Bacillus licheniformis mutant and application thereof

By introducing mutations into the accA gene of Bacillus licheniformis and optimizing the secretion level of the protein, the problem of difficulty in increasing the production level of heterologous proteins in Bacillus licheniformis was solved, and a significant improvement in the expression level of heterologous proteins was achieved.

CN120624313APending Publication Date: 2025-09-12WUHAN YINMU BIOTECHNOLOGY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510621351.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-14
Publication Date
2025-09-12

AI Technical Summary

Technical Problem

In Bacillus licheniformis, there are numerous genes that regulate the expression and secretion of exogenous proteins, and the specific relationship between them and protein production has not been fully elucidated, making it difficult to improve the production level of heterologous proteins.

Method used

By introducing mutations into the accA gene of Bacillus licheniformis, specifically replacing the 216th codon CTG with ATA, a recombinant expression vector was constructed and engineered strains with accA gene mutations were screened to optimize protein secretion levels.

Benefits of technology

The expression level of heterologous proteins was significantly improved, and the enzyme activity was increased by 21.88% to 26.92%, indicating that the mutant has important application value in the production of heterologous proteins.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005402611940000121
    Figure BDA0005402611940000121
  • Figure BDA0005402611940000131
    Figure BDA0005402611940000131
  • Figure BDA0005402611940000132
    Figure BDA0005402611940000132
Patent Text Reader

Abstract

The invention relates to the technical field of microorganisms, and provides a bacillus licheniformis mutant and application thereof. According to the mutant, bacillus licheniformis is used as a starting strain, the 216th codon CTG of a strain accA gene sequence is replaced with ATA, and the nucleotide sequence of the accA gene is shown as SEQ ID NO. 1. The recombinant bacillus licheniformis BL10-accA-L216I / pHY-AprE, the recombinant bacillus licheniformis BL10-accA-L216I / pHY-npr E and the recombinant bacillus licheniformis BL10-accA-L216I / pHY-Ker are constructed by the bacillus licheniformis mutant, the enzyme activities of the recombinant bacillus licheniformis BL10-accA-L216I / pHY-npr E and the recombinant bacillus licheniformis BL10-accA-L216I / pHY-Ker are respectively 27600.8 U / mL, 4144.00 U / mL and 8380.8 U / mL after the recombinant bacillus licheniformis BL10-accA-L216I / The bacillus licheniformis mutant recombinant strain constructed by the invention has important application value in the aspect of improving the production of bacillus licheniformis heterologous protein.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of microorganisms, in particular to a Bacillus licheniformis mutant and application thereof. Background Art

[0002] Due to its efficient synthesis and secretion capabilities, Bacillus licheniformis has become one of the most commonly used host strains in the industrial production of heterologous proteins, especially proteases. Using Bacillus for heterologous protein expression is an important strategy to increase the yield of target proteins. In recent years, researchers have developed a variety of methods to improve the synthesis level of exogenous proteins. However, in Bacillus licheniformis, there are many genes related to regulating the expression and secretion of exogenous proteins, and the specific relationship between them and protein production has not been fully elucidated. Therefore, constructing high-yield protein engineering strains by targeting and modifying these related genes remains an important direction worthy of in-depth exploration in the future.

[0003] The accA gene is acetyl-CoA carboxylase, a key enzyme in the fatty acid synthesis process. It can catalyze the conversion of acetyl-CoA into malonyl-CoA. Whether its expression level is related to the expression of heterologous proteins has not been clarified. The present invention achieves the effect of increasing heterologous protein production by mutating the accA gene in Bacillus licheniformis, indicating that mutating accA is an effective strategy to improve the production level of heterologous proteins. Summary of the Invention

[0004] In view of this, the present invention provides a Bacillus licheniformis mutant capable of increasing the production of heterologous proteins and its application.

