Recombinant microorganism for producing o-phosphoserine, and method for producing o-phosphoserine, cysteine, and cysteine derivative using same

Abstract

The present disclosure relates to a recombinant microorganism having an increased O-phosphoserine production capacity, and a method for producing O-phosphoserine, cysteine, and cysteine derivatives using the same.

Description

Technical Field

[0001] The present disclosure relates to a recombinant microorganism having enhanced O-phosphoserine production ability, and a method for producing O-phosphoserine, cysteine, and cysteine ​​derivatives using the same. Background Art

[0002] L-cysteine ​​is an amino acid that plays an important role in sulfur metabolism in all organisms. It is not only used to synthesize biological proteins such as hair keratin, glutathione, biotin, methionine and other sulfur-containing metabolites, but also serves as a precursor for the biosynthesis of coenzyme A.

[0003] Methods for producing L-cysteine ​​using microorganisms known in the art include: 1) a method for bioconverting D,L-2-aminothiazoline-4-carboxylic acid (D,L-ATC) into L-cysteine ​​using a microorganism, 2) a method for producing L-cysteine ​​by direct fermentation using Escherichia coli (E. coli) (EP0885962B; Wada M and Takagi H, Appl. Microbiol. Biochem., 73:48-54, 2006), and 3) a method for producing O-phosphoserine (hereinafter referred to as "OPS") by fermentation using a microorganism and then converting O-phosphoserine into L-cysteine ​​by reacting O-phosphoserine with sulfide under the catalysis of O-phosphoserine sulfhydrylase (hereinafter referred to as "OPSS") (US 8557549 B2), etc.

[0004] In particular, in order to produce cysteine ​​in high yield by method 3), the precursor OPS should be overproduced. Summary of the Invention

[0005]

Technical Issues

[0006] The technical problem of the present disclosure is to provide a recombinant microorganism with enhanced O-phosphoserine production ability, and a method for producing O-phosphoserine, cysteine ​​and cysteine ​​derivatives using the same.

[0007]

Technical solution

[0008] An object of the present disclosure is to provide a recombinant microorganism that produces O-phosphoserine, wherein: (a) the activity of the MntH protein is enhanced compared to the endogenous activity; and (b) the microorganism comprises a YhhS variant, which comprises a substitution of an amino acid at a specific position in the amino acid sequence corresponding to SEQ ID NO: 3 with another amino acid.

[0009] Another object of the present disclosure is to provide a recombinant microorganism that produces O-phosphoserine, wherein: (a) the activity of the MntH protein is enhanced compared to the endogenous activity; (b) the microorganism comprises a YhhS variant, the variant comprising a substitution of an amino acid at a specific position in the amino acid sequence corresponding to SEQ ID NO: 3 with another amino acid; and (c) the activity of the Ahp protein is enhanced compared to the endogenous activity.

[0010] Another object of the present disclosure is to provide a method for producing O-phosphoserine using the O-phosphoserine-producing recombinant microorganism of the present disclosure.

[0011] Another object of the present disclosure is to provide a method for producing cysteine ​​or a cysteine ​​derivative using the recombinant microorganism producing O-phosphoserine disclosed herein.

[0012] Beneficial effects

[0013] Compared with existing unmodified strains, the recombinant O-phosphoserine-producing microorganism disclosed herein can produce O-phosphoserine at a high yield. DETAILED DESCRIPTION

[0014] The present disclosure will be described in detail below. Meanwhile, each description and embodiment described herein can be applied to other descriptions and embodiments respectively. That is to say, all combinations of the various elements described herein fall within the scope of the present disclosure. In addition, the scope of the present disclosure is not limited by the specific description described below.

[0015] In addition, many papers and patent documents are cited in this specification, and the contents of the cited papers and patent documents are incorporated herein by reference in their entirety to more clearly describe the technical level of the present disclosure and the content of the present disclosure.

[0016] One aspect of the present disclosure provides a recombinant microorganism that produces O-phosphoserine, wherein: (a) the activity of the MntH protein is enhanced compared to the endogenous activity; and (b) the microorganism comprises a YhhS variant, which comprises a substitution of an amino acid at a specific position in the amino acid sequence corresponding to SEQ ID NO: 3 with another amino acid.

[0017] Specifically, the recombinant microorganism that produces O-phosphoserine can: (a) exhibit enhanced MntH protein activity compared to endogenous activity; and (b) contain a YhhS variant, which contains another amino acid substitution of the amino acid at position 129 and / or 241 in the amino acid sequence corresponding to SEQ ID NO: 3.

[0018] Furthermore, the YhhS variant may further comprise substitutions of the amino acids corresponding to positions 246 and / or 330 in the amino acid sequence of SEQ ID NO:3.

[0019] As used herein, the term "O-phosphoserine (OPS)" refers to a phosphate ester of serine, which is a component of many proteins. OPS is a precursor of L-cysteine ​​and can be converted to cysteine ​​by reacting with sulfide under the catalysis of OPS sulfhydrylase (OPSS), but is not limited thereto (U.S. Patent No. US 8557549B2).

[0020] The recombinant O-phosphoserine-producing microorganism disclosed herein is a microorganism having enhanced MntH protein activity compared to endogenous activity.

[0021] As used herein, the term "MntH protein" is a protein having divalent ion transporter activity, which is classified into the NRAMP family and may be, for example, Mn 2+ As used herein, the term "Mn 2+ The natural resistance-associated macrophage protein (NRAMP) transporter (MntH) is a protein that has 2+ / Fe 2+ :H + A protein having symporter activity that imports manganese (Mn) into cells.

[0022] The amino acid sequence of the MntH protein can be obtained from known databases such as NCBI GenBank.

[0023] In one example, the MntH protein of the present disclosure may be derived from a microorganism, specifically a microorganism of the genus Escherichia, but is not limited thereto.

[0024] In another example, the amino acid sequence of the MntH protein disclosed herein may be WP000186369.1 or EEW8215783.1 derived from Escherichia coli; however, it is apparent that proteins having MntH protein activity from various sources may be included.

[0025] In the present disclosure, the MntH protein may have, include, consist of, or may essentially consist of the amino acid sequence of SEQ ID NO: 1.

[0026] In the present disclosure, the MntH protein may comprise an amino acid sequence having 70% or more, 75% or more, 76% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, 99.5% or more, 99.7% or more, or 99.9% or more homology or identity with the amino acid sequence of SEQ ID NO: 1. In addition, it is apparent that any protein having an amino acid sequence in which a portion of the sequence is deleted, modified, substituted, conservatively substituted or added may also fall within the scope of the present disclosure, as long as the amino acid sequence has such homology or identity and exhibits an efficacy equivalent to that of a protein comprising the amino acid sequence of SEQ ID NO: 1. In one example, the MntH protein may consist of 412 to 428 amino acids comprising the amino acid sequence of SEQ ID NO: 1.

[0027] For example, this includes sequence additions or deletions, naturally occurring mutations, silent mutations, or conservative substitutions at the N-terminus, C-terminus, and / or internal regions of the amino acid sequence that do not alter the function of the disclosed proteins.

[0028] As used herein, the term "conservative substitution" refers to replacing an amino acid with another amino acid having similar structure and / or chemical properties. Such amino acid substitutions can generally occur based on the similarity of the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic properties of the residues. For example, among charged amino acids, positively charged (basic) amino acids include arginine, lysine, and histidine, and negatively charged (acidic) amino acids include glutamic acid and aspartic acid. Among uncharged amino acids, non-polar amino acids include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, and proline, and polar or hydrophilic amino acids include serine, threonine, cysteine, tyrosine, asparagine, and glutamine. Among the above-mentioned amino acids, aromatic amino acids include phenylalanine, tryptophan, and tyrosine. Generally, conservative substitutions have little or no effect on the activity of proteins or polypeptides.

[0029] As used herein, the term "homology" or "identity" refers to the degree of similarity between two given amino acid sequences or nucleotide sequences and can be expressed as a percentage. The terms "homology" and "identity" are often used interchangeably.

[0030] The sequence homology or identity of conserved polynucleotides or polypeptides can be determined by standard comparison algorithms, and can be used together with the default gap penalty set up by the used program. Basically, homology or identical sequences can hybridize with each other in whole or in part usually under medium or high stringency conditions. Obviously, hybridization also includes polynucleotide hybridization with codons that contain universal codons or take into account the degeneracy of codons in the polynucleotide.

