiment of the present application, the specific steps of step S1 include: taking out the glycerol tube of the Galacto-Saccharomyces cerevisiae CFFSH021 at -80°C, taking an appropriate amount of glycerol bacterial solution on a YPD plate medium using a sterile inoculation needle in a clean bench, inoculating the plate medium using the polygonal streak method, culturing at 28°C to form a bacterial lawn, and then placing the culture in a 4°C refrigerator for standby use;

[0026] Among them, the specific preparation method of YPD liquid culture medium is: add 6g of glucose, 6g of peptone, 3g of yeast extract powder, and 4.5g of agar into deionized water and stir. After fully dissolving, adjust the pH to between 6.0-6.1 with dilute saline, and then make up to 300mL with deionized water. Sterilize at 115℃ for 20min. After sterilization is completed, pour the plate into the clean room and cool it to solidify.

[0027] According to an embodiment of the present application, the specific steps of step S2 include: picking 3 rings of galactose yeast-like fungi CFFSH021 with an inoculation loop on a clean workbench and placing it into 300 mL of YPD liquid culture medium, and placing it in a shaker and culturing it at 28°C and 220 rpm for 26 hours to obtain seed liquid; wherein the OD600 is between 3.0-4.0, and 300 mL of YPD liquid culture medium includes 6 g of glucose, 6 g of peptone and 3 g of yeast extract powder.

[0028] According to an embodiment of the present application, the specific steps of step S3 include: using a fermentation tank as a culture tank and YPD liquid culture medium as a fermentation culture medium, sterilizing at 115°C for 20 minutes, inoculating the seed liquid into the fermentation culture medium at an inoculum amount of 5% by weight, and the fermentation conditions are: fermentation temperature 28°C, fixed speed 250rpm, ventilation volume 100L / h, tank pressure 0.05Mpa, and culturing until the glucose concentration is less than 0.5g / L and the pH recovery range is greater than 0.1, stopping the fermentation and releasing the tank, and the fermentation broth obtained by fermentation is the fermentation product of galactose yeast-like bacteria.

[0029] According to an embodiment of the present application, step S4 specifically includes the following steps: centrifuging the fermentation broth obtained in step S3, the centrifugation conditions are: 6000rpm, 15min, removing the lower layer of bacterial mud after centrifugation, and taking the supernatant; filtering the obtained supernatant through a three-stage microfiltration membrane of 0.45μm, 0.22μm, and 0.10μm in sequence for sterilization, and the filtrate obtained by filtration is the filtrate of the fermentation product of galactose yeast-like bacteria.

[0030] In another aspect of the present application, a galactosidase-like bacteria fermentation product filtrate obtained by using the above-mentioned method for preparing a galactosidase-like bacteria fermentation product filtrate is disclosed.

[0031] The fourth aspect of the present application provides the use of the filtrate of the fermentation product of the galactosidase-like bacteria as described above in a skin care formula.

[0032] The beneficial effects of the technical solution of the present invention compared with the prior art are:

[0033] The filtrate of the fermentation product of the Galacto-Saccharomyces-like bacteria CFFSH021 provided by the present invention has multi-dimensional anti-aging effects:

[0034] 1. Fighting against cell aging caused by DNA damage due to free radicals: In the present invention, the fermentation product of the galactosidase-like yeast CFFSH021 was found to significantly reduce DNA damage caused by free radicals, thereby achieving the goal of fighting against aging induced by DNA damage caused by free radicals;

[0035] 2. Maintaining the function of mitochondrial membrane permeability transition pore protein and slowing down aging caused by mitochondrial functional decline: The fermentation product filtrate of the Galacto-Saccharomyces cerevisiae CFFSH021 provided by the present invention can prevent and reduce mitochondrial functional decline and mPTP permeability protein failure caused by free radical stress, and has a good delaying effect on cell aging caused by mitochondrial mPTP functional decline;

[0036] 3. Reduce intracellular reactive oxygen species (ROS) levels and reduce aging caused by oxidative cell damage: The fermentation product filtrate of the Galacto-Saccharomyces cerevisiae CFFSH021 provided by the present invention can reduce the intracellular reactive oxygen species level caused by free radicals, thereby delaying oxidative cell damage and inhibiting aging caused by reactive oxygen species (ROS) and oxidative cell damage;

[0037] 4. Impact on individual oxidative stress levels: The fermentation product filtrate of the Galacto-Saccharomyces cerevisiae CFFSH021 provided by the present invention can reduce the oxidative stress level under free radical stress at the individual level in Caenorhabditis elegans, a model organism for aging research, and has a delaying effect on aging induced by free radical damage and oxidative stress.

[0038] 5. Impact on Multiple Aging-Related Secretory Phenotypes of Skin Aging: The fermentation product filtrate of the Galacto-Saccharomyces cerevisiae-like strain CFFSH021 provided by the present invention has been found to target multiple aging-related secretory phenotypes during skin aging, including: 1) increasing fibroblast activity and cell proliferation and replication; 2) reducing cell functional decline and improving the ability of fibroblasts to synthesize collagen and elastin; 3) reducing cellular aging-related secretory phenotypes and the expression of matrix metalloproteinase 1 (MMP1), thereby comprehensively blocking the vicious cycle of skin aging and delaying and preventing precipitous skin aging.

[0039] 6. Enhance the stability of the nuclear membrane structure and delay aging: The fermentation product filtrate of the Galacto-Saccharomyces cerevisiae CFFSH021 provided by the present invention can inhibit the expression reduction of Lamin B1 under free radical stress, enhance the maintenance of nuclear function and structural stability, and delay cell aging;

[0040] 7. Enhance the expression of the "longevity gene" SIRT1: The fermentation product filtrate of the Galacto-Saccharomyces cerevisiae-like bacteria CFFSH021 provided by the present invention can promote the expression of the SIRT1 gene in cells, thereby delaying aging related to SIRT1 gene decline;

[0041] 8. β-galactosidase is an important marker of cellular senescence that can be used to indicate the proportion of senescent cells. In a specific embodiment, the fermentation product filtrate of the galactosidase-like yeast CFFSH021 was found to reduce the proportion of senescent cells in the overall cell population through labeling with the cell senescence marker β-galactosidase.

[0042] 9. Anti-glycation effect: The fermentation product filtrate of the Galacto-Saccharomyces cerevisiae CFFSH021 provided by the present invention has a certain anti-glycation effect, reducing the formation of AGEs, thereby achieving the effect of delaying skin aging;

[0043] 10. Impact on aging phenotypes at the individual level: The fermentation product filtrate of the galactosidase-like bacteria CFFSH021 provided by the present invention can prolong the median survival time of nematodes at the individual level by 33%. The fermentation product of the galactosidase-like bacteria CFFSH021 provided by this application can reduce the area and level of red zones on the skin, reduce the number and depth of wrinkles, and can also show anti-aging effects at the individual human level. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 This is a photo of the colony morphology of the Galacto-Saccharomyces cerevisiae CFFSH021 exemplified in the present invention;

[0045] Figure 2 This is a microscopic photo of the microscopic morphology of the Galacto-Saccharomyces cerevisiae CFFSH021 exemplified in the present invention;

[0046] Figure 3 This is a microscopic fluorescence photograph showing the effect of the filtrate of the fermentation product of the galactosidase-like bacteria on the DNA damage of HaCat cells induced by hydrogen peroxide;

[0047] Figure 4 This is a microscopic fluorescence photograph of the results of the filtrate of the fermentation product of the galactosidase-like bacteria of the present invention for the detection of the mitochondrial permeability transition pore (MPTP) of HaCat cells induced by hydrogen peroxide;

[0048] Figure 5 A histogram showing the fluorescence intensity of the results of the detection of the ROS level in HaCat cells induced by hydrogen peroxide by the filtrate of the fermentation product of the galactosidase-like bacteria of the present invention;

[0049] Figure 6 This is a microscopic fluorescence photograph of the effect of the fermentation product filtrate of the galactosidase-like bacteria of the present invention on the Caenorhabditis elegans CF1553 under hydrogen peroxide induction;

[0050] Figure 7 A bar graph showing the effect of the filtrate of the fermentation product of the galactosidase-like bacteria of the present invention on the expression level of the longevity gene SIRT1 in HaCat cells;

[0051] Figure 8 This is a bar graph showing the effect of the filtrate of the fermentation product of Galacto-Saccharomyces cerevisiae on the expression level of LaminB1 in HaCat cells induced by hydrogen peroxide;

[0052] Figure 9 This is a micrograph showing the effect of the fermentation product filtrate of the galactosidase-like bacteria on the activity of the cell apoptosis marker β-galactosidase;

[0053] Figure 10 This is a bar graph showing the effect of the filtrate of the fermentation product of the galactosidase-like bacteria on the expression of type I collagen (col-1) according to an example of the present invention;

[0054] Figure 11 This is a bar graph showing the effect of the filtrate of the fermentation product of the galactosidase-like bacteria on the expression of elastin (ELN) according to an example of the present invention;

[0055] Figure 12 This is a bar graph showing the effect of the filtrate of the fermentation product of the galactosidase-like bacteria on the expression of matrix metalloproteinase (MMP-1) according to the present invention;

[0056] Figure 13 This is a micrograph showing the effect of the filtrate of the fermentation product of the galactosidase-like bacteria on melanin formation in B16 cells;

[0057] Figure 14 This is a bar graph showing the effect of the filtrate of the fermentation product of Galacto-Saccharomyces cerevisiae on the formation of glycosylated collagen according to an example of the present invention;

[0058] Figure 15 This is a bar graph showing the effect of the filtrate of the fermentation product of the galactosidase-like bacteria on the viability of HSF cells;

[0059] Figure 16 This is a micrograph (crystal violet staining) showing the effect of the filtrate of the fermentation product of the galactosidase-like bacteria on HSF cell proliferation.

[0060] Figure 17 This is a schematic diagram of the survival rate curve of the filtrate of the galactose yeast-like fermentation product of the present invention on the life span of nematodes;

[0061] Figure 18 This is a comparison picture of the human eye area tested in the present invention before and after the use of the filtrate of the fermentation product of the Galacto-Saccharomyces cerevisiae CFFSH021;

[0062] Figure 19 This is a comparison picture of the changes in the red zone on the face of the human efficacy test subjects before and after using the filtrate of the fermentation product of Galacto-saccharomyces cerevisiae CFFSH021. DETAILED DESCRIPTION

[0063] The present invention will be further described below in conjunction with the accompanying drawings and specific examples. The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention.