[0005] The technical solution of the present invention is achieved as follows: In the first aspect, the present invention provides a mutant of Bacillus licheniformis, wherein the mutant is based on Bacillus licheniformis as a starting strain, and the 216th codon CTG in the strain accA gene sequence is replaced by ATA, the original nucleotide sequence of the accA gene is shown in SEQ ID NO.1, and the mutated nucleotide sequence is shown in SEQ ID NO.2.

[0006] On the basis of the above technical solution, preferably, the Bacillus licheniformis is Bacillus licheniformis BL10 (CCTCC NO: M2013400).

[0007] In a second aspect, the present invention provides a recombinant expression vector carrying a gene encoding the above-mentioned Bacillus licheniformis mutant.

[0008] In a third aspect, the present invention provides a method for preparing a Bacillus licheniformis mutant, comprising the following steps:

[0009] S1, using Bacillus licheniformis BL10 genomic DNA as a template, primers were designed to construct an accA homologous recombination vector containing a mutation site;

[0010] S2, the recombinant vector was transformed into Bacillus licheniformis BL10, and positive transformants were obtained by kanamycin selection;

[0011] S3, after subculturing the positive transformants, the strains with a single exchange between the upstream homology arm and the genome and the strains with a single exchange between the downstream homology arm and the genome were screened out by colony PCR identification;

[0012] S3, the two single-exchange strains were mixed and cultured in an antibiotic-free medium. After multiple passages, the engineered strain with accA gene mutation was obtained through PCR screening and sequencing verification.

[0013] In a fourth aspect, the present invention provides a use of a Bacillus licheniformis mutant in the production of heterologous proteins.

[0014] Based on the above technical solution, preferably, the heterologous protein is one of alkaline protease, keratinase and neutral protease.

[0015] In a fifth aspect, the present invention provides a use of a Bacillus licheniformis mutant in improving the activity of a heterologous protease.

[0016] Based on the above technical solution, preferably, the heterologous protein is one of alkaline protease, keratinase and neutral protease.

[0017] The Bacillus licheniformis mutant and its application of the present invention have the following beneficial effects compared with the prior art:

[0018] The present invention is based on the accA gene from Bacillus licheniformis BL10. By analyzing its amino acid sequence, sites that may affect protein expression are identified. Then, by designing primers and using PCR technology to introduce mutation sites, a mutant L216I of the accA gene is obtained. Recombinant strains of the mutants, Bacillus licheniformis BL10-accA-L216I / pHY-AprE, BL10-accA-L216I / pHY-nprE, and BL10-accA-L216I / pHY-Ker, are constructed. After 48 hours of fermentation, the enzyme activities of the mutants reach 27600.8 U / mL, 4144.00 U / mL, and 8380.8 U / mL, respectively. Compared with the original strains, the enzyme activities of the mutants are increased by 21.88%, 21.71%, and 26.92%, respectively. This shows that the mutant recombinant strains of Bacillus licheniformis constructed by the present invention have important application value in improving the production of heterologous proteins in Bacillus licheniformis. DETAILED DESCRIPTION

[0019] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0020] The Bacillus licheniformis BL10 (CCTCC NO: M2013400), Bacillus subtilis 168 (ATCC33234) and Bacillus clausii (FERM BP-1497) used in the present invention are all from the Microbial Engineering Laboratory of Hubei University.

[0021] The accA gene is an important gene for expressing acetyl-CoA carboxylase, which is an important metabolic intermediate in organisms and participates in numerous biochemical reactions. The present invention mutates its binding site, optimizes the secretion level of the protein, and thereby improves the expression level of the heterologous protein.

[0022] The present invention predicts a mutation (L216I) at a partial binding site by analyzing the sequence of the accA gene. Using the Bacillus licheniformis BL10 genome as a template, this mutation is constructed into the expression vector T2. The mutation site is then introduced using inverse PCR technology, and the accA gene is subjected to site-directed mutagenesis to obtain a mutant gene. A recombinant vector is constructed and transformed into Bacillus licheniformis for fermentation and enzyme production experiments to verify the production of effective mutants. Subsequently, Bacillus licheniformis mutant strains BL10-accA-L216I / pHY-AprE, BL10-accA-L216I / pHY-NprE, and BL10-accA-L216I / pHY-Ker were generated.