[0031] Whether any two polynucleotide or polypeptide sequences share homology, similarity or identity can be determined using known computer algorithms, such as the "FASTA" program, using the default parameters of Pearson et al. (1988) Proc. Natl. Acad. Sci. USA 85:2444. Alternatively, it can be determined by the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48:443-453), which is implemented using the Needleman program (version 5.0.0 or later) in the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16:276-277) (GCG program package (Devereux, J. et al., Nucleic Acids Research 12:387 (1984)), BLASTP, BLASTN, FASTA (Atschul, SF et al., J Mol Biol 215:403 (1990); Guide to Huge Computers, Martin J. Bishop, ed., Academic Press, San Diego, 1994, and CARILLO et al. (1988) SIAM J Applied Math 48:1073). For example, homology, similarity, or identity can be determined by using BLAST or ClustalW from the National Center for Biotechnology Information.

[0032] Homology, similarity or identity of polynucleotides or polypeptides can be determined by comparing sequence information using, for example, the GAP computer program, e.g., Needleman et al. (1970), J Mol Biol. 48:443, as disclosed in Smith and Waterman, Adv. Appl. Math (1981) 2:482. In summary, the GAP program defines homology, similarity or identity as the value obtained by dividing the number of similar aligned symbols (i.e., nucleotides or amino acids) by the total number of symbols in the shorter of the two sequences. Default parameters for the GAP program can include: (1) a unitary comparison matrix (including a value of 1 for identity and a value of 0 for non-identity), and the weighted comparison matrix of Gribskov et al. (1986) Nucl. Acids Res. 14:6745 (or the EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix), as disclosed in Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10 and a gap extension penalty of 0.5); and (3) no penalty for end gaps.

[0033] The MntH protein of the present disclosure may be encoded by an mntH gene.

[0034] In one example, the mntH gene may be a polynucleotide encoding EEW8215783.1 derived from Escherichia coli, but is not limited thereto. In another example, the mntH gene may be a polynucleotide encoding WP_000186369.1 derived from Escherichia coli, and in another example, it may be a sequence contained in CP116188.1 derived from Escherichia coli, but is not limited thereto, and it is apparent that the gene may include mntH genes encoding proteins having MntH protein activity from various sources.

[0035] As used herein, the term "polynucleotide" refers to a DNA or RNA chain of at least a certain length and a polymer of nucleotides, wherein the nucleotide monomers are linked to form a long chain by covalent bonds. More specifically, it refers to a polynucleotide fragment that encodes a protein.

[0036] The polynucleotide encoding the MntH protein of the present disclosure may include a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 1. In one example of the present disclosure, the polynucleotide of the present disclosure may have or include the nucleotide sequence of SEQ ID NO: 2. In addition, the polynucleotide of the present disclosure may consist of or essentially consist of the nucleotide sequence of SEQ ID NO: 2. Specifically, the mntH gene may be encoded by the polynucleotide shown in the nucleotide sequence of SEQ ID NO: 2.

[0037] Taking into account codon degeneracy or preferred codons in the organism in which the MntH protein of the present invention is to be expressed, the polynucleotides of the present invention may be modified in various ways in the coding region without changing the amino acid sequence of the MntH protein. Specifically, the polynucleotides of the present invention may have or include a nucleotide sequence having 70% or more, 75% or more, 76% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity to the sequence of SEQ ID NO: 2, or may consist of or be essentially composed of a nucleotide sequence having 70% or more, 75% or more, 76% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity to the sequence of SEQ ID NO: 2, but are not limited thereto.

[0038] In addition, the polynucleotides of the present disclosure may include, but are not limited to, probes that can be prepared from known gene sequences, for example, any polynucleotide sequence that can hybridize under stringent conditions with all or part of the complementary sequence of the polynucleotide sequence of the present disclosure. The term "stringent conditions" refers to conditions that enable specific hybridization between polynucleotides. Such conditions are disclosed in detail in the literature (see J. Sambrook et al., Molecular Cloning, A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8). For example, stringent conditions may include conditions under which polynucleotides with high homology or identity, i.e., polynucleotides with homology or identity of 70% or more, 75% or more, 76% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more, hybridize to each other, while polynucleotides with lower homology or identity do not hybridize to each other; or may include conventional Southern hybridization washing conditions, i.e., washing is performed once, particularly 2 to 3 times, at a salt concentration and temperature corresponding to 60°C, 1×SSC, 0.1% SDS, specifically 60°C, 0.1×SSC, 0.1% SDS, more specifically 68°C, 0.1×SSC, 0.1% SDS.

[0039] Hybridization requires that the two nucleic acids have complementary sequences, although mismatches between bases are possible depending on the stringency of the hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize to each other. For example, in DNA, adenine is complementary to thymine, and cytosine is complementary to guanine. Therefore, the polynucleotides of the present disclosure may also include isolated nucleic acid fragments that are complementary to the entire sequence, as well as nucleic acid sequences that are substantially similar thereto.

[0040] Specifically, one can use a m The hybridization conditions of the hybridization step are 55°C. Polynucleotides having homology or identity with the polynucleotides disclosed herein are detected under the above conditions. m The value may be 60° C., 63° C. or 65° C., but is not limited thereto, and may be appropriately adjusted by a person skilled in the art according to the purpose.

[0041] The appropriate stringency for hybridizing polynucleotides depends on the length of the polynucleotides and the degree of complementation, and these variables are well known in the art (eg, J. Sambrook et al., supra).

[0042] As used herein, the term "vector" refers to a DNA construct containing a polynucleotide sequence encoding a target protein, which is operably linked to an expression control sequence suitable for expressing the target protein in a suitable host. The expression control sequence may include a promoter capable of initiating transcription, any operator sequence that regulates transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence that regulates transcription and translation termination. Once the vector is transformed into a suitable host cell, it can replicate or function independently of the host genome, or it can be integrated into its genome.

[0043] The vector used in the present disclosure is not particularly limited, as long as it can be replicated in a host cell, any vector known in the art can be used. Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses and phages. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, Charon21A, etc. can be used as phage vectors or cosmid vectors; those based on pDZ, pBR, pUC, pBluescriptII, pGEM, pTZ, pCL, pET, etc. can be used as plasmid vectors. Specifically, pSKH130 (U.S. Patent Application Publication No. 2020-0048619), pSK, pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors, etc. can be used.

[0044] Insertion of the polynucleotide into the chromosome can be performed by any method known in the art, such as homologous recombination, but is not limited thereto.

[0045] As used herein, the term "transformation" refers to the introduction of a recombinant vector containing a polynucleotide encoding a target protein into a host cell so that the protein encoded by the polynucleotide can be expressed in the host cell. The polynucleotide may be located in the chromosome of the host cell or may be present outside the chromosome, as long as the polynucleotide transformed can be expressed in the host cell. The transformation method includes any method by which nucleic acid is introduced into a cell, and can be performed by selecting suitable standard techniques known in the art according to the host cell. For example, transformation can be performed by electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) technology, DEAE-dextran technology, cationic liposome technology, and lithium acetate-DMSO technology, but the method is not limited thereto.

[0046] In addition, as used herein, the term "operably linked" refers to a polynucleotide sequence that is functionally linked to a promoter sequence or expression regulatory region that initiates and mediates transcription of a polynucleotide encoding a target protein of the present disclosure. Operable linkage can be prepared using genetic recombination techniques known in the art, and site-specific DNA cleavage and ligation can be prepared using cleavage enzymes and ligases known in the art, but the preparation is not limited thereto.

[0047] As used herein, the term "enhancement" of a polypeptide (e.g., the protein specified by the name of each enzyme) refers to an increase in polypeptide activity compared to endogenous activity. Enhancement can be used interchangeably with terms such as activation, upregulation, overexpression, increase, etc. In particular, activation, enhancement, upregulation, overexpression, and increase can obtain an activity that was not initially present and can also show an increase in activity compared to endogenous activity or activity before modification. The term "endogenous activity" refers to the activity of a specific polypeptide originally present in a parent strain or unmodified microorganism before transformation when a trait is changed by genetic modification caused by natural or artificial factors, and can be used interchangeably with "activity before modification." "Enhancement," "upregulation," "overexpression," or "increase" of polypeptide activity compared to endogenous activity refers to an increase in the activity and / or concentration (expression level) of a polypeptide compared to an endogenous activity.

[0048] Enhancement can be achieved by introducing an exogenous polypeptide or by increasing the activity and / or concentration (expression level) of an endogenous polypeptide. Enhancement of polypeptide activity can be confirmed by an increase in polypeptide activity level, expression level, or the amount of the polypeptide secretion product.

[0049] For the purposes of this disclosure, the microorganisms disclosed herein have enhanced MntH protein activity, thereby enhancing OPS production capacity. As a reference strain for comparing OPS production capacity or MntH protein increase, an unmodified microorganism in which MntH protein is not enhanced can be wild-type Escherichia coli K-12W3100 or CA07-0012, but is not limited thereto.