[0064] One aspect of the present application shows a galactosidase-like fungus whose fermentation product has multidimensional anti-aging effects. The galactosidase-like fungus is galactosidase-like fungus CFFSH021, and its taxonomic Latin name is Galactomyces candidus CFFSH021. The galactosidase-like fungus CFFSH021 was deposited in the China Center for Type Culture Collection on April 11, 2025, with a preservation number of CCTCC NO: M 2025750.

[0065] Another aspect of the present application discloses a method for preparing a filtrate of a fermentation product of the galactosidase-like bacteria as described above, comprising the following steps:

[0066] S1: preparing a single colony plate: activating the frozen stored Galacto-Saccharomyces cerevisiae-like bacteria CFFSH021, inoculating it onto a plate culture medium by the streak method, and culturing it to obtain a single colony plate of the Galacto-Saccharomyces cerevisiae-like bacteria CFFSH021.

[0067] Specifically, the specific steps of step S1 include: taking out the glycerol tube of the galactose yeast-like bacteria CFFSH021 at -80°C, taking an appropriate amount of glycerol bacterial liquid on the YPD plate culture medium using a sterile inoculation needle in the clean bench, and using the polygonal streak method to inoculate it on the plate culture medium. After culturing at 28°C to form a bacterial lawn, it is placed in a 4°C refrigerator for standby use. Among them, the specific configuration method of YPD liquid culture medium is: adding 6g of glucose, 6g of peptone, 3g of yeast extract powder, and 4.5g of agar to deionized water and stirring. After fully dissolving, adjust the pH to between 6.0-6.1 with dilute saline, and then dilute to 300mL with deionized water. Sterilize at 115°C for 20min. After sterilization is completed, pour the plate in the clean bench and cool and solidify.

[0068] S2: Seed solution preparation: Pick a bacterial moss of the galactosidase-like fungus CFFSH021, inoculate the bacterial moss into a liquid culture medium, and culture the moss to obtain a seed solution.

[0069] Specifically, the specific steps of step S2 include: picking 3 rings of galactose yeast-like fungi CFFSH021 with an inoculation loop on a clean workbench and placing it into 300 mL of YPD liquid culture medium, and placing it in a shaker and culturing it at 28°C and 220 rpm for 26 hours to obtain seed liquid; wherein the OD600 is between 3.0-4.0, and 300 mL of YPD liquid culture medium includes 6 g of glucose, 6 g of peptone and 3 g of yeast extract powder.

[0070] S3: Fermentation culture: The seed liquid is inoculated into YPD liquid culture medium. The fermentation liquid obtained after the fermentation is the fermentation product of galactose yeast-like bacteria.

[0071] Wherein, in step S3, the seed liquid is inoculated into the liquid culture medium at an inoculum amount of 1-10% by weight for propagation.

[0072] Specifically, the YPD liquid medium used in step S3 can be any of the following combinations: Combination 1: glucose, yeast powder, and peptone; Combination 2: glucose, milk powder, and yeast extract powder; Combination 3: malt extract, milk powder, and yeast extract powder; Combination 4: rice flour and milk powder. Preferably, the YPD liquid medium can also be supplemented with any of alanine, methionine, whey protein, animal milk, and milk powder to enhance the anti-aging efficacy of the filtrate of the fermentation product of the galactosidase-like yeast.

[0073] Specifically, the specific steps of step S3 include: using a fermentation tank as a culture tank and YPD liquid culture medium as a fermentation medium, sterilizing at 115°C for 20 minutes, inoculating the seed liquid into the fermentation medium at an inoculum amount of 5% by weight, and fermentation conditions are: fermentation temperature 28°C, fixed speed 250rpm, ventilation volume 100L / h, tank pressure 0.05Mpa, culturing until the glucose concentration is less than 0.5g / L and the pH rises by more than 0.1, stopping the fermentation and releasing the tank, and the fermentation broth obtained by fermentation is the fermentation product of galactose yeast-like bacteria.

[0074] S4: Preparation of filtrate of galactosidase-like yeast fermentation product: The fermentation broth obtained in step S3 is centrifuged to obtain the supernatant, and the supernatant is then filtered and sterilized to obtain filtrate of galactosidase-like yeast fermentation product.

[0075] Specifically, step S4 specifically includes the following steps: centrifuging the fermentation broth obtained in step S3, the centrifugation conditions are: 6000 rpm, 15 min, removing the lower layer of bacterial mud after centrifugation, and taking the supernatant; filtering the obtained supernatant through 0.45 μm, 0.22 μm, and 0.10 μm three-stage microfiltration membranes for sterilization, and the filtrate obtained by filtration is the filtrate of the fermentation product of galactose yeast-like bacteria.

[0076] In another aspect of the present application, a galactosidase-like bacteria fermentation product filtrate obtained by using the above-mentioned method for preparing a galactosidase-like bacteria fermentation product filtrate is disclosed.

[0077] The fourth aspect of the present application discloses the use of the filtrate of the fermentation product of the galactosidase-like bacteria as described above in a skin care formula.

[0078] The main reagents and instruments involved in the embodiments of the present invention are as follows:

[0079] Fetal bovine serum (FBS, Shanghai Bosheng Biotechnology Co., Ltd., FB-1058 / 500); penicillin-streptomycin dual antibody stock solution (Shanghai Bosheng Biotechnology Co., Ltd., XC-A4122 / 100); DMEM medium (Shanghai Bosheng Biotechnology Co., Ltd., LM-D1110 / 500); mitochondrial permeability transition pore (MPTP) detection kit (Biyuntian Biotechnology Co., Ltd., C2009S); ROS kit (Biyuntian Biotechnology Co., Ltd., S0034S); fluorescence microplate reader (MD, SpectraMax i3x); M9 buffer (manufacturer: PHYGENE); ELISA kit (Human Lamin B1 ELISA Detection Kit (96T), Addison Biotechnology Co., Ltd.); β-galactosidase staining kit (Biyuntian Biotechnology Co., Ltd., C0602); nucleic acid extraction kit (Golden Weichi Biotechnology Co., Ltd., ER501); reverse transcription kit (Golden Weichi Biotechnology Co., Ltd., AT311), qPCR kit (Golden Weichi Biotechnology Co., Ltd., AQ601); all experimental water used was laboratory-made RO pure water.

[0080] Example 1 Classification and identification of Galacto-Saccharomyces cerevisiae CFFSH021

[0081] (1) Colony morphology

[0082] The white fluffy colonies formed by strain CFFSH021 on YPD agar medium (morphology see Figure 1 ), fine burr-like hyphae appeared on the surface of the colony, and then covered with milky white hyphae. Figure 2 This is a microscopic morphology of the strain CFFSH021. The hyphae are septate, transparent, and branched. They can break into arthroconidia, which easily break into rectangular or cylindrical arthroconidia after maturation. Yeast-like cells can form elliptical to spherical budding cells (similar to yeast) in liquid culture, exhibiting typical characteristics of Galacto-like yeasts. This strain was named Galacto-like yeast CFFSH021.

[0083] (2) Molecular biological identification

[0084] The ITS1F / ITS4 primer pair was used to amplify the ITS gene region of the Galactomyces-like strain CFFSH021 by PCR and compared it. The ITS fragment was found to be 99.9% similar to that of Galactomyces candidus CBS 178.71 (GenBank: GCA_030564105.1). Therefore, the Galactomyces-like strain CFFSH021 was identified as Galactomyces candidus.

[0085] Example 2 Preparation of Galacto-Saccharomyces Fermentation Product Filtrate

[0086] Prepare single colony plates: Remove the glycerol tube from the Galactomyces candidus CFFSH021 stored at -80°C. Use a sterile inoculating needle to take an appropriate amount of glycerol culture solution on YPD agar plates using the polygonal streak method. Inoculate the agar plates at 28°C to form a lawn, then place in a 4°C refrigerator until ready for use.

[0087] The formula of YPD solid plate culture medium is: 6g glucose, 6g peptone, 3g yeast extract powder, and 4.5g agar. After adding appropriate amount of deionized water to fully dissolve, adjust the pH to between 6.0-6.1 with HCl and then make up to 300mL with deionized water. Sterilize at 115℃ for 20min. After sterilization is completed, pour the plate into the clean room and cool to solidify.

[0088] (2) Seed liquid preparation: Use an inoculation loop to pick up 3 rings of Galacto-Saccharomyces cerevisiae CFFSH021 bacterial moss on a clean bench and place it into 300 mL of YPD liquid culture medium. Place it in a shaker at 28°C and 220 rpm for 26 hours. At this time, the OD600 should be between 3.0 and 4.0.

[0089] The formula of YPD liquid culture medium is: 6 g glucose, 6 g peptone, 3 g yeast extract powder, and the volume is adjusted to 300 mL.

[0090] (3) Fermentation culture: A 10L fermentation tank is used as the culture tank, and YPD liquid medium (fixed volume 6L) is used as the fermentation medium. The sterilization condition is 115℃ for 20min. The seed liquid is inoculated into the fermentation medium at an inoculum rate of 5% by weight. The fermentation temperature is 28℃, the fixed speed is 250rpm, the ventilation volume is 100L / h, and the tank pressure is 0.05Mpa. The culture is carried out until the glucose is exhausted (less than 0.5g / L) and the pH begins to rise (the pH rise is greater than 0.1, which is considered to be a rise). Then the fermentation can be stopped and the tank can be released. The changes in glucose and pH during the fermentation process are as follows: Figure 1 As shown, glucose and pH reached the lowest point at 17.5h, and pH rebounded by more than 0.1 at 18.5h. The fermentation of this batch was terminated at 18.5 and the fermentation broth obtained was the fermentation product of galactose yeast-like bacteria.