[0023] The technical content of the present invention will be further described below with reference to the embodiments.

[0024] Example 1

[0025] The wild-type accA gene sequence is shown in SEQ ID NO. 1. This application analyzed the accA gene sequence and predicted that mutations at certain sites might enhance heterologous protein expression. By changing amino acid position 216 from L to I, the mutant accA gene sequence is shown in SEQ ID NO. 2.

[0026] Wild-type accA gene sequence: GTGGCTGGAGAATTAGAATTTGAAAAACCGGT GGTCGAACTGCGTGAAAAGATCTCCGAATTGAAAAAGTTCACACAGGATTCCGATATGGATTTGAGCTCTGAAATTACGAAGCTTGAAGCTCGTCTTGAAAGGCTTGAAGAAGACATTTATACAAATCTGAAAGCCTGGGACAGAGTCCAGATTGCAAGGCACCCGAACCGTCCGACAACGCTCGATTATATCGAACATCTCTTTACCGATTTTTTTGAATGCCACGGAGATCGTTATTTCGGTGATGATGAAGCAATTGTCGGCGGAATTGCCAAGTTCCGGGGTCTTCCTGTGACAGTAATCGGTCAGCAGCGCGGCAAGGATACAAAAGAAAACATCCGCCGCAATTTCGGAATGCCGCATCCTGAAGGCTACCGCAAAGCGCTCAGGCTGATGAAGCAGGCCGACAAATTTAACAGGCCGATCATCTGCTTTATTGATACAAAAGGAGCATACCCGGGCAAAGCAGCTGAAGAGCGGGGGCAAAGCGAAGCGATTGCCAAGAATCTTTTTGAAATGGCGGGACTCTCCGTGCCGGTCATCTCGATCGTCATCGGGGAAGGCGGCAGCGGGGGAGCGCTTGCGCTCGGCGTCGCAAACCGCTTATTGATG CTGGAAAACTCAACTTATTCGGTGATCTCTCCCGAGGGAGCTGCTGCTATCCTCTGGAAGGATTCAGGACTCGCGAAAAAAGCGGCAGAAACAATGAAAATCACCGCTCCGGACCTTAAAGAATTGGATATTATAGATCATGTTATAAAAGAAGTAAGAGGCGGAGCACACCGCGATGTGGAGCAGCAGGCTGCCTACATCGACGAAGCGCTGAAAGGCGAGCTTAAATCCCTGCTGAAACTGGATAAGAACGAGCTGATCCAACAAAGATATAACAAGTATAAGTCAATTGGAAAAATTTCGACTGAAAACCAATATGTTGGGATAAAATAA。(SEQ ID NO.1) Mutant accA gene sequence: GTGGCTGGAGAATTAGAATTTGAAAAACCGGT GGTCGAACTGCGTGAAAAGATCTCCGAATTGAAAAAGTTCACACAGGATTCCGATATGGATTTGAGCTCTGAAATTACGAAGCTTGAAGCTCGTCTTGAAAGGCTTGAAGAAGACATTTATACAAATCTGAAAGCCTGGGACAGAGTCCAGATTGCAAGGCACCCGAACCGTCCGACAACGCTCGATTATATCGAACATCTCTTTACCGATTTTTTTGAATGCCACGGAGATCGTTATTTCGGTGATGATGAAGCAATTGTCGGCGGAATTGCCAAGTTCCGGGGTCTTCCTGTGACAGTAATCGGTCAGCAGCGCGGCAAGGATACAAAAGAAAACATCCGCCGCAATTTCGGAATGCCGCATCCTGAAGGCTACCGCAAAGCGCTCAGGCTGATGAAGCAGGCCGACAAATTTAACAGGCCGATCATCTGCTTTATTGATACAAAAGGAGCATACCCGGGCAAAGCAGCTGAAGAGCGGGGGCAAAGCGAAGCGATTGCCAAGAATCTTTTTGAAATGGCGGGACTCTCCGTGCCGGTCATCTCGATCGTCATCGGGGAAGGCGGCAGCGGGGGAGCGCTTGCGCTCGGCGTCGCAAACCGCTTATTGATG。 ATGAAAACTCAACTTATTCGGTGATCTCTCCCGAGGGAGCTGCTGCTATCCTCTGGAAGGATTCAGGACTCGCGAAAAAAGCGGCAGAAACAATGAAAATCACCGCTCCGGACCTTAAAGAATTGGATATTATAGATCATGTTATAAAAGAAGTAAGAGGCGGAGCACACCGCGATGTGGAGCAGCAGGCTGCCTACATCGACGAAGCGCTGAAAGGCGAGCTTAAATCCCTGCTGAAACTGGATAAGAACGAGCTGATCCAACAAAGATATAACAAGTATAAGTCAATTGGAAAAATTTCGACTGAAAACCAATATGTTGGGATAAAATAA. (SEQ ID NO.2) The method for constructing the Bacillus licheniformis mutant expression vector comprises the following steps:

[0027] 1. Design homology arm primers

[0028] Based on the sequence of the accA gene in the genomic DNA of Bacillus licheniformis BL10 (CCTCC NO: M2013400), the following primers were designed:

[0029] Upstream homology arm (including mutation site):

[0030] Forward primer: accA-F1: cgggggatccactagtacatatataatttacctta;

[0031] Reverse primer: accA-R1: aaaccgcttattgatgatagaaaactcaacttat;

[0032] Downstream homology arm (including mutation site):

[0033] Forward primer: accA-F2: ataagttgagttttctatcatcaataagcggttt;

[0034] Reverse primer: accA-R2: ttgatcttttctacgagctcgtggctggagaattag.

[0035] 2. PCR amplification of homology arm fragments

[0036] The genomic DNA of Bacillus licheniformis BL10 was used as a template, and PCR amplification was performed using upstream and downstream homology arm primers to obtain an upstream homology arm fragment and a downstream homology arm fragment.

[0037] 3. Construction of mutation vector

[0038] Backbone amplification: Use T2 plasmid as template to amplify the vector backbone fragment.

[0039] Homologous recombination: Use a recombineering cloning kit (such as Gibson Assembly or In-Fusion Cloning) to homologously recombine the vector backbone, upstream homology arm fragment, and downstream homology arm fragment.

[0040] Transformation verification: The recombinant vector was transformed into Escherichia coli DH5α and positive clones were screened.

[0041] Positive clones were selected and verified by PCR using vector-specific primers and homology arm primers. Clones that were correctly verified by PCR were sequenced to ensure that the mutation site and homology arm sequence were correct. PCR verification and sequencing were also performed to confirm the results.

[0042] Amplification T2 backbone primers:

[0043] T2-GJ-F: actagtggatcccccgggctgcaggaattc;

[0044] T2-GJ-R: gagctcgtagaaaagatcaaagga.

[0045] 4. Electrotransformation of Bacillus licheniformis BL10

[0046] The verified correct mutation vector was electroporated into Bacillus licheniformis BL10, and positive transformants were screened using kanamycin resistance (50 μg / mL).

[0047] PCR verification primers for electroporation colonies:

[0048] T2-F1: atgatagtttatggcggtgtag;

[0049] T2-R1:acagagttcttgaagtggtggc.

[0050] 5. Screening for Single Crossover Binders

[0051] Positive transformants were inoculated into 5 mL of LB liquid medium containing kanamycin and cultured at 45°C (to promote single crossover events). After three subcultures, the culture was diluted and plated onto LB solid medium containing kanamycin.

[0052] Pick a single colony and perform colony PCR verification to detect single crossover events between the upstream homology arm or downstream homology arm and genomic DNA.