[0050] The enhancement of polypeptide activity can be achieved by various methods well known in the art, as long as the activity of the target polypeptide is enhanced compared to the microorganism before modification, the method is not limited. Specifically, genetic engineering and / or protein engineering well known to those of ordinary skill in the art can be used to achieve this, which is a conventional molecular biology technique, but is not limited thereto (e.g., Sitnicka et al., Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2, 1-16, Sambrook et al., Molecular Cloning 2012, etc.).

[0051] Specifically, enhancing the activity of the polypeptide of the present disclosure can be achieved by:

[0052] 1) increasing the copy number of the polynucleotide encoding the polypeptide in the cell;

[0053] 2) Modify the expression regulatory sequence of the gene encoding the polypeptide on the chromosome;

[0054] 3) modifying the nucleotide sequence encoding the start codon or 5'-UTR of the gene transcript encoding the polypeptide;

[0055] 4) Modifying the amino acid sequence of a polypeptide to enhance its activity;

[0056] 5) Modifying a polynucleotide sequence encoding a polypeptide so that the activity of the polypeptide is enhanced (for example, modifying the polynucleotide sequence of a polypeptide gene so that the polynucleotide sequence encodes a modified polypeptide to enhance the activity of the polypeptide);

[0057] 6) introducing an exogenous polypeptide expressing the polypeptide activity or an exogenous polynucleotide encoding the polypeptide;

[0058] 7) codon optimization of the polynucleotide encoding the polypeptide;

[0059] 8) Analyze the tertiary structure of the polypeptide and select and modify exposed sites or perform chemical modifications thereon;

[0060] 9) regulating the cellular localization of a polypeptide; or

[0061] 10) A combination of two or more selected from the above 1) to 9), but the method is not particularly limited thereto.

[0062] More specifically,

[0063] 1) The method for increasing the number of copies of a polynucleotide encoding a protein (polypeptide) in a cell can be achieved by introducing a vector comprising a polynucleotide encoding a protein (polypeptide) into a host cell (microorganism), wherein the polynucleotide is operably linked to a suitable regulatory sequence. Alternatively, the method can be achieved by introducing one copy or two or more copies of a polynucleotide encoding a protein (polypeptide) into the chromosome of a host cell (microorganism), wherein the polynucleotide is operably linked to a suitable regulatory sequence. Introduction into the chromosome can be carried out by introducing a vector capable of inserting a polynucleotide into the chromosome of a host cell (microorganism) into the host cell (microorganism), but is not limited thereto. The vector is as described above. With respect to the polynucleotide sequence encoding a protein, the regulatory sequence can be a natural sequence (of the same origin) or an exogenous sequence (derived from a different gene), a variant thereof or another artificial sequence, and can induce the expression of the polynucleotide in the host cell (microorganism).

[0064] 2) The method of replacing the expression regulatory region (or expression regulatory sequence) of the gene encoding the protein (polypeptide) on the chromosome with a sequence having strong activity can be achieved by, for example, introducing modifications to the sequence by deletion, insertion, substitution or a combination thereof to further enhance the activity of the expression regulatory region, or by replacing the sequence with a sequence having stronger activity. The expression regulatory region may include, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence that regulates transcription and translation termination. In one example, it can specifically include replacing the original promoter with a strong promoter, but is not limited to this.

[0065] Examples of known strong promoters include CJ1 to CJ7 promoters (U.S. 7662943B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13 (sm3) promoter (U.S. 10584338B2), O2 promoter (U.S. 10273491B2), tkt promoter, yccA promoter, rmf promoter and serC promoter, but strong promoters are not limited thereto.

[0066] 3) The method of modifying the nucleotide sequence encoding the start codon or 5'-UTR of the gene transcript encoding the protein (polypeptide) can be achieved by, for example, modifying the nucleotide sequence so that it encodes a different start codon that has a higher protein (polypeptide) expression rate compared to the endogenous start codon, or modifying the nucleotide sequence so that it encodes a ribosome binding site (RBS) sequence that has a higher protein (polypeptide) expression rate compared to the endogenous RBS sequence, but is not limited thereto.

[0067] Methods 4) and 5) for modifying the amino acid sequence or polynucleotide sequence of a protein (polypeptide) can be achieved by introducing modifications into the sequence through deletion, insertion, substitution, or a combination thereof of the amino acid sequence of the protein (polypeptide) or the polynucleotide sequence encoding the protein (polypeptide) to enhance the activity of the protein (polypeptide), or by replacing the sequence with an amino acid sequence or polynucleotide sequence modified to have enhanced activity, but are not limited thereto. Specifically, replacement can be achieved by inserting a polynucleotide into a chromosome through homologous recombination, but is not limited thereto.

[0068] 6) Methods for introducing exogenous polynucleotides that exhibit protein (polypeptide) activity can be achieved by introducing an exogenous polynucleotide encoding a protein (polypeptide) that exhibits the same / similar activity as the protein (polypeptide) into a host cell (microorganism). The exogenous polynucleotide is not limited by its source or sequence, as long as it exhibits the same / similar activity as the protein (polypeptide). Introduction can be performed by a transformation method known in the art, appropriately selected by one of ordinary skill in the art, and expression of the introduced polynucleotide in the host cell can produce the protein (polypeptide), thereby increasing its activity.

[0069] 7) The method of codon optimization of polynucleotides encoding proteins (polypeptides) can be achieved by: codon optimization of endogenous polynucleotides to increase transcription or translation in host cells (microorganisms), or by optimizing codons so that optimized transcription and translation of exogenous polynucleotides can be achieved in host cells.

[0070] 8) The method of analyzing the tertiary structure of a protein (polypeptide) and thereby selecting and modifying exposed sites or chemically modifying them can be achieved as follows: for example, the sequence information of the protein (polypeptide) to be analyzed is compared with a database storing sequence information of known proteins to determine template protein candidates based on the degree of sequence similarity, and the structure is confirmed based on the information, thereby selecting and transforming or modifying the exposed sites to be modified or chemically modified.

[0071] 9) Methods for regulating the cellular localization of proteins (polypeptides) can be achieved by targeting the protein (polypeptide) to a specific organelle or specific space within the cell. For example, this can be achieved by adding or removing a leader sequence that plays a role in targeting the protein (polypeptide) to the periplasm or cytoplasm, but is not limited thereto.

[0072] Such enhancement of protein (polypeptide) activity may refer to an increase in the activity or concentration of the corresponding protein (polypeptide), or an increase in the amount of a product produced by the protein (polypeptide), relative to the activity or concentration of the protein (polypeptide) expressed in a wild-type strain or a host cell (microorganism) before modification, but is not limited thereto.

[0073] As used herein, the term "strain before modification" or "microorganism before modification" does not exclude strains containing mutations that may occur naturally in microorganisms, and may refer to wild-type strains or natural strains themselves, or strains before their properties are changed due to genetic modification caused by natural or artificial factors. In the present disclosure, the change in properties can be an enhancement of MntH protein activity. The term "strain before modification" or "microorganism before modification" can be used interchangeably with "unmutated strain", "unmodified strain", "unmutated microorganism", "unmodified microorganism" or "reference microorganism".

[0074] The recombinant O-phosphoserine-producing microorganism of the present disclosure comprises a YhhS variant in which an amino acid at a specific position corresponding to the YhhS protein having the amino acid sequence of SEQ ID NO: 3 is substituted with another amino acid.

[0075] As used herein, the term "YhhS" refers to a polypeptide that exhibits O-phosphoserine (OPS) export activity, specifically, a membrane protein capable of exporting OPS to the extracellular space. In the present disclosure, YhhS may be a YhhS major cotransporter superfamily (MFS) transporter, which is a membrane protein capable of exporting OPS to the extracellular space. YhhS has been identified as a protein that exhibits OPS export activity from Escherichia coli, where growth inhibition is alleviated under conditions of excess OPS.

[0076] Specifically, the YhhS of the present disclosure can be used interchangeably with the YhhS MFS transporter. In the present disclosure, the amino acid sequence of YhhS can be obtained from known databases such as NCBI GenBank. Specifically, the amino acid sequence can be a polypeptide encoded by the yhhS gene that exhibits YhhS activity, more specifically, having, comprising, consisting of, or essentially consisting of the amino acid sequence of SEQ ID NO: 3.

[0077] In the YhhS variant disclosed herein, the amino acid at position 129 and / or 241 in the amino acid sequence corresponding to SEQ ID NO: 3 may each be substituted with another amino acid.

[0078] In one example, the amino acid at position 129 in the amino acid sequence corresponding to SEQ ID NO: 3 may be a polar amino acid. The polar amino acid may be, for example, serine, threonine, cysteine, tyrosine, asparagine or glutamine, particularly serine.