[0091] (4) Preparation of the filtrate of the fermentation product of the galactosidase-like bacteria: The fermentation broth obtained in step (3) was centrifuged (6000 rpm, 15 min), the lower bacterial sludge was removed, and the supernatant was obtained. The obtained supernatant was sterilized by filtering through three microfiltration membranes of 0.45 μm, 0.22 μm, and 0.10 μm in sequence. The filtrate obtained by filtration was the filtrate of the fermentation product of the galactosidase-like bacteria;

[0092] Example 3: Test on the Effect of Galacto-Saccharomyces Fermentation Product Filtrate on Reducing DNA Damage Caused by Free Radicals

[0093] The test sample was a filtrate of the fermentation product of the Galactomyces spp. strain CFFSH021, obtained according to the method of Example 2. HaCaT cells were used as the test cells, H2O2 was used as the mechanism of free radical-induced DNA damage, and γ-H2AX was used as a DNA damage marker. The effect of the fermentation product filtrate of the Galactomyces spp. strain CFFSH021 on DNA damage was tested at different concentrations.

[0094] The test steps are as follows:

[0095] A) Cell plating: HaCaT cells were seeded at a concentration of 1×105 cells / mL in a 96-well plate (100 μL per well) using DMEM medium containing 10% fetal bovine serum and 1% penicillin-streptomycin antibody stock solution. The plates were incubated at 37°C with 5% CO2 for 24 h.

[0096] B) Sample loading: Use DMEM medium (containing 1% penicillin-streptomycin dual antibody stock solution), discard the solution in the wells, and load 5 parallel wells for each concentration, with 100 μL per well. Stimulate for 72 hours.

[0097] BC group: replaced with 100uL DMEM medium (containing 1% penicillin-streptomycin dual antibody stock solution)

[0098] NC group: replaced with 100uL DMEM medium (containing 1% penicillin-streptomycin dual antibody stock solution)

[0099] Sample group: replaced with DMEM medium supplemented with galactosaccharomyces fermentation product filtrate (galactosaccharomyces fermentation product filtrate prepared according to Example 2), the final concentration of the test sample in the medium is: 0.1%, 0.01%

[0100] C) H2O2 injury: Use PBS to prepare a 1.5 mM H2O2 stock solution and refrigerate in the dark until use.

[0101] Except for the BC group, 20uL of H2O2 stock solution was added to each well to make the final concentration 250uM and allowed to stand at room temperature for 1h.

[0102] Immunofluorescence staining:

[0103] The DNA damage detection kit was used to determine the intensity of the fluorescence, and the average fluorescence intensity was calculated using ImageJ software.

[0104] The test results are as follows Figure 3 As shown, the green fluorescence labeled γ-H2AX and the blue fluorescence DAPI labeled cell nucleus decreased by 60.6% and 55.5% at the 0.1% and 0.01% test levels respectively compared with the BC group, indicating that the filtrate of the fermentation product of galactosidase-like bacteria has a certain effect in protecting DNA from H202 damage.

[0105] Example 4 Effect of the Filtrate of Galacto-Saccharomyces Fermentation Product on the Function of Mitochondrial Channel Proteins

[0106] The test used keratinocyte (HaCAT) cell line as the test cells, and used H202 to create stress, causing mitochondrial functional decline, resulting in decreased mitochondrial permeability transition pore (mPTP) functionality and increased permeability damage, thereby testing the effect of the fermentation product filtrate of the galactosidase-like yeast CFFSH021 on the functional decline of mitochondrial mPTP protein caused by free radicals.

[0107] The testing process is as follows:

[0108] A) Cell plating: HaCaT cells were seeded at a concentration of 1×105 cells / mL in a 96-well plate (100 μL per well) using DMEM medium containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin dual antibody stock solution. The plates were incubated at 37°C with 5% CO2 for 24 h.

[0109] B) Sample loading: Use DMEM medium (1% penicillin-streptomycin double antibody stock solution), discard the solution in the wells, and stimulate for 72 hours with 5 parallel wells for each concentration and 100 μL per well.

[0110] BC group: replaced with 100uL DMEM medium (1% penicillin-streptomycin dual antibody stock solution)

[0111] NC group: replaced with 100uL DMEM medium (1% penicillin-streptomycin dual antibody stock solution)

[0112] Sample group: replaced with DMEM medium supplemented with galactosaccharomyces fermentation product filtrate (galactosaccharomyces fermentation product filtrate prepared according to Example 2). The final concentration of the test sample in the medium is: 1%, 0.1%, 0.01%

[0113] C) H₂O₂ stress: Prepare a 1.5 mM H₂O₂ stock solution in PBS and refrigerate in the dark until use. Except for the BC group, add 20 μL of H₂O₂ stock solution to each well to a final concentration of 250 μM. Incubate at room temperature for 1 hour to induce free radical stress.

[0114] D) Immunofluorescence staining:

[0115] The mitochondrial permeability transition pore (MPTP) detection kit was used for determination, and the mean fluorescence intensity was calculated using ImageJ software.

[0116] The test results are as follows Figure 4 As shown in the data, after the mitochondrial permeability transition pore of the positive control group was fully opened, the quencher entered the mitochondria, resulting in quenching of the fluorescent substance in the mitochondria, and the fluorescence intensity was 0. Compared with the BC group, the proportion of "vacuolization" in the sample group at the test levels of 0.01%, 0.1%, and 1% was significantly reduced, indicating that the fluorescence intensity of individual cells gradually increased, that is, the mitochondrial permeability transition pore was low in opening, less quencher entered, and more fluorescent substances were intercepted. The statistical average fluorescence intensity increased by 6.5%, 15%, and 18.6%, respectively. Therefore, it can be seen that the filtrate of the fermentation product of galactosidase has the effect of protecting mitochondria and inhibiting mPTP dysfunction.

[0117] Example 5 Effect of the Fermentation Product Filtrate of Galacto-Saccharomyces CFFSH021 on the Level of Intracellular ROS under Free Radical Stress

[0118] The test used keratinocytes (HaCAT) as the test model, used H202 stress model to increase the ROS level of cells, and tested the regulatory effect of the fermentation product filtrate of galactose yeast-like bacteria CFFSH021 on the intracellular ROS level under free radical stress.

[0119] The testing process is as follows:

[0120] A) Cell plating: HaCaT cells were seeded at a concentration of 1×105 cells / mL in a 96-well plate (100 μL per well) using DMEM medium containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin dual antibody stock solution. The plates were incubated at 37°C with 5% CO2 for 24 h.

[0121] B) Sample loading: Use DMEM medium (1% penicillin-streptomycin dual antibody stock solution), discard the solution in the wells, and load 5 parallel wells for each concentration, with 100 μL per well. Stimulate for 72 hours.

[0122] BC group: replaced with 100 μL DMEM medium (1% penicillin-streptomycin dual antibody stock solution)

[0123] NC group: replaced with 100 μL DMEM medium (1% penicillin-streptomycin dual antibody stock solution)

[0124] Sample group: replaced with DMEM medium supplemented with galactosaccharomyces fermentation product filtrate (galactosaccharomyces fermentation product filtrate prepared according to Example 2), the final concentration of the test sample in the medium is: 0.01%

[0125] C) Incubate the probe: Protect from light throughout the process

[0126] According to the ROS kit instructions, the protein was diluted 1000-fold using serum-free medium to a final concentration of 10 μM.

[0127] Discard the solution in the wells, wash once with serum-free medium, and add 100 μL of fluorescent probe to each well. Incubate in the incubator for 20 minutes according to the instructions. After incubation, wash twice with serum-free medium to fully remove the probe that has not entered the cells.

[0128] D) H2O2 stress: Prepare a 1.5 mM H2O2 stock solution using PBS and store in the dark until use.

[0129] Except for the BC group, 20 μL of H2O2 stock solution was added to each well to a final concentration of 250 μM and the cells were placed in an incubator for 1 h.

[0130] E) Measure fluorescence intensity

[0131] Fluorescence intensity (488 nm, 525 nm) was measured using a fluorescence microplate reader (MD, SpectraMax i3x)

[0132] The test results are as follows Figure 5 As shown in the results, at a test level of 0.01%, the average fluorescence intensity of cells incubated with the filtrate of the fermentation product of Galacto-Saccharomyces cerevisiae decreased by 25%, indicating that it has the effect of protecting cells from free radical stress and reducing intracellular reactive oxygen species (ROS) damage. This has the effect of delaying aging caused by oxidative damage.

[0133] Example 6 Effect of the Filtrate of the Fermentation Product of Galactomyces elegans on the Oxidative Stress State of Caenorhabditis elegans CF1553

[0134] The filtrate of the fermentation product of the Galacto-Saccharomyces cerevisiae obtained in Example 2 was used as the test sample. CF1553 was used as the test subject (the SOD enzyme gene was linked to the green fluorescent protein (GFP) gene as a reporter gene, and the two genes were expressed in tandem). When the nematode enters a state of oxidative stress, oxidative stress-related enzymes (including SOD) in the nematode are activated. The GFP reporter gene can report the expression level of the SOD enzyme, and the degree and level of oxidative stress in the nematode can be determined by the fluorescence intensity.

[0135] Test method:

[0136] A) Synchronization of Nematodes: Wash CF1553 Caenorhabditis elegans from a culture dish with M9 buffer (PHYGENE) and transfer to a 15 mL centrifuge tube. Centrifuge at 600 g for 15-30 seconds. Carefully remove the supernatant with a pipette to avoid resuspending the nematodes. Prepare bleaching lysis buffer according to the following formula (NaOH: NaClO: H2O, 1:2:7). Start a timer and add 5 mL of lysis buffer to each tube. Cover and shake continuously. Lysis is complete when the majority of the nematodes begin to disappear from the solution. Immediately add approximately 10 mL of M9+ buffer to each tube, quickly mix, and centrifuge at 4000 rpm for 2 minutes. Discard the supernatant. Repeat this washing process at least three times. The resulting eggs are plated at a predetermined density on NGM plates covered with OP50 microspheres and incubated at 20°C.

[0137] B) Sample testing: Caenorhabditis elegans CF1553, grown to the L4 stage after synchronization, were plated onto NGM plates containing 5% galactose yeast-like fermentation product filtrate. A blank control (BC) and a negative control (NC) were set up, with 30 cells per well in a 12-well plate. 50 μL of OP50 bacterial solution was added and the plates were incubated at 20°C. 0.1% hydrogen peroxide was added to both the NC and sample groups, while all other parameters remained unchanged.

[0138] C) Detection: After 72 hours, the autofluorescence intensity of the nematodes was observed under a fluorescence microscope, and the average fluorescence intensity of the nematodes was calculated using ImageJ software.