[0053] 6. Double Crossover Screening of Mutant Strains

[0054] The strain that successfully crossed over was inoculated into 5 mL of LB liquid medium without resistance and cultured at 37°C (to promote double crossover events). After three subcultures, the strain was diluted and plated onto LB solid medium without resistance.

[0055] Single colonies were picked and tested by PCR: primers were used to verify the mutation site (L216I) of the accA gene. Colonies that were correctly identified by PCR were sequenced to confirm the successful mutation.

[0056] Validation primers: accA-YF: atctccgccgcttgtcaa;

[0057] accA-YR: taaagcatggccagcttg.

[0058] 7. Obtaining Engineered Strains

[0059] After sequencing verification, the Bacillus licheniformis mutant strain BL10-accA-L216I was obtained, preserved and used for subsequent research.

[0060] Example 2

[0061] 1. Construct an expression vector for alkaline protease. The specific steps are as follows:

[0062] The expression vector backbone was amplified using the pHY300PLK plasmid as a template, and the primers were pHY-GJ-F and pHY-GJ-R.

[0063] pHY-GJ-F:gtaaaggataaaacagcacaattc;

[0064] PHY-GJ-R:acacgctaactgtcagaccaagt.

[0065] The P43 promoter was amplified using Bacillus subtilis 168 (ATCC 33234) as a template with primers P43-F and P43-R.

[0066] P43-F: tgctgttttatcctttactgataggtggtatgttt;

[0067] P43-R: caacggtttcttcatgtgtacattcctctc.

[0068] The alkaline protease gene AprE was amplified using Bacillus clausii (FERM BP-1497) DNA as a template with primers AprE-F and AprE-R.

[0069] AprE-F: gagaggaatgtacacatgaagaaaccgttg;

[0070] AprE-R:gtctgacagttagcgtgttgccgcttc.

[0071] The P43 promoter and the alkaline protease gene AprE were linked using SOEPCR to generate the expression cassette P43-AprE. The expression cassette and vector backbone were homologously recombined using a recombination cloning kit and transformed into Escherichia coli DH5α. Transformants were then verified by colony PCR using primers pHY-amp-F and pHY-amp-R.

[0072] pHY-amp-F:gtttattatccatacccttac;

[0073] pHY-amp-R: cagatttcgtgatgcttgtc.

[0074] The gene was then sequenced by Wuhan Qingke Biotechnology Co., Ltd. The sequencing results were correct, and the alkaline protease expression vector pHY-AprE was obtained.

[0075] 2. Construct an expression vector for neutral protease. The specific steps are as follows:

[0076] The expression vector backbone was amplified using the pHY300PLK plasmid as a template, and the primers were pHY-GJ-F and pHY-GJ-R.

[0077] The P43 promoter was amplified using Bacillus subtilis 168 (ATCC 33234) as a template with primers P43-F and P43-R.

[0078] P43-F: tgctgttttatcctttactgataggtggtatgttt;

[0079] P43-R: gattgataaactcatgtgtacattcctctc.

[0080] The neutral protease gene NprE was amplified using Bacillus clausii (FERM BP-1497) DNA as a template with primers NprE-F and NprE-R.

[0081] NprE-F: gagaggaatgtacacatgagtttatcaatc;

[0082] NprE-R:gtgctgttttatcctttaacttacaatccaacag.

[0083] The P43 promoter and the neutral protease gene NprE were linked using SOEPCR to generate the expression cassette P43-NprE. The expression cassette and vector backbone were homologously recombined using a recombination cloning kit and transformed into E. coli DH5α. Transformants were then verified by colony PCR using the same primers as the alkaline protease expression vector, pHY-amp-F and pHY-amp-R.

[0084] The gene was then sequenced by Wuhan Qingke Biotechnology Co., Ltd. The sequencing results were correct, and the alkaline protease expression vector pHY-NprE was obtained.