[0079] In the YhhS variants of the present disclosure, the amino acid at position 129 in the amino acid sequence corresponding to SEQ ID NO: 3 may be substituted with a non-polar amino acid. The non-polar amino acid may be, for example, alanine, glycine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, or proline, particularly alanine or glycine. The YhhS variants may include amino acid sequences having 70% or more, 75% or more, 76% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, 99.5% or more, 99.7% or more, or 99.9% or more homology or identity with an amino acid sequence in which the amino acid at position 129 in the amino acid sequence corresponding to SEQ ID NO: 3 is alanine or glycine. In addition, it is obvious that variants having amino acid sequences in which part of the sequence is deleted, modified, substituted, conservatively substituted or added are also included in the scope of the present disclosure, as long as the amino acid sequence has such homology or identity with the variant of the present disclosure and exhibits equivalent efficacy. For example, the variant may include sequence additions or deletions, naturally occurring mutations, silent mutations or conservative substitutions at the N-terminus, C-terminus and / or within the amino acid sequence that do not change the function of the variant of the present disclosure.

[0080] In the YhhS variants disclosed herein, the amino acid at position 241 in the amino acid sequence corresponding to SEQ ID NO: 3, isoleucine, can be substituted with threonine or glutamine. YhhS variants may include amino acid sequences having 70% or more, 75% or more, 76% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, 99.5% or more, 99.7% or more, or 99.9% or more homology or identity with an amino acid sequence in which the amino acid at position 241 in the amino acid sequence corresponding to SEQ ID NO: 3 is glutamine or threonine. In addition, it is apparent that variants having amino acid sequences in which a portion of the sequence is deleted, modified, substituted, conservatively substituted, or added are also included within the scope of the present disclosure, as long as the amino acid sequence has such homology or identity and exhibits an efficacy equivalent to that of the variants disclosed herein. For example, the variants may include N-terminal, C-terminal and / or internal additions or deletions, naturally occurring mutations, silent mutations or conservative substitutions thereof that do not alter the function of the disclosed variants.

[0081] Furthermore, the YhhS variant of the present disclosure may be a YhhS variant in which the amino acid corresponding to position 129 in the amino acid sequence of SEQ ID NO: 3 is substituted with another amino acid, and the amino acid corresponding to position 241 is substituted with another amino acid.

[0082] Furthermore, in the YhhS variants disclosed herein, in addition to the substitution of the amino acid at position 129 and / or 241 in the amino acid sequence of SEQ ID NO: 3, the amino acid at position 246 and / or 330 in the amino acid sequence of SEQ ID NO: 3 may each be substituted with another amino acid.

[0083] Specifically, it may also include amino acid substitutions, wherein the amino acid aspartic acid at position 246 in the amino acid sequence corresponding to SEQ ID NO: 3 is replaced by valine, and / or the amino acid valine at position 330 in the amino acid sequence corresponding to SEQ ID NO: 3 is replaced by isoleucine.

[0084] Furthermore, in the YhhS variant disclosed herein, the amino acid at position 88 in the amino acid sequence of SEQ ID NO: 3 may be phenylalanine, and the amino acid at position 207 in the amino acid sequence of SEQ ID NO: 3 may be lysine.

[0085] Specifically, the YhhS variants of the present disclosure may include the following amino acid sequences: SEQ ID NO: 5, wherein the amino acid serine at position 129 in the amino acid sequence corresponding to SEQ ID NO: 3 is replaced by alanine; SEQ ID NO: 6, wherein the amino acid serine at position 129 in the amino acid sequence corresponding to SEQ ID NO: 3 is replaced by glycine; SEQ ID NO: 7, wherein the amino acid isoleucine at position 241 in the amino acid sequence corresponding to SEQ ID NO: 3 is replaced by threonine; SEQ ID NO: 8, wherein the amino acid isoleucine at position 241 in the amino acid sequence corresponding to SEQ ID NO: 3 is replaced by glutamine; or SEQ ID NO: 9, wherein the amino acid serine at position 129 in the amino acid sequence corresponding to SEQ ID NO: 3 is replaced by glycine, the amino acid isoleucine at position 241 is replaced by threonine, the amino acid aspartic acid at position 246 is replaced by valine, and the amino acid valine at position 330 is replaced by isoleucine.

[0086] The YhhS variant disclosed herein may be a polypeptide consisting of or comprising the amino acid sequence of SEQ ID NOS: 5 to 9.

[0087] In addition, the YhhS variants of the present disclosure may have a sequence having 99% or greater sequence identity (homology or identity) to the amino acid sequences of SEQ ID NOS: 5 to 9, but it may have 90% or greater, 91% or greater, 92% or greater, 93% or greater, 94% or greater, 95% or greater, 96% or greater, 97% or greater, 98% or greater, 99% or greater, 99.1% or greater, 99.2% or greater, 99.3% or greater, 99.4% or greater, 99.5% or greater, 99.6% or greater, 99.7% or greater, 99.8% or greater, or 99.9% or greater sequence identity to the amino acid sequences of SEQ ID NOS: 5 to 9. Furthermore, it is apparent that variants having an amino acid sequence in which part of the sequence is deleted, modified, substituted, conservatively substituted or added are also included in the scope of the present disclosure, as long as the amino acid sequence has such homology or identity with the YhhS variant of the present disclosure and exhibits equivalent efficacy.

[0088] As used herein, the terms "conservative substitutions", "homology" and "identity" are as described above.

[0089] As used herein, the term "variant" refers to a polypeptide in which one or more amino acids are conservatively substituted and / or modified so that the amino acid sequence is different from the sequence before the variant mutation, but the function or property is maintained. Such variants can generally be identified by modifying one or more amino acids in the polypeptide amino acid sequence and evaluating the properties of the modified polypeptide. That is, the ability of the variant can be enhanced, unchanged or reduced compared to the polypeptide before mutation. In addition, some variants can include variants in which one or more parts, such as the N-terminal leader sequence or the transmembrane domain have been removed. Other variants can include variants in which a part has been removed from the N- and / or C-terminus of the mature protein. The term "variant" can be used interchangeably with terms such as modification, modified polypeptide, modified protein, mutant, mutant protein and disproportionate (divergent), and is not limited thereto, as long as it is a term used in the sense of mutation.

[0090] In one example, the YhhS variants of the present disclosure can exhibit YhhS activity. In addition, the variants of the present disclosure can exhibit enhanced OPS export activity compared to the wild-type polypeptide.

[0091] In addition, variants may include deletions or additions of amino acids that have minimal effect on the properties and secondary structure of the polypeptide. For example, a signal (or leader) sequence involved in protein transfer may be conjugated to the N-terminus of the variant in a co-translational or post-translational manner. Variants may be conjugated to other sequences or linkers for identification, purification, or synthesis.

[0092] As used herein, the term "corresponding to" refers to an amino acid residue at a specific position in a polypeptide, or an amino acid residue that is similar, identical, or homologous to an amino acid residue at a specific position in a polypeptide. Identifying an amino acid at a corresponding position can be determining a specific amino acid in a sequence with reference to a specific sequence. As used herein, the term "corresponding region" generally refers to a similar or corresponding position in a related protein or a reference protein.

[0093] For example, by aligning a given amino acid sequence with SEQ ID NO: 3, each amino acid residue of the amino acid sequence can be numbered with reference to the position numbering of the amino acid residue in SEQ ID NO: 3. For example, a sequence alignment algorithm as described in the present disclosure can be used to compare a sequence to a query sequence (also referred to as a "reference sequence") to determine the position of an amino acid, or the position at which a modification (e.g., substitution, insertion, or deletion) has occurred.

[0094] For this comparison, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J.Mol.Biol.48:443-453) can be used, the Needleman program of the EMBOSS package (EMBOSS:The European Molecular Biology OpenSoftware Suite, Rice et al., (2000), Trends Genet.16:276-277) etc., but the program to be used is not limited thereto. Any sequence alignment program known in the art, such as the pairwise alignment algorithm, can be suitably used.

[0095] The recombinant microorganisms of the present disclosure that produce O-phosphoserine are microorganisms having enhanced MntH protein activity compared to endogenous activity, and include the aforementioned YhhS variants of the present disclosure. Specifically, the recombinant microorganisms can be microorganisms that exhibit O-phosphoserine production capacity, and the production capacity can be increased compared to endogenous O-phosphoserine production capacity.

[0096] As used herein, the term "microorganism (or strain)" includes wild-type microorganisms and microorganisms that have been genetically modified, whether natural or artificial. It can be a microorganism that has been genetically modified to produce a target polypeptide, protein, or product, wherein a specific mechanism is weakened or enhanced due to factors such as the insertion of exogenous genes and the enhancement or inactivation of endogenous gene activity.