[0139] The test results are as follows Figure 6 As shown: Compared with the BC group, the fluorescence intensity of the NC group was significantly increased, indicating that hydrogen peroxide successfully induced CF1553 into an oxidative stress state; compared with the NC group, the fluorescence intensity of the sample group decreased by 82% at a test concentration of 5%, that is, the expression of SOD enzyme was significantly reduced, indicating that the sample can reduce the oxidative stress state of CF1553 to a certain extent.

[0140] Example 7 Effect of the Filtrate of Galacto-Saccharomyces Fermentation Product on the "Longevity Gene" SIRT1

[0141] Human skin fibroblasts (HSF) were used as a test model to test the regulatory effect of the fermentation product filtrate of Galacto-Saccharomyces cerevisiae CFFSH021 on the expression level of SIRT1 in HSF cells.

[0142] Test method:

[0143] A) Cell plating: Using DMEM medium containing 15% fetal bovine serum (FBS) and 1% penicillin-streptomycin dual antibody stock solution, HSF were seeded at a concentration of 1×105 cells / mL in a 96-well plate (100 μL per well). Incubate at 37°C, 5% CO2 in a humidified incubator for 24 h.

[0144] B) Sample addition: Discard the solution in the wells, add 100 μL to each well of 5 parallel wells for each concentration, and incubate for 48 h.

[0145] BC group: replaced with 100uL DMEM medium (1% penicillin-streptomycin dual antibody stock solution)

[0146] Sample group: replaced with DMEM medium supplemented with galactosaccharomyces fermentation product filtrate (galactosaccharomyces fermentation product filtrate prepared according to Example 2), the final concentration of the test sample in the medium is: 0.1%

[0147] C) Assay: Cell supernatant was collected and SIRT1 content was determined according to the ELISA kit instructions.

[0148] The test results are as follows Figure 7 As shown: At the 0.1% test level, the filtrate of the fermentation product of galactosidase has the effect of upregulating the expression level of SIRT1, with an upregulation rate of 18% compared with the BC group, indicating that the sample can delay aging by upregulating the expression of the "longevity gene" SIRT1.

[0149] Example 8 Effect of the Filtrate of Galacto-Saccharomyces Fermentation Product on the Expression of Lamin B1

[0150] Decreased expression of the nuclear lamin protein LaminB1 is both a cause and a consequence of cellular aging. It plays a significant role in maintaining the functional stability of the nucleus. Using human skin fibroblasts (HSF) as a test model, the authors used H2O2 stress to reduce LaminB1 levels in the cells. The authors also tested the effect of a fermentation product filtrate of the galactosidase-like yeast CFFSH021 on regulating LaminB1 levels in cells exposed to free radical stress.

[0151] Test method:

[0152] A) Cell plating: Using DMEM medium containing 15% fetal bovine serum (FBS) and 1% penicillin-streptomycin dual antibody stock solution, HSF were seeded at a concentration of 1×105 cells / mL in a 96-well plate (100 μL per well). Incubate at 37°C, 5% CO2 in a humidified incubator for 24 h.

[0153] B) H2O2 stimulation: Prepare a 600 μM H2O2 stock solution in PBS and refrigerate in the dark until ready for use. Discard all remaining solutions and add 100 μL of serum-free DMEM medium (containing a penicillin-streptomycin antibody stock solution) to each well. For all other wells except the BC group, add 20 μL of H2O2 stock solution to each well to a final concentration of 100 μM. Incubate for 2 h.

[0154] C) Sample addition: Discard the solution in the wells, add 100 μL to each well of 5 parallel wells for each concentration, and incubate for 24 h.

[0155] BC group: replaced with 100 μL DMEM medium (1% penicillin-streptomycin dual antibody stock solution)

[0156] NC group: replaced with 100 μL DMEM medium (1% penicillin-streptomycin dual antibody stock solution)

[0157] Sample group: replaced with 100 μL DMEM medium supplemented with galactosaccharomyces fermentation product filtrate (galactosaccharomyces fermentation product filtrate prepared according to Example 2), the test concentration is: 0.1%

[0158] D) Determination: The cell supernatant was collected and the Lamin B1 content was determined according to the ELISA kit instructions.

[0159] The test results are as follows Figure 8 As shown: at a test level of 0.1%, the filtrate of the fermentation product of galactosidase has the effect of upregulating the expression level of LaminB1, which can be increased by 130% compared with the NC group, indicating that the sample can maintain the stability of the nuclear membrane to a certain extent and resist the decline of cell nuclear function caused by aging.

[0160] Example 9 Effect of the Filtrate of Galacto-Saccharomyces Fermentation Product on the Ratio of Senescent Cells

[0161] The test used skin fibroblasts (HSF) as the test cells, and induced cell senescence by H202 stress model, and tested the regulatory effect of the fermentation product filtrate of galactosidase-like bacteria CFFSH021 on the level of cell senescence under free radical stress.

[0162] Test method:

[0163] Cell plating: Use DMEM medium containing 15% fetal bovine serum (FBS) and 1% penicillin-streptomycin dual antibody stock solution to seed HSF at a concentration of 1×105 Ce11 / mL in a 96-well plate (100 μL per well). Place in a 37°C, 5% CO2 incubator and culture for 24 hours.

[0164] B) H2O2 stimulation: Prepare a 600 μM H2O2 stock solution in PBS and refrigerate in the dark until ready for use. Discard all remaining solutions and add 100 μL of serum-free DMEM medium (containing a penicillin-streptomycin antibody stock solution) to each well. For all other wells except the BC group, add 20 μL of H2O2 stock solution to each well to a final concentration of 100 μM. Incubate for 2 h.

[0165] C) Sample addition: Discard the solution in the wells, add 100 μL to each well of 5 parallel wells for each concentration, and continue culturing for 24 h.

[0166] BC group: replaced with 100 μL DMEM medium (1% penicillin-streptomycin dual antibody stock solution)

[0167] NC group: replaced with 100 μL DMEM medium (1% penicillin-streptomycin dual antibody stock solution)

[0168] Sample group: replaced with 100 μL of DMEM medium supplemented with galactosaccharomyces fermentation product filtrate (galactosaccharomyces fermentation product filtrate prepared according to Example 2), the test concentration is: 0.01%

[0169] D) Assay: Follow the instructions of the commercially available β-galactosidase staining kit.

[0170] The test results are as follows Figure 9 As shown in the staining results, there were no senescence-positive cells in the BC group, 54% in the NC group, and 26% in the sample group. The sample group had a 52% reduction in senescence-positive cells compared to the BC group. Furthermore, it was shown that the filtrate of the fermentation product of the Galacto-Saccharomyces cerevisiae-like bacteria can attenuate the cell morphological damage caused by hydrogen peroxide. This indicates that the sample, at a test concentration of 0.01%, can attenuate the degree of cell senescence induced by hydrogen peroxide.

[0171] Example 10: Effect of the Filtrate of Galacto-Saccharomyces Fermentation Product on the Synthesis of Type I Collagen

[0172] The test used skin fibroblasts (HSF) as the test model to test the regulatory effect of the fermentation product filtrate of Galacto-Saccharomyces CFFSHO21 on the expression level of type I collagen in cells.

[0173] Test method:

[0174] A) Cell plating: Adjust the HSF cell suspension concentration to 1×10 5 cells / mL with DMEM medium containing 15% fetal bovine serum (FBS), then inoculate into 24-well plates, 1 mL per well, and place in a 37°C, 5% CO 2 incubator for 24 h.

[0175] B) Sample loading: A blank control group (BC), a positive control group (PC), and a test sample group (n=3) were established. 100 μL of DMEM medium (1% penicillin-streptomycin dual antibody stock solution) was added to the BC group. The PC group was added with DMEM medium containing 100 ng / mL TGF-β1 and 1% penicillin-streptomycin dual antibody stock solution. The test sample group was added with DMEM medium containing 0.01% galactosidase-like yeast fermentation product filtrate and 1% penicillin-streptomycin dual antibody stock solution (galactosidase-like yeast fermentation product filtrate prepared according to Example 2). The volume of liquid added to each well was 1 mL. After sample loading, the cells were incubated in an incubator for 48 h.

[0176] C) Detection: Collect cells and determine the relative expression of type I collagen COL-1 in each group of cells according to the instructions of commercially available nucleic acid extraction kits, reverse transcription kits, and qPCR kits. The primer sequences are as follows:

[0177] GAPDH-F: ATCTTCCAGGAGCGAGATCC

[0178] GAPDH-R: CTGCAAATGAGCCCCAGCCT

[0179] COL1-F: TAGGGTCTAGACATGTTCAGCTTTGTCOL1-R: GTGATTGGTGGGATGTCTTCGT)

[0180] The test results are as follows Figure 10 As shown: at the 0.1% test level, the expression of type I collagen in the galactosidase-like bacteria fermentation filtrate group increased by 16% compared with the control group, indicating that the sample can improve skin toughness by upregulating the expression of col-1, thereby achieving the effect of firming and anti-wrinkle, and fighting against cell functional decline and aging.

[0181] Example 11: Effect of the Filtrate of Galacto-Saccharomyces Fermentation Product on the Expression of Elastin (ELN)

[0182] The test used skin fibroblasts (HSF) as the test model to test the regulatory effect of the fermentation product filtrate of Galacto-Saccharomyces cerevisiae CFFSH021 on the expression level of cell elastin.

[0183] Test method:

[0184] A) Cell plating: Adjust the HSF cell suspension concentration to 1×10 5 cells / mL with DMEM medium containing 15% fetal bovine serum (FBS), then inoculate into 24-well plates, 1 mL per well, and place in a 37°C, 5% CO 2 incubator for 24 h.

[0185] B) Sample loading: A blank control group (BC), a positive control group (PC), and a test sample group (n=3) were established. 100 μL of DMEM medium (1% penicillin-streptomycin dual antibody stock solution) was added to the BC group. The PC group was added to DMEM medium containing 100 ng / mL TGF-β1 and 1% penicillin-streptomycin dual antibody stock solution. The test sample group was added to DMEM medium containing 0.01% galactosidase-like yeast fermentation product filtrate and 1% penicillin-streptomycin dual antibody stock solution (galactosidase-like yeast fermentation product filtrate prepared according to Example 2). The volume of liquid added to each well was 1 mL. After sample loading, the cells were incubated in an incubator for 48 h.