[0085] 3. Construct an expression vector for keratinase. The specific steps are as follows:

[0086] The expression vector backbone was amplified using the pHY300PLK plasmid as a template, and the primers were pHY-GJ-F and pHY-GJ-R.

[0087] The P43 promoter was amplified using Bacillus subtilis 168 (ATCC 33234) as a template with primers P43-F and P43-R.

[0088] P43-F: tgctgttttatcctttactgataggtggtatgttt;

[0089] P43-R:acctttttgcctctcatgtgtacattcctct.

[0090] The keratinase gene Ker was amplified using Bacillus clausii (FERM BP-1497) DNA as a template, and the primers were Ker-F and Ker-R.

[0091] Ker-F: agaggaatgtacacatgagaggcaaaaaggt;

[0092] Ker-R: gctgttttatcctttacttactgagctgccg.

[0093] The P43 promoter and the keratinase gene Ker were linked using SOEPCR to generate the expression cassette P43-Ker. The expression cassette and vector backbone were homologously recombined using a recombination cloning kit and transformed into Escherichia coli DH5α. Transformants were then verified by colony PCR using primers pHY-amp-F and pHY-amp-R, the same as for the alkaline protease expression vector pHY-NprE.

[0094] The gene was then sequenced by Wuhan Qingke Biotechnology Co., Ltd. The sequencing results were correct, and the alkaline protease expression vector pHY-Ker was obtained.

[0095] 4. Construction of strains expressing heterologous proteins. The specific steps are as follows:

[0096] The alkaline protease free expression plasmid pHY-AprE, the keratinase free expression vector pHY-Ker, and the neutral protease free expression vector pHY-NprE were respectively electroporated into the Bacillus licheniformis BL10-accA-L216I in step S1, and tetracycline resistance was used as a screening marker. After colony PCR screening, pHY-amp-F and pHY-amp-R were used as verification primers. Positive transformants were obtained by PCR verification, and the alkaline protease expression strain Bacillus licheniformis BL10-accA-L216I / pHY-AprE, the keratinase expression strain Bacillus licheniformis BL10-accA-L216I / pHY-Ker, and the neutral protease expression strain Bacillus licheniformis BL10-accA-L216I / pHY-NprE were obtained.

[0097] In this example, the alkaline protease free expression plasmid pHY-AprE, the keratinase free expression vector pHY-Ker, and the neutral protease free expression vector pHY-NprE were respectively electroporated into Bacillus licheniformis BL10. The same method as above was used to screen the genetically engineered bacteria alkaline protease-expressing strain Bacillus licheniformis BL10 / pHY-AprE, keratinase-expressing strain Bacillus licheniformis BL10 / pHY-Ker, and neutral protease-expressing strain Bacillus licheniformis BL10 / pHY-NprE as controls.

[0098] Example 3

[0099] The mutant recombinant strain expressing heterologous protein obtained in Example 2 was inoculated on an LB plate and cultured at 37°C for 12 h. A single colony was picked and inoculated into 5 ml of LB medium for activation again at 230 r / min for 12 h. Then 1 ml was aspirated and inoculated into 20 ml of seed solution (LB) and cultured at 230 r / min and 37°C for 14 h until OD 600 When the cells reached 4-6, inoculate the cells into alkaline protease fermentation medium and ferment at 230 rpm and 37°C for 48 hours. Samples were collected and assayed for alkaline protease activity. Laboratory-existing strains BL10 / pHY-AprE, BL10 / pHY-NprE, and BL10 / pHY-Ker, constructed from unmutated Bacillus licheniformis BL10, were used as controls, with five replicates per group.

[0100] LB medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, pH 7.2. Filling volume (dosage): 5 mL.

[0101] Seed medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, pH 7.2. Filling volume (dosage): 20 mL.