[0097] As used herein, the term "O-phosphoserine (OPS) producing microorganism" refers to a microorganism that naturally has the ability to produce OPS or a microorganism in which the OPS production ability is imparted to a parent strain that does not have the OPS production ability. Specifically, the microorganism can be an OPS producing microorganism with enhanced MntH protein activity due to natural or artificial genetic modification, and it comprises a YhhS variant. For the purposes of this disclosure, the OPS producing microorganism can be any microorganism capable of producing OPS, wherein the MntH protein activity is enhanced by the method disclosed herein and it comprises a YhhS variant. As used herein, "O-phosphoserine (OPS) producing microorganism" can be used interchangeably with "a microorganism that produces O-phosphoserine (OPS)" or "a microorganism with O-phosphoserine (OPS) production ability."

[0098] In one example, the microorganism of the present disclosure may be a genetically modified microorganism or a recombinant microorganism in which the activity of the MntH protein is enhanced and the microorganism comprises a YhhS variant, thereby increasing the desired OPS production capacity, but is not limited thereto. The recombinant microorganism may be a microorganism with enhanced OPS production capacity compared to endogenous OPS production capacity.

[0099] In one example, the recombinant microorganism with enhanced OPS productivity can show an increase of about 1% or more, specifically, about 1.7% or more, 2% or more, about 2.3% or more, about 3% or more, about 4% or more, about 5% or more, about 5.3% or more, about 6% or more, about 7% or more, about 8% or more, about 9% or more, or about 10% or more (the upper limit is not particularly limited, for example, about 200% or less, about 150% or less, about 100% or less, about 50% or less, about 40% or less, about 30% or less, about 20% or less, or about 15% or less) OPS productivity compared to the OPS productivity of the parent strain or unmodified microorganism before modification. However, the OPS productivity of the recombinant microorganism is not limited thereto, as long as it shows a positive increase compared to the productivity of the parent strain or unmodified microorganism before modification. In another example, the microorganism with enhanced OPS-producing ability may have an OPS-producing ability increased by about 1.01 times or more, about 1.017 times or more, about 1.02 times or more, about 1.023 times or more, about 1.03 times or more, about 1.04 times or more, about 1.05 times or more, about 1.053 times or more, about 1.06 times or more, about 1.07 times or more, about 1.08 times or more, about 1.09 times or more, or about 1.10 times or more (the upper limit is not particularly limited, for example, about 10 times or less, about 5 times or less, about 3 times or less, or about 2 times or less), compared to the OPS-producing ability of the parent strain or unmodified microorganism before modification, but is not limited thereto.

[0100] As used herein, the term "unmodified microorganism" does not exclude strains containing mutations that may occur naturally in microorganisms, and can refer to wild-type strains or natural strains themselves, or strains before their properties are changed due to genetic mutations caused by natural or artificial factors. For example, an unmodified microorganism can refer to a strain before the MntH protein of the present disclosure is enhanced, a strain into which a YhhS variant is not introduced, and / or a strain before the introduction of a YhhS variant. "Unmodified microorganism" can be used interchangeably with "strain before modification," "microorganism before modification," "unmutated strain," "unmodified strain," "unmutated microorganism," or "reference microorganism."

[0101] In another example of the present disclosure, the microorganism of the present disclosure can be a microorganism capable of producing OPS, and the type is not particularly limited. The microorganism of the present disclosure can be a prokaryotic cell or a eukaryotic cell, specifically a prokaryotic cell. The prokaryotic cell can include, for example, a microbial strain belonging to the genus Escherichia, the genus Erwinia, the genus Serratia, the genus Providencia, the genus Corynebacterium, or the genus Brevibacterium. More specifically, the microorganism can belong to the genus Escherichia, and even more specifically, it can be Escherichia coli, but is not limited thereto. Specifically, in the case of the microorganism belonging to the genus Escherichia of the present disclosure, OPS and L-serine can be produced using SerA, SerC and SerB, which are enzymes involved in the L-serine biosynthesis pathway (Ahmed Zahoor, Computational and structural biotechnology journal, Vol. 3, October 2012; Wendisch VF et al., Curr Opin Microbiol. 2006 Jun; 9(3):268-74; Peters-Wendisch P et al., Appl Environ Microbiol. 2005 Nov; 7 1(11):7 139-44.).

[0102] The OPS-producing microorganisms of the present disclosure may also exhibit enhanced alkyl hydroperoxide reductase (Ahp) protein activity compared to endogenous activity.

[0103] As used herein, the term "alkyl hydroperoxide reductase (Ahp)" refers to a protein having the activity of converting NADH into NAD+. Alkyl hydroperoxide reductase can be used interchangeably with Ahp protein and Ahp.

[0104] The Ahp protein can be composed of alkyl hydroperoxide reductase subunit C (AhpC) and alkyl hydroperoxide reductase subunit F (AhpF). The amino acid sequence of AhpC or AhpF can be obtained from known databases such as NCBI GenBank.

[0105] In one example, the AhpC or AhpF of the present disclosure may be derived from a microorganism, specifically a microorganism derived from the genus Escherichia, but is not limited thereto.

[0106] In another example, the amino acid sequence of AhpC disclosed herein can be UMQ15446.1 derived from Escherichia coli, and the amino acid sequence of AhpF can be WP_000979839.1 derived from Escherichia coli. Obviously, the amino acid sequence can include proteins with AhpC or AhpF activity from different sources. In one example, AhpC can be UMQ15446.1, EFF4225430.1, or WP_000052796.1, and AhpF can be NCBI Accession No. ANK05951.1, EFS6382721.1, or HCD8516410.1.

[0107] In the present disclosure, AhpC may have, include, or consist of, or may consist essentially of, the amino acid sequence of SEQ ID NO: 15. In the present disclosure, AhpF may have, include, or consist of, or may consist essentially of, the amino acid sequence of SEQ ID NO: 17.

[0108] In the present disclosure, the amino acid sequence of AhpC may include an amino acid sequence having 70% or more, 75% or more, 76% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, 99.5% or more, 99.7% or more, or 99.9% or more homology or identity to the amino acid sequence of SEQ ID NO: 15. In the present disclosure, the amino acid sequence of AhpF may include an amino acid sequence having 70% or more, 75% or more, 76% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, 99.5% or more, 99.7% or more, or 99.9% or more homology or identity to the amino acid sequence of SEQ ID NO: 17. Furthermore, it is apparent that any protein having an amino acid sequence in which a portion of the sequence is deleted, modified, substituted, conservatively substituted, or added also falls within the scope of the present disclosure, as long as the amino acid sequence has such homology or identity and exhibits efficacy corresponding to the protein comprising the amino acid sequence of SEQ ID NO: 15 and / or 17. In one example, AhpC may consist of 187 to 193 amino acids, comprising the amino acid sequence of SEQ ID NO: 15. In another example, AhpF may consist of 521 to 531 amino acids, comprising the amino acid sequence of SEQ ID NO: 17. For example, this includes sequence additions or deletions, naturally occurring mutations, silent mutations, or conservative substitutions at the N-terminus, C-terminus, and / or internal regions of the amino acid sequence, which do not alter the function of the protein of the present disclosure.

[0109] As used herein, the terms "conservative substitutions", "homology" and "identity" are as described above.

[0110] AhpC and AhpF of the present disclosure may be encoded by genes of the ahpCF operon.

[0111] As used herein, the term "operon" refers to a functional unit of DNA that includes a group of genes whose expression is regulated by a single expression regulatory sequence, specifically, a single promoter. The mRNA transcribed from an operon can be a polycistronic mRNA, in which a single mRNA molecule encodes one or more proteins, or a monocistronic mRNA, in which a single mRNA molecule encodes a single protein.

[0112] The term "ahpCF operon gene" may be used interchangeably with "ahpCF operon," "ahpCF gene," or "ahp gene."

[0113] The ahpCF operon genes may include an ahpC gene and an ahpF gene.

[0114] In one example, the ahpC gene may be a polynucleotide encoding UMQ15446.1 or a portion of CP101971.1 derived from Escherichia coli, and the ahpF gene may be a polynucleotide encoding WP_000979839.1 derived from Escherichia coli, but the genes are not limited thereto. Obviously, the genes may include ahpC and / or ahpF genes encoding proteins having AhpC and / or AhpF activity from different sources.

[0115] The polynucleotide encoding the Ahp protein of the present disclosure may include a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 15 and / or 17. In one example of the present disclosure, the polynucleotide of the present disclosure may have or include the nucleotide sequence of SEQ ID NO: 16 and / or 18. In addition, the polynucleotide of the present disclosure may consist of or essentially consist of the nucleotide sequence of SEQ ID NO: 16 and / or 18. Specifically, the Ahp protein may be encoded by the polynucleotide shown in the nucleotide sequence of SEQ ID NO: 16 and / or 18.