[0186] C) Detection: Collect cells and determine the relative expression of ELN in each group of cells according to the instructions of commercially available nucleic acid extraction kits, reverse transcription kits, and qPCR kits. The primer sequences are as follows:

[0187] GAPDH-F: ATCTTCCAGGAGCGAGATCC

[0188] GAPDH-R: CTGCAAATGAGCCCCAGCCT

[0189] ELN-F:CTAAATACGGTGCTGCTGGC

[0190] ELN-R: CATGGGATGGGGTTACAAAG

[0191] The test results are as follows Figure 11 As shown: at the 0.01% test level, the ELN expression in the galactosidase-like bacteria fermentation filtrate group increased by 64% compared with the BC group, indicating that the sample can increase the expression of elastin, improve skin elasticity, thereby exerting a firming and anti-wrinkle effect, and fighting against cell functional decline and aging.

[0192] Example 12 Effect of the Filtrate of Galacto-Saccharomyces Fermentation Product on the Expression of Matrix Metalloproteinases (MMP-1)

[0193] The test used skin fibroblasts (HSF) as the test model to test the regulatory effect of the fermentation product filtrate of Galacto-Saccharomyces cerevisiae CFFSH021 on the expression level of cellular matrix metalloproteinase MMP-1.

[0194] Test method:

[0195] A) Cell plating: Adjust the HSF cell suspension concentration to 1×10 5 cells / mL with DMEM medium containing 15% fetal bovine serum (FBS), then inoculate into 24-well plates, 1 mL per well, and place in a 37°C, 5% CO 2 incubator for 24 h.

[0196] B) Sample loading: A blank control group (BC), a positive control group (PC), and a test sample group (n=3) were established. 100 μL of DMEM medium (1% penicillin-streptomycin dual antibody stock solution) was added to the BC group. The PC group was added to DMEM medium containing 100 ng / mL TGF-β1 and 1% penicillin-streptomycin dual antibody stock solution. The test sample group was added to DMEM medium containing 0.01% galactosidase-like yeast fermentation product filtrate and 1% penicillin-streptomycin dual antibody stock solution (galactosidase-like yeast fermentation product filtrate prepared according to Example 2). The volume of liquid added to each well was 1 mL. After sample loading, the cells were incubated in an incubator for 48 h.

[0197] C) Detection: Cell supernatants were collected and the expression level of matrix metalloproteinase (MMP-1) in the cell supernatants of each group was determined according to the operating instructions of a commercially available human matrix metalloproteinase (MMP-1) ELISA kit.

[0198] The test results are as follows Figure 12 As shown: at the 0.01% test level, the expression of matrix metalloproteinase MMP-1 in the galactosidase fermentation filtrate group was reduced by 14% compared with the BC group, indicating that the sample can achieve the effect of firming and anti-wrinkle by reducing the expression of MMP-1 and reducing the degradation of collagen.

[0199] Example 13 Effect of the Filtrate of the Fermentation Product of Galacto-Saccharomyces cerevisiae on Reducing Cytochrome Synthesis

[0200] Mouse melanoma cells (B16) were used as a test model to test the regulatory effect of the fermentation product filtrate of Galacto-Saccharomyces cerevisiae CFFSH021 on B16 melanin synthesis.

[0201] Test method:

[0202] A) Cell plating: Using 1640 medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin dual antibody stock solution, seed B16 cells at a concentration of 2.5×10⁴ cells / well in a 24-well plate (500 μL per well). Incubate at 37°C, 5% CO₂ in a humidified incubator for 24 h.

[0203] B) Sample loading: Use DMEM medium (2% fetal bovine serum (FBS), 1% penicillin-streptomycin dual antibody stock solution), discard the solution in the wells, and plate three parallel wells for each concentration, with 500 μL per well. Stimulate for 72 hours.

[0204] BC group: replaced with 500uL DMEM medium (2% fetal bovine serum (FBS), 1% penicillin-streptomycin double antibody stock solution)

[0205] PC group: replaced with 500 μL 0.5 g / L kojic acid (kojic acid dissolved in DMEM medium containing 2% fetal bovine serum and 1% penicillin-streptomycin dual antibody solution)

[0206] Sample group: replaced with 500uL of galactosidase fermentation product filtrate (the sample was dissolved in DMEM medium containing 2% fetal bovine serum and 1% penicillin-streptomycin double antibody mother solution), the test concentrations were: 1%, 0.1%, 0.01%

[0207] C) Assay: After discarding the culture medium and washing three times with PBS, 300 μL of trypsin was added to each well to digest the cells for 3 minutes, and 700 μL of culture medium was added to terminate the digestion.

[0208] Collect the cell suspension into a 1.5 mL centrifuge tube and centrifuge at 10,000 rpm for 3 min. Carefully remove the supernatant and add 50 μL of 1 M sodium hydroxide (containing 10% DMSO). Incubate at 80°C for 30 min to fully lyse the cells and dissolve the melanin granules. Add 50 μL of the sample to a 96-well plate and measure OD405.

[0209] The test results are as follows Figure 13 As shown in Table 1: At the test concentrations, especially at 1% and 0.1% test concentrations, the filtrate of the fermentation product of Galacto-Saccharomyces cerevisiae has a very strong inhibitory effect on the synthesis of melanin, with inhibition rates reaching 58.24% and 40.66%, respectively. The inhibition rate is highly concentration-dependent with the test concentration, indicating that the sample can achieve a whitening effect by inhibiting the synthesis of melanin.

[0210] Table 1. Melanin inhibition rate

[0211]

[0212] Example 14 Anti-glycation efficacy test of galactosidase fermentation product filtrate

[0213] Glucose and bovine serum albumin (BSA) undergo a non-enzymatic glycosylation reaction in vitro, generating fluorescent advanced glycation end products (AGEs). After adding the fermentation filtrate of the Galacto-Saccharomyces cerevisiae CFFSH021 strain, the AGE production level was measured by fluorescence quantitative analysis to evaluate the anti-glycation effect.

[0214] Test method:

[0215] A) Bovine serum albumin (BSA) (60 mg / mL with 0.2% proclean 300 as a preservative), glucose solution (300 mg / mL), aminoguanidine AG solution (60 μg / mL), and sample solution were prepared in phosphate buffered saline (PBS, pH=7.4).

[0216] B) In a clean bench, mix equal volumes of BSA, glucose, and sample solution (1.5 mL each). Replace the sample solution with 60 μg / mL AG as a positive control, and leave the sample solution or AG alone as a negative control. Replace the glucose in the sample and control groups with PBS as blank controls.

[0217] C) Incubate in a 55°C constant temperature incubator for 24 h.

[0218] D) AGEs determination: 0.5 mL of the saccharification solution was diluted to 5 mL with PBS, and the fluorescence intensity was measured with the excitation wavelength set at 370 nm and the emission wavelength set at 440 nm.

[0219] The test results are as follows Figure 14 As shown: at 10% test concentration, compared with the BC group, the fluorescence intensity of the filtrate group of the fermentation product of galactosidase-like bacteria was significantly reduced, and the inhibition rate reached 36%, indicating that the sample can exert an anti-glycation effect by inhibiting the formation of glycated collagen.

[0220] Example 15: Test on the Cell Proliferation-Promoting Effect of the Fermentation Product Filtrate of Galacto-Saccharomyces cerevisiae

[0221] Human skin fibroblasts (HSF) were used as the test model and cell viability was used as the detection index to test the regulatory effect of the fermentation product filtrate of Galacto-Saccharomyces cerevisiae CFFSH021 on the proliferation of HSF.

[0222] Test method:

[0223] A) Cell inoculation: Well-grown human skin fibroblasts (HSF) were selected as test cells and digested and then prepared into approximately 2×10 4 Cells were plated in a 96-well plate with a cell suspension of 100 μL / mL. The plates were incubated in a 37°C, 5% CO2 incubator for 24 hours. A blank control group was maintained without cells and treated with the same volume of cell culture medium.

[0224] B) Sample Loading: Set up a blank control group, a negative control group, a positive control group, and a test sample group. The test sample is the filtrate of the fermentation product of the Galactomyces galactosidase prepared in Example 2. The blank and negative control groups are incubated with DMEM medium supplemented with 2% fetal bovine serum and 1% penicillin-streptomycin dual antibody stock solution. The positive control group is incubated with DMEM medium supplemented with 10% serum and 1% penicillin-streptomycin dual antibody stock solution. The test sample group is incubated with the test sample culture medium at the specified concentration. The volume added to each well is 100 μL. After sample loading, continue incubation for 72 hours.

[0225] C) Medium Exchange: After 48 hours of incubation, the 96-well plate was removed and the medium exchanged. The blank and negative control groups were exchanged with DMEM medium containing 2% fetal bovine serum and 1% penicillin-streptomycin antibody stock solution. The test sample group was exchanged with medium containing different concentrations of galactosidase-like fermentation product filtrate samples (samples dissolved in 2% fetal bovine serum and 1% penicillin-streptomycin antibody stock solution). The positive control group was exchanged with DMEM medium containing 10% serum and 1% penicillin-streptomycin antibody stock solution.

[0226] D) CCK8 assay: Mix CCK8 with DMEM medium at a ratio of 1:9 and incubate for 2 h. Calculate relative cell viability.

[0227] E) Take another 96-well plate and stain it with crystal violet and take a picture.

[0228] The test results are as follows Figure 15 、 Figure 16 As shown, incubation with 0.1% galactose yeast-like fermentation product filtrate significantly promoted HSF cell proliferation, while also increasing cell viability by 91%, indicating that the sample can accelerate cell renewal and promote cell regeneration in the skin. Cell viability and renewal rate are closely related to aging. Aging cells experience a slowdown or even stagnation in their proliferation rate, leading to a decrease in activity. These results indicate that the galactose yeast-like fermentation product filtrate of the CFFSH021 strain can counteract the decline in cell viability and delay functional aging.