[0102] Alkaline protease fermentation medium: corn starch 40g / L, soybean meal 45g / L, calcium carbonate 5g / L, ammonium sulfate 4g / L, pH 7.2. Liquid volume (dosage) 20mL

[0103] Keratinase fermentation medium: 20 g / L soybean meal, 10 g / L corn flour, 5 g / L ammonium sulfate, 1 g / L potassium dihydrogen phosphate, 2 g / L dipotassium hydrogen phosphate, 0.5 g / L magnesium sulfate, 0.1 g / L calcium chloride, 10 g / L feather meal, pH 7.2. Liquid volume (dosage) 20 mL.

[0104] Neutral protease fermentation medium: 5g / L beef extract, 10g / L peptone, 5g / L yeast extract, 10g / L glucose, 2g / L disodium hydrogen phosphate, 1g / L potassium dihydrogen phosphate, 0.5g / L magnesium sulfate, 0.1g / L calcium chloride, 0.01g / L manganese sulfate, and 0.01g / L zinc sulfate. Liquid volume (dosage): 20mL.

[0105] The protease activity was tested using the national standard method (GBT 23527-2009 Determination of protease preparations). The experimental results are shown in the table below.

[0106] Table 1 Alkaline protease fermentation

[0107]

[0108]

[0109] As shown in Table 1, after culturing in alkaline protease fermentation medium for 48 h, the enzyme activity of the mutant recombinant strain of Bacillus licheniformis constructed in the experimental group was significantly increased by more than 21% compared with the control group.

[0110] Table 2 Keratinase fermentation

[0111]

[0112] As shown in Table 2, after culturing in the keratinase fermentation medium for 48 h, the enzyme activity of the mutant recombinant strain of Bacillus licheniformis constructed in the experimental group was significantly increased by more than 20% compared with the control group.

[0113] Table 3 Neutral protease fermentation

[0114]

[0115] As can be seen from the table, after culturing in alkaline protease fermentation medium for 48 hours, the enzyme activity of the mutant recombinant strain of Bacillus licheniformis constructed in the experimental group was significantly increased by more than 26% compared with the control group.

[0116] In summary, it is shown that the mutant recombinant strain of Bacillus licheniformis constructed in the present invention has important application value in improving the production of heterologous proteins in Bacillus licheniformis.

[0117] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A Bacillus licheniformis mutant, characterized in that: The mutant is based on Bacillus licheniformis as a starting strain, and the 216th codon CTG of the strain's accA gene sequence is replaced by ATA. The original nucleotide sequence of the accA gene is shown in SEQ ID NO.

1.

2. A Bacillus licheniformis mutant according to claim 1, characterized in that: The Bacillus licheniformis is Bacillus licheniformis BL10.

3. A recombinant expression vector, characterized in that: The recombinant expression vector carries a gene encoding the Bacillus licheniformis mutant according to any one of claims 1-2.

4. The method for preparing a Bacillus licheniformis mutant according to any one of claims 1 to 2, characterized in that: The following steps are involved: S1, using Bacillus licheniformis BL10 genomic DNA as a template, primers were designed to construct an accA homologous recombination vector containing a mutation site; S2, the recombinant vector was transformed into Bacillus licheniformis BL10, and positive transformants were obtained by kanamycin selection; S3, after subculturing the positive transformants, the strains with a single exchange between the upstream homology arm and the genome and the strains with a single exchange between the downstream homology arm and the genome were screened out by colony PCR identification; S3, the two single-exchange strains were mixed and cultured in an antibiotic-free medium. After multiple passages, the engineered strain with accA gene mutation was obtained through PCR screening and sequencing verification.

5. Use of a Bacillus licheniformis mutant according to any one of claims 1 to 2 in the production of heterologous proteins.

6. The use according to claim 5, characterized in that: The heterologous protein is one of alkaline protease, keratinase and neutral protease.

7. Use of a Bacillus licheniformis mutant according to any one of claims 1 to 2 in improving the activity of a heterologous protease.

8. The use according to claim 7, characterized in that: The heterologous protein is one of alkaline protease, keratinase and neutral protease.