[0116] Due to codon degeneracy or taking into account the preferred codons in the organism in which Ahp is to be expressed, the polynucleotides encoding the Ahp protein of the present disclosure may be modified in various ways in the coding region without changing the amino acid sequence of the Ahp protein. Specifically, the polynucleotides of the present disclosure may have or include a nucleotide sequence having 70% or more, 75% or more, 76% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity with the sequence of SEQ ID NO: 16 and / or 18, or may consist of or be substantially composed of a nucleotide sequence having 70% or more, 75% or more, 76% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity with the sequence of SEQ ID NO: 16 and / or 18, but are not limited thereto.

[0117] Meanwhile, as described above, an operon is a group of genes whose expression is regulated by a single promoter. The expression of ahpC and ahpF in the ahpCF operon can be regulated by the ahpC promoter. Therefore, in one embodiment of the present disclosure, the ahpCF operon promoter (ahp operon promoter) can be the ahpC promoter.

[0118] The recombinant OPS-producing microorganism of the present disclosure may also exhibit attenuated phosphoserine phosphatase (SerB) activity compared to endogenous activity.

[0119] SerB disclosed herein exhibits the activity of converting OPS into L-serine. Therefore, microorganisms modified to reduce SerB activity accumulate OPS, which may be beneficial for OPS production. SerB disclosed herein may be a protein having or including the amino acid sequence shown in SEQ ID NO: 19, or may be a protein consisting essentially of the amino acid sequence shown in SEQ ID NO: 19, but is not limited thereto. In addition, SerB disclosed herein may have or include an amino acid sequence having 70% or more, 80% or more, 90% or more, 95% or more, or 99% or more homology or identity with the amino acid sequence shown in SEQ ID NO: 19, as long as it exhibits SerB activity. In addition, SerB disclosed herein may consist of or consist essentially of an amino acid sequence having 70% or more, 80% or more, 90% or more, 95% or more, or 99% or more homology or identity with the amino acid sequence shown in SEQ ID NO: 19, but is not limited thereto. In addition, the polynucleotide encoding SerB may have or include a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 19. In addition, the polynucleotide encoding SerB may consist of or consist essentially of a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO: 19. Due to codon degeneracy or taking into account the preferred codons in the organism in which the SerB protein is to be expressed, the polynucleotide encoding SerB of the present disclosure may be modified in various ways in the coding region without changing the amino acid sequence of the SerB protein. The polynucleotide encoding SerB of the present disclosure may have or include a nucleotide sequence having 70% or more, 80% or more, 90% or more, 95% or more, or 99% or more and less than 100% homology or identity with the nucleotide sequence of SEQ ID NO: 20. In addition, the polynucleotide encoding SerB of the present disclosure may consist of or consist essentially of a nucleotide sequence having 70% or more, 80% or more, 90% or more, 95% or more, or 99% or more and less than 100% homology or identity with the nucleotide sequence of SEQ ID NO: 20, but is not limited thereto.

[0120] As used herein, the term "reduction" of polypeptide activity is a comprehensive concept, including that the activity is reduced or inactive compared to the endogenous activity. Reduction can be used interchangeably with terms such as inactivation, lack, downregulation, reduction, decrease and attenuation.

[0121] Attenuation can also include the following situations: due to mutations in the polynucleotide encoding the polypeptide, the polypeptide activity itself is reduced or eliminated compared to the original polypeptide activity of the microorganism; due to the inhibition of gene expression of the polynucleotide encoding the polypeptide or the inhibition of translation into the polypeptide, the overall level of polypeptide activity and / or concentration (expression level) in the cell is reduced compared to the natural strain; the polynucleotide is not expressed at all; and / or even when the polynucleotide is expressed, no polypeptide activity is observed. As used herein, the term "endogenous activity" refers to the activity of a specific polypeptide originally present in the parent strain, wild type or unmodified microorganism before transformation when the trait is changed by genetic modification caused by natural or artificial factors, and can be used interchangeably with "activity before modification". This term can be used interchangeably with "activity before modification". The expression "attenuated", "inactivated", "lack", "reduced", "downregulated", "reduced" or "weakened" of polypeptide activity compared to endogenous activity means that the polypeptide activity is reduced compared to the activity of the specific polypeptide originally present in the parent strain or unmodified microorganism before transformation.

[0122] The attenuation of polypeptide activity can be performed by any method known in the art, but the method is not limited thereto and can be achieved by applying various methods well known in the art (e.g., Nakashima N et al., Bacterialcellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014; 15(2): 2773-2793; Sambrook et al., Molecular Cloning 2012).

[0123] Specifically, attenuating the activity of the polypeptide of the present disclosure can be achieved by:

[0124] 1) Deletion of all or part of the gene encoding the polypeptide;

[0125] 2) Modifying the expression regulatory region (expression regulatory sequence) to reduce the expression of the gene encoding the polypeptide;

[0126] 3) Modifying the amino acid sequence of a polypeptide so that the activity of the polypeptide is eliminated or weakened (for example, deleting / substituting / adding one or more amino acids in the amino acid sequence);

[0127] 4) Modifying the gene sequence encoding the polypeptide so that the activity of the polypeptide is eliminated or weakened (for example, deleting / substituting / adding one or more nucleotides in the nucleotide sequence of the polypeptide gene to encode the modified polypeptide to eliminate or weaken the activity of the polypeptide);

[0128] 5) modifying the nucleotide sequence encoding the start codon or 5'-UTR of the gene transcript encoding the polypeptide;

[0129] 6) introducing an antisense oligonucleotide (e.g., antisense RNA) that binds complementary to the gene transcript encoding the polypeptide;

[0130] 7) adding a sequence complementary to the Shine-Dalgarno (SD) sequence of the gene encoding the polypeptide upstream of the SD sequence to form a secondary structure that prevents ribosome attachment;

[0131] 8) using reverse transcription engineering (RTE) to add a promoter to be reverse transcribed to the 3' end of the open reading frame (ORF) of the gene sequence encoding the polypeptide; or

[0132] 9) Regulate the cellular localization of proteins (peptides); or

[0133] 10) A combination of two or more selected from the above 1) to 9), but not particularly limited thereto.

[0134] For example,

[0135] 1) The method of deleting part or all of the gene encoding the polypeptide can be achieved by deleting all polynucleotides encoding the endogenous target polypeptide in the chromosome, or by replacing the polynucleotide with a partially deleted polynucleotide or a marker gene.

[0136] 2) Methods for modifying the expression regulatory region (or expression regulatory sequence) can be achieved by inducing modification of the expression regulatory region (or expression regulatory sequence) through deletion, insertion, non-conservative substitution, conservative substitution, or a combination thereof, or by replacing the sequence with a sequence having weaker activity. The expression regulatory region may include, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and sequences that regulate transcription and translation termination.

[0137] Methods 3) and 4) for modifying an amino acid sequence or a polynucleotide sequence can be achieved by, but are not limited to, inducing modification of the amino acid sequence of a polypeptide or a polynucleotide sequence encoding the polypeptide by deletion, insertion, non-conservative substitution, conservative substitution, or a combination thereof, thereby reducing the activity of the polypeptide, or by replacing the sequence with a modified amino acid sequence or polynucleotide sequence having weaker activity, or replacing the sequence with a modified amino acid sequence or polynucleotide sequence having no activity. For example, gene expression can be inhibited or reduced by introducing a mutation into a polynucleotide sequence to form a stop codon, but is not limited thereto.

[0138] 5) The method of modifying the nucleotide sequence encoding the start codon or 5'-UTR of the gene transcript encoding the polypeptide can be achieved by, for example, replacing the nucleotide sequence with a nucleotide sequence encoding another start codon having a lower polypeptide expression rate than the endogenous start codon, but is not limited thereto.

[0139] 6) The method of introducing an antisense oligonucleotide (e.g., antisense RNA) that binds complementarily to a gene transcript encoding a polypeptide can be achieved by referring to the literature [Weintraub, H. et al., Antisense-RNA as a molecular tool for genetic analysis, Reviews-Trends in Genetics, Vol. 1 (1) 1986].

[0140] 7) A method of adding a sequence complementary to the Shine-Dalgarno (SD) sequence of a polypeptide-encoding gene upstream of the SD sequence to form a secondary structure that prevents ribosome attachment can be achieved by inhibiting mRNA translation or reducing its rate.

[0141] In addition, 8) using reverse transcription engineering (RTE), a method of adding a promoter to be reverse transcribed to the 3' end of the open reading frame (ORF) of the gene sequence encoding the polypeptide can be achieved by generating antisense nucleotides complementary to the gene transcript encoding the polypeptide to weaken the activity.