[0229] Example 16 Effect of the Filtrate of the Fermentation Product of Galacto-Saccharomyces cerevisiae on the Lifespan of Caenorhabditis elegans N2

[0230] The filtrate of the fermentation product of the galactosaccharomyces-like bacteria obtained in Example 2 was used as the test sample. The test used N2 as the test subject, and survival rate and nematode lifespan as evaluation indicators to test the effect of the fermentation product filtrate of the galactosaccharomyces-like bacteria CFFSH021 on the lifespan of the nematode N2 at a concentration of 5%.

[0231] Test method:

[0232] A) Synchronization of Nematodes: Wash N2 C. elegans from a culture dish with M9+ and transfer to a 15 mL centrifuge tube. Centrifuge at 600 g for 15-30 seconds. Carefully remove the supernatant with a pipette to avoid resuspending the nematodes. Prepare bleaching lysis buffer according to the following formula (NaOH: NaClO: H2O, 1:2:7). Start a timer and add 5 mL of lysis buffer to each tube. Cover and shake continuously. Lysis is complete when the majority of the worms begin to disappear from the solution. Immediately add approximately 10 mL of M9+ solution to each tube, quickly mix, and centrifuge at 4000 rpm for 2 minutes. Discard the supernatant. Repeat this washing method at least three times. The resulting eggs are plated at a predetermined density on NGM plates covered with OP50 microspheres and incubated at 20°C.

[0233] B) Sample testing: C. elegans N2, grown to the L4 stage after synchronization, were plated onto NGM plates containing 5% galactosidase-like yeast fermentation product filtrate (containing 120 μM / L 5-fluoro-2′-deoxyuridine (FUdR)). A blank control was established, with approximately 50 cells per well of a 6-well plate. 50 μL of OP50 bacterial solution were then added and incubated at 20°C.

[0234] C) Every 24 hours, the number of surviving nematodes was counted under a stereomicroscope and the survival rate was calculated.

[0235] The test results are as follows Figure 17 As shown in the results, it can be calculated that the median survival time increased from 9 days to 12 days, a 33% increase; the average lifespan increased by 15.7%; and the maximum lifespan increased from 15 days to 21 days, a 40% increase. Therefore, it can be seen that the filtrate of the fermentation product of the galactosidase-like bacteria can significantly extend the lifespan of nematodes, indicating that the multi-effect anti-aging function of CFFSH021 is not only reflected in anti-aging at the cellular level, but also can achieve anti-aging at the level of individual organisms, providing strong evidence for delaying aging.

[0236] Example 17 Anti-aging Effects of Fermentation Product Filtrates of Galactomyces from Other Sources

[0237] Following the process steps and methods of Example 2, different Galactomyces-like yeast fermentation product filtrates were prepared using the strains listed in Table 3. Aside from the different strains used, the remaining preparation processes were identical. The effects of the fermentation product filtrates on different anti-aging pathways were evaluated using the methods of Examples 3 to 16. The efficacy results of the test samples are shown in Table 2.

[0238] The results showed that although all the strains were Galactomyces candidus or its dimorphism Geotrichum candidum, except for the strain Galactomyces candidus CFFSH021, the other strains did not have multiple anti-aging-related efficacy indicators and could exhibit multi-effect anti-aging functions.

[0239] Table 2 Efficacy of fermentation product filtrates prepared from different strains of Galactomyces

[0240]

[0241]

[0242] Example 18 Effect of culture medium on galactosidase fermentation product filtrate

[0243] Galactomyces candidus CFFSH021 was used as the fermentation strain, and the fermentation culture was carried out by shake flask culture. The culture medium was cultured using the following four culture media, and the culture medium was sterilized by high-pressure steam at 115 degrees for 20 minutes before use.

[0244] Medium 1: 2% glucose, 2% peptone, 1% yeast extract powder, natural pH.

[0245] Medium 2: 0.5% glucose, 0.7% skim milk powder, 0.07% yeast extract powder, adjusted to pH 5.8±0.2.

[0246] Medium 3: 0.3% malt extract, 1% whole milk powder, adjusted to pH 5.8±0.2 before digestion.

[0247] Culture medium 4: 0.5% rice flour, 0.5% whole milk powder, adjust the pH to 5.8±0.2 before disinfection.

[0248] The culture conditions were as follows: one loopful of bacterial lawn was inoculated per 100 mL of culture medium, the culture temperature was 28°C, the culture shaker was shaken at 200 rpm, and the culture time was 24 h.

[0249] After the culture was completed, the fermentation broth was centrifuged at 12000 rpm for 15 min in a high-speed refrigerated centrifuge.

[0250] The supernatant was taken and sterilized by filtration using a 0.22 μm syringe filter to obtain the fermentation product filtrate of the galactosidase-like yeast CFFSH021.

[0251] The efficacy of the fermentation product filtrates of Galactomyces spp. obtained in different culture media was evaluated using the efficacy methods of Examples 3 to 16. The results are shown in Table 3. The results show that although there are differences in efficacy, the fermentation product filtrates of Galactomyces spp. CFFSH021 prepared in different culture media have almost all anti-aging pathways.

[0252] Table 3 Efficacy of fermentation product filtrates prepared from different culture media

[0253]

[0254]

[0255] Example 19 Products in the fermentation broth and possible anti-aging ingredients

[0256] The fermentation product filtrates obtained from the culture media 1 to 4 in Example 18 were subjected to high performance liquid chromatography to determine the content of potential anti-aging ingredients (adenosine, glutathione, pantothenic acid, and mevalonic acid).

[0257] The analysis methods for each anti-aging ingredient are as follows:

[0258] (1) Adenosine

[0259] An Agilent LC-1290 high-performance liquid chromatograph was used, using a Polaris 3 C18-A column (150 x 4.6 mm), a DAD detector, a wavelength of 260 nm, and mobile phases: A: methanol, D: 0.05% TFA in water. The flow rate was 0.8 mL / min, the column temperature was 30°C, and the injection volume was 1 μL. The gradient elution profile was as follows: a. Initial 5% phase A, b. 5% phase A at 6.00 min, 95% phase A at 10 min, c. 95% phase A at 14 min, 5% phase A at 14.5 min, and 5% phase A at 20 min. The retention time of the adenosine standard was 5.4 min.

[0260] (2) Methylvalonic acid

[0261] An Agilent LC-1290 high-performance liquid chromatograph was used, using a Polaris 3 C18-A column (150 x 4.6 mm), a DAD detector, a wavelength of 270 nm, and mobile phases: C: acetonitrile, D: 0.05% TFA in water. The flow rate was 0.7 mL / min, the column temperature was 30°C, the injection volume was 2 μL, and the acquisition and run time was 15 min. A gradient elution program was used: a. Initial, 100% C phase at 0 min, b. 50% C phase at 6 min, c. 50% C phase at 8 min, d. 0% C phase at 9 min, and d. 0% C phase at 15 min. External standard detection was used, and the retention time of the mevalonate standard was 8.31 min.

[0262] (3) Glutathione, pantothenic acid

[0263] An Agilent LC-1290 high-performance liquid chromatograph was used, using a Discovery HS F5-3 column (2.1 mm × 150 mm, 3 μm particle size). The detector was a DAD detector at a wavelength of 210 nm. The mobile phases were: A: 0.1% (v / v) formic acid in water, D: 0.1% (v / v) formic acid in acetonitrile. The flow rate was 0.5 mL / min, the column temperature was 30°C, the injection volume was 1 μL, and the acquisition and run time was 20 min. A gradient elution program was used: a. Initial, 0 min, 100% C phase; b. 6 min, 50% C phase; c. 8 min, 50% C phase; d. 9 min, 0% C phase; d. 15 min, 0% C phase. Detection was performed using an external standard.

[0264] The test results are shown in Table 4. However, the relationship between these known ingredients and potential anti-aging effects cannot be confirmed. There is no obvious correlation between the anti-aging ingredients and their effects. This shows that there are other unknown ingredients in the fermentation product filtrate of Galacto-saccharomyces cerevisiae CFFSH021 that can play an anti-aging role, and the effects are not entirely derived from these known ingredients.

[0265] Table 4 Potential anti-aging ingredients in the filtrate of galactosidase-like fermentation products

[0266]

[0267] Example 20 Effect of Precursor Addition on Potential Functional Substances in Galacto-Saccharomyces Fermentation Product Filtrate

[0268] Different precursor components were additionally added to the culture medium 1 of Example 19, and after culturing for 24 hours according to the shake flask culture method of Example 18, the galactosidase-like fermentation product filtrate was obtained by centrifugation and filtration, and the contents of adenosine, glutathione, pantothenic acid, and galacturonic acid therein were detected.

[0269] (1) Alanine

[0270] Among the various amino acid precursors, alanine is particularly beneficial in increasing the pantothenic acid content of the product. Adding 2g / L of alanine can increase the pantothenic acid content of the galactosidase-like fermentation filtrate to 56mg / L. Efficacy testing of the alanine-supplemented galactosidase-like fermentation filtrate revealed significant improvements in resistance to DNA damage, Col-1 expression levels, and reduction in the proportion of senescent cells.

[0271] Methionine

[0272] Among the various amino acid precursors, methionine is particularly beneficial in increasing the glutathione content in the product. Adding 2g / L methionine increased the glutathione (reduced form) content in the galactosidase-like fermentation filtrate to 30.5mg / L. The galactosidase-like fermentation filtrate obtained with the addition of 2g / L methionine showed significant improvements in five indicators: promoting fibroblast proliferation, resisting DNA damage, upregulating ELN expression, inhibiting MMP-1 expression, and increasing intracellular ROS levels.

[0273] Milk protein, milk powder

[0274] The addition of whey protein and milk powder increased the adenosine content in the galactosyl yeast fermentation product filtrate. Adding 1% whey protein and milk powder increased the adenosine content in the galactosyl yeast fermentation product filtrate to 38 mg / L and 19 mg / L, respectively. The yeast fermentation product filtrate obtained with 1% whey protein showed significant improvements in five efficacy measures: melanin inhibition, DNA damage resistance, Col-I expression upregulation, and ELN expression upregulation. The yeast fermentation product filtrate obtained with 1% milk powder also showed significant improvements in melanin inhibition, ROS levels, and DNA damage resistance.

[0275] Example 21 Human Efficacy Test of Galactosidase-like Fermentation Product Filtrate

[0276] The filtrate of the fermentation product of the galactosaccharomyces spp. CFFSH021 prepared in Example 2 was used to conduct an actual human efficacy test. The test subjects used the filtrate of the fermentation product of the galactosaccharomyces spp. CFFSH021 once in the morning and once in the evening for 7 consecutive days. The skin of the users before and after use was analyzed using a VISTA-CR facial image analyzer. The results are as follows: Figure 18 As shown in the figure, after 7 days of use, the number of wrinkles in the eyelid area of ​​the user was reduced and the depth was significantly lighter. At the same time, the range and area of ​​the red area of ​​the skin were significantly improved (the red area is as shown in the figure). Figure 19 shown).

[0277] Example 22 Skin Care Formula: Galacto-Yeast Toner

[0278] The fermentation product filtrate of the galactosidase-like fungus CFFSH021 prepared in Example 2 was used as a raw material for the skin care formula. As shown in Table 5, the process steps for the galactosidase-like fungus activating toner are as follows:

[0279] 1. Add Phase A ingredients to an emulsifier and heat to 85°C. Keep warm for 10 minutes.

[0280] 2. Cool down to 45℃ and add the raw materials of phase B into the emulsifying pot respectively, stir evenly and discharge the material.

[0281] Table 5. Galactose Yeast Revitalizing Toner

[0282]

[0283] Example 22: Effect of skin care formula on skin function maintenance

[0284] Test method:

[0285] Testing instrument: Multifunctional skin tester CK-MPAiO

[0286] (1) Determination of moisture content in the stratum corneum

[0287] Seven volunteers aged between 20 and 40 were selected, and the moisture content of the volunteers was measured on their forearms after using the samples and at 24 hours.

[0288] The evaluation results before and after product use are compared using statistical test methods to determine whether there are statistical differences.

[0289] (2) Determination of transdermal water loss

[0290] Seven volunteers aged between 20 and 40 were selected. Transepidermal water loss (TEWL) values ​​were measured on their forearms before, and then at 1, 2, 3, 4, and 5 hours after product application. The results before and after product use were compared using statistical tests to determine if there were any statistically significant differences.

[0291] (3) Statistical methods

[0292] The statistical analysis software was SPSS 25. The difference between the initial value of each test area and the measured value at other time points was calculated, and then this difference was used to statistically analyze the differences between the sample area and the blank control area at different time points.

[0293] Paired T test or rank sum test was used, and the significant difference level was statistically significant when P value < 0.05.

[0294] Result Interpretation: 1. Positive result: The moisture content of the stratum corneum in the test area before and after product use shows a significant difference, indicating that the test sample has a moisturizing effect. 2. Negative result: There is no significant difference in the moisture content of the stratum corneum in the test area before and after product use, indicating that the test sample does not have a moisturizing effect.

[0295] The test results are shown in Tables 6 and 7. Based on the stratum corneum moisture content test results, combined with statistical analysis, it was found that the Galactose Yeast Revitalizing Toner showed a significant difference after 24 hours of use compared to 0 hours, indicating that the test sample has a hydration-retaining effect. Based on the stratum corneum transepidermal water loss test results, combined with statistical analysis, it was found that the Galactose Yeast Revitalizing Toner showed a significant difference after 5 hours of use compared to 0 hours, indicating that the test sample effectively strengthens the skin's moisture barrier.

[0296] Table 6. Test of moisture content of stratum corneum

[0297]

[0298] Table 7. Transdermal water loss determination

[0299]

[0300] In summary, the technical solution of this application has the following beneficial effects:

[0301] The filtrate of the fermentation product of the Galacto-Saccharomyces-like bacteria CFFSH021 provided by the present invention has multi-dimensional anti-aging effects:

[0302] (1) Combating cellular aging caused by DNA damage due to free radicals: Continuous DNA damage (genotoxic stress) triggers a signal cascade reaction, driving cell apoptosis or aging to avoid replicating the damaged genome, but these cellular processes are related to aging drivers and promote aging. Existing scientific research has found evidence of the association between DNA damage and other pillars of aging, indicating that DNA damage is the root cause of aging ("DNA damage-how and why we age?" eLife 10: e62852., DOI: 10.7554 / eLife.62852). In the present invention, the fermentation product of the galactosidase-like yeast CFFSH021 was found to significantly reduce DNA damage caused by free radicals, thereby achieving aging induced by DNA damage caused by free radicals;

[0303] (2) Maintain the function of mitochondrial membrane permeability transition pore protein and slow down the aging caused by mitochondrial function decline: Mitochondria are the energy organs of cells responsible for cell energy supply. The decline of mitochondrial function is one of the important driving factors of cell and organism aging. When cells are affected by various factors such as environmental stress, mitochondrial function will decline. After the decline of mitochondrial function, the permeability of the mitochondrial membrane permeability transition pore (mPTP) on the mitochondrial membrane increases, which will further lead to: loss of mitochondrial membrane potential, thereby affecting the function of the electron transport chain and ATP production, leading to energy crisis and cell aging. Cytochrome C is released, which then activates the caspase pathway, triggers cell apoptosis, and leads to tissue function decline. Calcium ion homeostasis imbalance further aggravates cell damage, aggravates the escape of endogenous ROS in mitochondria, and causes cell aging and apoptosis caused by cell damage. The fermentation product filtrate of the galactose yeast-like bacteria CFFSH021 provided by the present invention can prevent and reduce the decline of mitochondrial function and the failure of mPTP permeability protein caused by free radical stress, and has a good delaying effect on cell aging caused by the decline of mitochondrial mPTP function;

[0304] (3) Reduce the level of intracellular reactive oxygen species (ROS) and reduce aging caused by oxidative cell damage: The gradual accumulation of oxidative cell damage is considered to be one of the basic driving factors of cellular aging. Although existing studies have shown that oxidative stress and aging are not simply linearly correlated, reactive oxygen species ROS, as a byproduct of cellular metabolism, can be confirmed to randomly cause cell damage, thereby driving the aging phenotype. The level of ROS in cells is widely recognized as an important driving factor of aging. (《A Comprehensive Overview of the Complex Role of Oxidative Stress in Aging,The Contributing Environmental Stressors and Emerging Antioxidant Therapeutic Interventions》. Front. Aging Neurosci. 14: 827900. doi: 10.3389 / fnagi.2022.827900) The fermentation product filtrate of the galactosidase-like bacteria CFFSH021 provided by the present invention can reduce the level of intracellular reactive oxygen species caused by free radicals, thereby delaying oxidative cell damage and inhibiting aging caused by reactive oxygen species (ROS) and oxidative cell damage;

[0305] (4) Oxidative stress levels that affect the individual level: Oxidative stress is a key factor in the pathophysiology of aging. More specifically, elevated oxidative stress levels can induce various factors associated with cellular aging, such as telomere shortening (Literature source: Bodnar et al. Doi: 10.1126 / science.279.5349.349), loss of protein balance (Literature source: Tawo et al. Doi: 10.1016 / j.cell.2017.04.003), and differential expression of miRNAs (Literature source: Dhahbi et al., 2011, doi: 10.1371 / journal.pone.002050). The exact mechanism by which oxidative stress induces aging is still unclear, but existing studies have found that oxidative stress induces the senescence-associated secretory phenotype (SASP), including soluble factors (interleukins, chemokines, and growth factors), degradative enzymes (such as matrix metalloproteinases (MMPs) (public literature from "Oxidative stress, aging, and diseases" Clin Interv Aging. 2018 Apr 26; 13: 757-772. doi: 10.2147 / CIA.S158513). The fermentation product filtrate of the galactosidase-like yeast CFFSH021 provided by the present invention can reduce the oxidative stress level under free radical stress at the individual level in Caenorhabditis elegans, a model organism for aging research, and has a delaying effect on free radical damage-induced aging and oxidative stress-induced aging in individuals;

[0306] (5) Multiple aging-related secretory phenotypes that affect skin aging: Cellular senescence is a key factor in the aging of organisms. Senescent cells accumulate in large quantities in aging tissues, especially in aging skin. (Source: "Mitochondrial oxidative stress caused by Sod2 deficiency promotes cellular senescence and aging phenotypes in the skin". Aging 4, 3-12. doi: 10.18632 / aging.100423). Organ aging and functional decline begin with cellular senescence in the organs. Fibroblasts in the skin are the main cells in the dermis and are responsible for synthesizing the extracellular matrix (ECM), including collagen and elastin, to maintain cell structure and provide skin tensile strength, toughness, and skin elasticity. When fibroblasts undergo senescence, their functionality declines, including a decrease in their ability to synthesize collagen and elastin. Simultaneously, they develop a senescence-associated secretory phenotype (SASP), characterized by the secretion of soluble factors, including interleukins (ILs), chemokines, growth factors, and enzymes such as matrix metalloproteinases (MMPs). MMPs further degrade collagen, disrupting the extracellular matrix between skin cells. This leads to a loosening of the skin's structure, a decrease in its barrier function, and a reduction in its ability to retain moisture. Furthermore, cellular senescence causes the cessation and weakening of cell replication, as well as cell size reduction, leading to a loosening of the skin matrix and the formation of wrinkles. This decline in skin structure and function, coupled with an increase in senescent cells, contributes to skin aging. This decline in skin structure and function further exacerbates cellular senescence, creating a vicious cycle that accelerates the aging process, a process known as "cliff-like aging." The fermentation product filtrate of the Galacto-Saccharomyces cerevisiae CFFSH021 provided by this invention has been found to target multiple aging-related secretory phenotypes during skin aging, including: 1. increasing fibroblast activity and cell proliferation and replication; 2. reducing cell functional decline and improving fibroblasts' ability to synthesize collagen and elastin; 3. reducing cellular aging-related secretory phenotypes and lowering the expression of matrix metalloproteinase 1 (MMP1). This comprehensively blocks the vicious cycle of skin aging, delaying and preventing precipitous skin aging.