[0142] 9) Methods for regulating the cellular localization of proteins (polypeptides) can be achieved by targeting the protein (polypeptide) to a specific organelle or specific space within the cell. For example, this can be achieved by adding or removing a leader sequence that plays a role in the targeting polypeptide, thereby targeting the polypeptide to the periplasm or cytoplasm, but is not limited thereto.

[0143] Another aspect of the present disclosure provides a method for producing OPS, comprising culturing the microorganism of the present disclosure in a culture medium.

[0144] As used herein, the terms "OPS" and "microorganism" are as described above.

[0145] As used herein, the term "cultivation" refers to growing the microorganisms of the present disclosure under appropriately controlled environmental conditions. The cultivation process of the present disclosure can be carried out in a suitable culture medium and under suitable culture conditions known in the art. Such a cultivation process can be easily adapted and used by one of ordinary skill in the art depending on the selected strain. Specifically, the cultivation can be batch culture, continuous culture, and fed-batch culture, but is not limited thereto.

[0146] As used herein, the term "culture medium" refers to a mixed substance containing nutrients required for culturing the microorganisms of the present invention as main components, and the culture medium provides nutrients, growth factors, etc., including water that is indispensable for survival and growth. Specifically, any culture medium and culture conditions can be used to culture the microorganisms of the present invention without particular limitation, as long as the culture medium is used for general culture of microorganisms. The microorganisms of the present invention can be cultured in a general culture medium containing a suitable carbon source, nitrogen source, phosphorus source, inorganic compound, amino acid and / or vitamin, etc. under aerobic conditions, while controlling temperature, pH, etc.

[0147] In the present disclosure, carbon sources include carbohydrates such as glucose, sucrose, lactose, fructose, sucrose and maltose; sugar alcohols such as mannitol and sorbitol; organic acids such as pyruvic acid, lactic acid and citric acid; or amino acids such as glutamic acid, methionine and lysine. In addition, natural organic nutrients such as starch hydrolysate, molasses, blackstrap molasses, rice bran, cassava, sugarcane residue and corn steep liquor can be used. Specifically, carbohydrates such as glucose and aseptically pretreated molasses (i.e., molasses converted to reducing sugars) can be used, and appropriate amounts of other carbon sources can be used in various ways without limitation. These carbon sources can be used alone or in combination of two or more, but are not limited thereto.

[0148] As the nitrogen source, inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate and ammonium nitrate, or organic nitrogen sources such as amino acids such as glutamic acid, methionine and glutamine, peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolyzate, fish or its decomposition products, and defatted soybean cake or its decomposition products can be used. These nitrogen sources can be used alone or in combination of two or more, but are not limited thereto.

[0149] The phosphorus source may include potassium dihydrogen phosphate, dipotassium hydrogen phosphate, or their corresponding sodium salts. As inorganic compounds, sodium chloride, calcium chloride, ferric chloride, magnesium sulfate, ferric sulfate, manganese sulfate, calcium carbonate, etc. may be used. In addition, amino acids, vitamins, and / or suitable precursors may be included. These components or precursors may be added to the culture medium in a batch or continuous manner. However, the culture medium is not limited thereto.

[0150] The culture medium may contain metal salts, such as magnesium sulfate or iron sulfate, as well as amino acids, vitamins and suitable precursors. The culture medium or precursors may be added to the culture in a batch or continuous manner, but are not limited thereto.

[0151] In one example, when culturing a recombinant microorganism in which SerB activity is attenuated compared to endogenous activity, the serine requirement of the microorganism is induced, and therefore, glycine or serine may also be included in the culture medium. Glycine may be provided in the form of purified glycine, a yeast extract containing glycine, and tryptone, and the concentration of glycine contained in the culture medium may generally be 0.1 g / L to 10 g / L, specifically 0.5 g / L to 3 g / L. Serine may be provided in the form of purified serine, a yeast extract containing serine, and tryptone, and the concentration of serine contained in the culture medium may generally be 0.1 g / L to 5 g / L, specifically 0.1 g / L to 1 g / L.

[0152] In the process of cultivating the microorganism of the present disclosure, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid and sulfuric acid can be added to the culture medium in an appropriate manner to regulate the pH of the culture medium. During the culture, defoamers such as fatty acid polyethylene glycol esters can be used to suppress foaming. Oxygen or oxygen-containing gas can be injected into the culture medium to maintain the aerobic state of the culture medium, or gas can not be injected, or nitrogen, hydrogen or carbon dioxide gas can be injected to maintain anaerobic and microaerobic state, but culture conditions are not limited thereto.

[0153] In the culture of the present disclosure, the culture temperature may be maintained at 20° C. to 45° C., specifically 25° C. to 40° C., and the culture may be performed for about 10 to 160 hours, but the culture conditions are not limited thereto.

[0154] The OPS produced by the culture of the present disclosure may be secreted into the culture medium or retained in the cells.

[0155] The method of producing OPS of the present disclosure may further include, for example, preparing the microorganism of the present disclosure, preparing a culture medium for culturing the microorganism, or a combination thereof (in any order) before culturing.

[0156] The method for producing OPS disclosed herein may further include recovering OPS from the culture medium (cultured culture medium) or microorganisms after culture. The recovery step may also include after culture.

[0157] Recovery can be performed by collecting the desired OPS using suitable methods known in the art, depending on the method used to culture the microorganisms of the present disclosure, such as batch, continuous, or fed-batch culture. For example, recovery can include centrifugation, filtration, treatment with a crystalline protein precipitant (salting out), extraction, sonication, ultrafiltration, dialysis, various types of chromatography (such as molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, and affinity chromatography), HPLC, or a combination thereof. The desired OPS can be recovered from the culture medium or microorganism using suitable methods known in the art.

[0158] The method for producing OPS disclosed herein may further include purification. Purification may be performed using suitable methods known in the art. In one embodiment, when the method for producing OPS disclosed herein includes recovery and purification, these steps may be performed in any order, continuously, discontinuously, simultaneously, or as an integrated step, but are not limited thereto.

[0159] Another aspect of the present disclosure provides a method for producing cysteine ​​or a cysteine ​​derivative, comprising: (a) culturing the microorganism of the present disclosure in a culture medium to produce OPS or a culture medium containing OPS; and (b) reacting the OPS or the culture medium containing OPS produced in step (a) with sulfide in the presence of O-phosphoserine sulfhydrylase (OPSS) or a microorganism containing the same.

[0160] As used herein, the terms "OPS" and "microorganism" are as described above.

[0161] As used herein, the term "derivative" refers to a similar compound obtained by chemically modifying a portion of a specific compound. The term generally refers to a compound in which a hydrogen atom or a specific functional group is replaced by another atom or functional group.

[0162] As used herein, the term "cysteine ​​derivative" refers to a compound in which a hydrogen atom or a specific functional group in cysteine ​​is replaced by another atom or functional group. For example, the cysteine ​​derivative may be in a form in which another atom or functional group is attached to the nitrogen atom of the amine group (-NH2) or the sulfur atom of the thiol group (-SH) of cysteine. Examples of cysteine ​​derivatives include N-acetylcysteine ​​(NAC), S-carboxymethylcysteine ​​(SCMC), BOC-CYS(ME)-OH, (R)-S-(2-amino-2-carboxyethyl)-L-homocysteine, (R)-2-amino-3-sulfopropionic acid, D-2-amino-4-(ethylthio)butanoic acid, 3-sulfinyl-L-alanine, Fmoc-Cys(BOC-methyl)-OH, seleno-L-cystine, S-(2-thiazolyl)-L-cysteine, S-(2-thienyl)-L-cysteine, and S-(4-tolyl)-L-cysteine, but are not limited thereto.

[0163] As long as cysteine ​​is produced according to the method disclosed herein, it can be easily converted into various cysteine ​​derivatives by methods well known in the art.

[0164] In the present disclosure, the method for producing a cysteine ​​derivative may further include converting the cysteine ​​produced in step b) into a cysteine ​​derivative.

[0165] Specifically, in the present disclosure, the method for producing a cysteine ​​derivative may include the steps of producing cysteine ​​according to the above-mentioned method of the present disclosure and converting the produced cysteine ​​into a cysteine ​​derivative.

[0166] The conversion of the produced cysteine ​​into cysteine ​​derivatives can be carried out by methods well known in the art. For example, according to methods well known in the art, N-acetylcysteine ​​(NAC) can be synthesized by reacting cysteine ​​with an acetylating agent, and S-carboxymethylcysteine ​​(SCMC) can be synthesized by reacting cysteine ​​with a haloacetic acid under alkaline conditions, but examples are not limited thereto.