[0307] (6) Delaying aging by enhancing the stability of the nuclear membrane structure: Lamin B1 is an important component of the nuclear lamina and belongs to the B-type nuclear lamin protein. It is mainly involved in maintaining the stability of the nuclear membrane structure, chromatin organization and gene expression regulation. The reduction of Lamin B1 is not only the result of cell aging, but also the cause of aging. It promotes cells into an irreversible aging state by affecting nuclear structure, chromatin stability and cell cycle regulation. During cell aging, the expression and function of Lamin B1 change significantly and directly affect the aging process. Senescent cells (including replicative aging, DNA damage-induced aging or oncogene-induced aging) usually show a significant decrease in Lamin B1 mRNA and protein levels. The reduction of Lamin B1 may affect the epigenetic state of chromatin, such as histone modification and DNA methylation, and promote cells into a senescent state. The reduction of Lamin B1 is associated with cell cycle arrest, which promotes cells to enter an irreversible aging state. Studies have shown that partially restoring or increasing Lamin B1 levels can delay aging. For example, Dou et al. (2015) inhibited autophagy, inhibiting the reduction of Lamin B1 and delaying cellular aging (Autophagy mediates degradation of nuclear lamina. Nature 527, 105-109 (2015). DOI: 10.1038 / nature15548). The fermentation product filtrate of the Galacto-Saccharomyces cerevisiae-like strain CFFSH021 provided by the present invention can inhibit the reduction of Lamin B1 expression under free radical stress, enhance the maintenance of nuclear function and structural stability, and delay cellular aging.

[0308] (7) Enhance the expression of the "longevity gene" SIRT1: Sirtuins (including SIRT1-SIRT7) are a class of histone deacetylases that regulate energy metabolism and mitochondrial function. They act as metabolic sensors and use intracellular metabolites such as NAD+ and acetyl-CoA to regulate mitochondrial function according to nutrient supply, so their activity depends on the metabolic state of the cell. They also coordinate stress response and damage repair mechanisms. Sirtuin 1 (SIRT1) has been found to regulate secretory proteins associated with the aging-associated secretory phenotype (SASP) by inducing epigenetic modifications in the promoter region, thereby silencing their genes. SIRT1 has also been found to play an important role in regulating stress response by deacetylation of p53, thereby combating aging and the occurrence of age-related diseases. : SIRT1 expression levels are highly correlated with aging markers such as telomere length and inflammatory factors. Overexpression of yeast SIR2 (a homologous gene of SIRT1) in yeast cells can extend replicative lifespan. Overexpression of SIRT1 in mice has been shown to improve health signs (such as metabolism and neuroprotection) and extend the lifespan of mice (approximately 10-15%), while mice with SIRT1 gene knockout exhibit premature aging phenotypes. In human studies, it was found that specific SIRT1 SNP gene polymorphisms (such as rs12778366) are associated with longevity (Gene.2019 Feb 20;686:8-15.doi:10.1016 / j.gene.2018.11.004.). The fermentation product filtrate of the galactosidase-like yeast CFFSH021 provided by the present invention can promote the expression of the SIRT1 gene in cells, thereby delaying aging associated with SIRT1 gene decline;

[0309] (8) β-galactosidase is an important cell senescence marker that can be used to indicate the proportion of senescent cells. In a specific embodiment, the fermentation product filtrate of the galactosidase-like yeast CFFSH021 was found to reduce the proportion of senescent cells in the overall cell population through labeling with the cell senescence marker β-galactosidase.

[0310] (9) Anti-glycation effect: There is a close relationship between glycation and aging. Glycation refers to the process in which reducing sugars combine with molecules such as proteins, lipids or nucleic acids to form advanced glycation end products (AGEs). This process does not require enzyme catalysis and is a non-enzymatic glycosylation. The accumulation of AGEs will destroy the normal functions of proteins and tissues, thereby leading to cell or tissue aging. AGEs will also cross-link with proteins such as collagen and elastin, reducing skin elasticity, leading to wrinkles and sagging, and causing skin aging. The fermentation product filtrate of the galactose yeast-like fungus CFFSH021 provided by the present invention has a certain anti-glycation effect, reduces the formation of AGEs, and thus achieves the effect of delaying skin aging;

[0311] (10) Affecting aging phenotypes at the individual level: Caenorhabditis elegans is a model organism widely used in biological research and is widely used in anti-aging research and lifespan research. The apoptosis mechanism of nematodes is highly conserved with that of humans. Key genes such as ced-3, ced-4 and ced-9 correspond to the human caspase family, Apaf-1 and Bcl-2 genes, respectively. About 60-80% of human disease-related genes have homologous genes in nematodes, such as LRRK2 related to Parkinson's disease and daf-2 related to metabolic diseases. The fermentation product filtrate of the galactose yeast-like bacteria CFFSH021 provided by the present invention can extend the median survival time (Median survival time) of nematodes at the individual level by 33%. The fermentation product of the galactose yeast-like bacteria CFFSH021 provided in this application can also play an anti-aging role at the individual biological level;

[0312] (11) In addition, in human efficacy tests, the fermentation product of the galactosidase-like bacteria CFFSH021 provided in this application can reduce the area and level of skin redness and reduce the number and depth of wrinkles.

[0313] The above are only preferred embodiments of the present invention and do not limit the implementation mode and protection scope of the present invention. For those skilled in the art, it should be aware that all solutions obtained by equivalent substitutions and obvious changes made using the description and illustrations of the present invention should be included in the protection scope of the present invention.

Claims

1. A galactosidase-like yeast whose fermentation products have multidimensional anti-aging effects, characterized in that: The galactosidase-like bacteria is galactosidase-like bacteria CFFSH021, whose taxonomic Latin name is Galactomyces candidus CFFSH021. The galactosidase-like bacteria CFFSH021 was deposited in the China Center for Type Culture Collection on April 11, 2025, with a deposit number of CCTCC NO: M 2025750.

2. A method for preparing the fermentation product filtrate of the galactosidase-like bacteria according to claim 1, characterized in that: The following steps are involved: S1: preparing a single colony plate: activating the frozen stored Galacto-Saccharomyces cerevisiae-like bacteria CFFSH021, inoculating it onto a plate culture medium by streak method, and culturing it to obtain a single colony plate of Galacto-Saccharomyces cerevisiae-like bacteria CFFSH021; S2: Seed solution preparation: picking the bacterial lawn of the galactosidase-like fungus CFFSH021, inoculating the bacterial lawn into a liquid culture medium, and obtaining a seed solution; S3: Fermentation culture: The seed solution is inoculated into a liquid culture medium, and the fermentation broth obtained after the fermentation is a galactose yeast-like fermentation product; S4: Preparation of a filtrate of a fermentation product of a galactosidase-like yeast: centrifuging the fermentation broth obtained in step S3 to obtain a supernatant, and then filtering and sterilizing the supernatant to obtain a filtrate of a fermentation product of a galactosidase-like yeast; Wherein, in the step S3, the seed liquid is inoculated into the liquid culture medium at an inoculum amount of 1-10% by weight for propagation.

3. The method for preparing a fermentation product filtrate of a galactosidase-like bacterium according to claim 2, characterized in that: The liquid culture medium used in step S3 is any one of the following combinations: Combination 1: glucose, yeast powder, peptone Combination 2: glucose, milk powder, yeast extract powder Combination 3: malt extract, milk powder, yeast extract powder Combination 4: rice flour and milk powder.

4. The method for preparing a filtrate of a fermentation product of a galactosidase-like bacterium according to claim 2, characterized in that: The liquid culture medium may further be supplemented with one of alanine, methionine, whey protein, animal milk and milk powder.

5. The method for preparing a filtrate of a fermentation product of a galactosidase-like bacterium according to claim 2, characterized in that: The specific steps of step S1 include: taking out the glycerol tube of the Galacto-Saccharomyces cerevisiae CFFSH021 at -80°C, taking an appropriate amount of glycerol bacterial solution on a YPD plate culture medium using a sterile inoculation needle in a clean bench, inoculating the plate culture medium using the polygonal streak method, culturing at 28°C to form a bacterial lawn, and then placing the plate culture medium in a 4°C refrigerator for standby use; Among them, the specific preparation method of the liquid culture medium is: add 6g of glucose, 6g of peptone, 3g of yeast extract powder, and 4.5g of agar to deionized water and stir. After fully dissolving, adjust the pH to between 6.0-6.1 with dilute saline, and then make up to 300mL with deionized water. Sterilize at 115°C for 20min. After sterilization is completed, pour the plate into the ultra-clean workbench and cool and solidify.

6. The method for preparing a filtrate of a fermentation product of a galactosidase-like bacterium according to claim 2, characterized in that: The specific steps of step S2 include: picking 3 rings of galactosidase-like fungi CFFSH021 with an inoculation loop on a clean bench and placing them into 300 mL of YPD liquid culture medium, and culturing them in a shaker at 28°C and 220 rpm for 26 hours to obtain a seed solution; wherein the OD600 is between 3.0 and 4.0, and the 300 mL of the YPD liquid culture medium includes 6 g of glucose, 6 g of peptone, and 3 g of yeast extract powder.

7. The method for preparing a filtrate of a fermentation product of a galactosidase-like bacterium according to claim 2, characterized in that: The specific steps of step S3 include: using a fermentation tank as a culture tank and YPD liquid culture medium as a fermentation medium, sterilizing at 115°C for 20 minutes, inoculating the seed liquid into the fermentation medium at an inoculum rate of 5% by weight, and fermenting under the following conditions: fermentation temperature of 28°C, fixed rotation speed of 250 rpm, ventilation volume of 100 L / h, tank pressure of 0.05 MPa, culturing until the glucose concentration is less than 0.5 g / L and the pH rises by more than 0.1, stopping fermentation and releasing the tank, and the fermentation liquid obtained by fermentation is the fermentation product of galactosidase-like bacteria.

8. The method for preparing a filtrate of a fermentation product of a galactosidase-like bacterium according to claim 2, characterized in that: The step S4 specifically includes the following steps: centrifuging the fermentation broth obtained in the step S3, the centrifugation conditions are: 6000 rpm, 15 min, removing the lower bacterial sludge after centrifugation, and taking the supernatant; filtering the obtained supernatant through three-stage microfiltration membranes of 0.45 μm, 0.22 μm, and 0.10 μm in sequence for sterilization, and the filtrate obtained by filtration is the filtrate of the fermentation product of the galactose yeast-like bacteria.

9. A galactosaccharomyces-like bacteria fermentation product filtrate obtained by the method for preparing a galactosaccharomyces-like bacteria fermentation product filtrate according to any one of claims 2 to 8.

10. Use of the filtrate of the fermentation product of Galactomyces spp. according to claim 9 in skin care formulations.

Images