[0167] These cysteine ​​derivatives are mainly used as pharmaceutical materials for antitussives, cough suppressants, and therapeutic agents for bronchitis, bronchial asthma, pharyngitis, and the like, but are not limited thereto.

[0168] As used herein, the term "O-phosphoserine sulfhydrylase (OPSS)" refers to an enzyme that catalyzes the conversion of OPS to cysteine ​​by donating a thiol group (SH group) to OPS. The enzyme was probably first discovered in Aeropyrumpernix, Mycobacterium tuberculosis, Mycobacterium smegmatics, and Trichomonas vaginalis (Mino K and Ishikawa K, FEBS Letters, 551: 133-138, 2003; Burns KE et al., J. Am. Chem. Soc., 127: 11602-11603, 2005). In addition, OPSS may include not only wild-type OPSS protein, but also variant proteins having deletions, substitutions or additions in a portion of the polynucleotide sequence encoding OPSS, which exhibit equivalent or enhanced biological activity compared to the wild-type OPSS protein, and may also include all OPSS and variant proteins thereof disclosed in U.S. Patent Publication No. US 8557549 B2 and U.S. Patent Publication No. US 9127324 B2.

[0169] Sulfide can be used without limitation, as long as it can be provided in a solid form commonly used in the art, or in a liquid or gaseous form due to differences in pH, pressure, and solubility, and can be provided in the form of sulfide ions (S 2- ), thiosulfate (S2O3 2-) or other sulfur-containing compounds into a thiol group (-SH). Specifically, the sulfide used can be Na2S, NaSH, (NH4)2S, H2S, and Na2S2O3, which provide a thiol group to OPS, but are not limited thereto. The reaction involves providing one thiol group to one OPS molecule to produce one cysteine ​​or cysteine ​​derivative molecule. Herein, the sulfide can be added in an amount of 0.1 to 3 molar equivalents, specifically 1 to 2 molar equivalents, based on the molar concentration of OPS, but the amount of the sulfide used is not limited thereto.

[0170] In addition, the method of the present disclosure may further include recovering cysteine ​​produced by the reaction. Herein, the desired cysteine ​​may be collected by separating and purifying cysteine ​​from the reaction solution using a suitable reaction known in the art.

[0171] Another aspect of the present disclosure provides a composition for producing OPS, cysteine, or a cysteine ​​derivative, comprising: the recombinant microorganism producing OPS disclosed herein; a culture medium for culturing the recombinant microorganism; or a combination thereof.

[0172] The compositions of the present disclosure may also include any suitable excipients commonly used in compositions for producing OPS, cysteine ​​or cysteine ​​derivatives, and such excipients may include, for example, preservatives, wetting agents, dispersing agents, suspending agents, buffers, stabilizers or isotonic agents, but the excipients are not limited thereto.

[0173] Another aspect of the present disclosure provides use of the OPS-producing recombinant microorganism of the present disclosure in producing OPS, cysteine, or a cysteine ​​derivative.

[0174] [Mode for Carrying Out the Invention]

[0175] The present disclosure will be described in detail by way of examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not intended to be limited to these examples. Meanwhile, the technical descriptions missing in the present disclosure can be fully understood and easily practiced by those of ordinary skill in the present disclosure or related fields.

[0176] Example 1: Preparation of an O-phosphoserine (OPS) producing strain with enhanced MntH expression

[0177] According to previous studies, the average transcription levels of the mntH, serC, and rmf genes in the OPS-producing host strain CA07-0012 (KCCM 11121P, U.S. Patent No. 8557549B2) were determined to be 698, 6,215, and 32,205, respectively, as shown in Table 1 below. The host strain is derived from wild-type E. coli K-12W3110 and lacks endogenous SerB, thereby reducing the ability to degrade OPS. Relative to the average transcription level of mntH, the average transcription level of serC was determined to be 8.9 times, and the average transcription level of rmf was determined to be 46 times. Therefore, the promoters of the serC and rmf genes were determined to be relatively stronger than the promoter of the mntH gene.

[0178] [Table 1]

[0179] Gene name Early Index Medium-term index Late Index Stablize average mntH 670 740 792 589 698 serC 5385 5485 5338 8652 6215 rmf 30725 28192 28109 41792 32205

[0180] Therefore, a strain having enhanced MntH expression was prepared by additionally inserting serC promoter (SEQ ID NO: 21) and rmf promoter (SEQ ID NO: 22) identified as having stronger activity than mntH promoter (SEQ ID NO: 2) downstream of the mntH promoter in the OPS-producing microorganism.

[0181] Specifically, PCR was performed using chromosomal DNA of wild-type Escherichia coli ATCC 27325 as a template using primers SEQ ID NOS: 23 and 24, SEQ ID NOS: 25 and 26, SEQ ID NOS: 27 and 28, and SEQ ID NOS: 29 and 30, respectively. As a result, gene fragments of the upstream and downstream regions of the wild-type mntH promoter and the promoter regions of the serC and rmf genes were obtained.

[0182] Using Solg TM PCR was performed using Pfu-X DNA polymerase under the following conditions: denaturation at 95°C for 2 minutes, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and polymerization at 72°C for 60 seconds, followed by polymerization at 72°C for 5 minutes.

[0183] Using an In-Fusion Cloning Kit, the upstream and downstream fragments of the mntH promoter and the serC or rmf promoter fragments obtained by the above method were cloned into the chromosomal transformation vector pSKH130 (U.S. Patent Application Publication No. 2020-0048619) digested with EcoRV restriction enzyme to obtain recombinant plasmids. The resulting recombinant plasmids were named pSKH130_PserC-mntH and pSKH130_Prmf-mntH, respectively.

[0184] The OPS production strain CA07-0012 was transformed using electroporation with previously constructed pSKH130_PserC-mntH and pSKH130_Prmf-mntH. After a second crossover process, downstream strains were obtained in which the promoter nucleotide sequence of the serC or rmf gene was inserted into the wild-type mntH gene promoter nucleotide sequence. PCR was performed on SEQ ID NOS: 31 and 32 using primers that can amplify the external regions of the upstream and downstream homologous recombination sites, and nucleotide sequence analysis was performed to confirm that the serC or rmf promoter nucleotide sequence was inserted into each strain. The resulting strains were named CA07-0014 (CA07-0012ΔPn_mntH::PserC_mntH) and CA07-0015 (CA07-0012ΔPn_mntH::Prmf_mntH), respectively.

[0185] The primer sequences used are shown in Table 2 below.

[0186] [Table 2]

[0187] SEQ ID NO:23 CTGCAGGAATTCgatAAGGATTCCAGTTTGCCCAT SEQ ID NO:24 GCAATAGAAGCGGCTTCCTGCTTGTGCCTCTAAAAC SEQ ID NO:25 TGAGGGAAACGAGGCATGACGAACTATCGC SEQ ID NO:26 GTCGACTACGGTgatGACAAAACCGGCAATAGTCA SEQ ID NO:27 TTTTAGAGGCACAAGCAGGAAGCCGCTTCTATTGC SEQ ID NO:28 GCGATAGTTCGTCATGCCTCGTTTCCCTCATACTG SEQ ID NO:29 ACGTGGTGAGGGGAAATGACGAACTATCGCGTTGA SEQ ID NO:30 GTCGACTAGCGTGATATTGACAAAACCGGCAATAG SEQ ID NO:31 TCATACATTTCTGCTATGTT SEQ ID NO:32 AGAGGATCTGAATCAGCATC

[0188] Example 2: Preparation of an OPS-producing strain with an introduced YhhS mutation

[0189] Example 2-1: Selection of YhhS variants

[0190] In order to select YhhS variants with increased OPS export activity, a yhhS gene variant plasmid library was constructed. The specific process is as follows.

[0191] Random mutagenesis PCR was performed using genomic DNA of Escherichia coli (E. coli) K12 W3110 as a template and a primer pair having the nucleotide sequences of SEQ ID NOS: 33 and 34 shown in Table 3 below. PCR was performed using a Diversity PCR Random Mutagenesis Kit (Takara) under the following conditions: denaturation at 94°C for 5 minutes, followed by 20 cycles of denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 1 minute, followed by polymerization at 72°C for 5 minutes.

[0192] In order to insert the mutant gene fragment constructed by this method into the pCL1920 vector having the rhtB promoter, the pCL_PrhtB vector was first constructed.

[0193] To obtain the rhtB promoter fragment, PCR was performed using genomic DNA from Escherichia coli K-12W3110 as a template and primers for SEQ ID NOS: 35 and 36. PCR was performed under the following conditions: denaturation at 94°C for 5 minutes, followed by 30 cycles of denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 1 minute, followed by polymerization at 72°C for 5 minutes. The rhtB promoter fragment was cloned into the pCL1920 vector (GeneBank No. AB236930) that had been digested with EcoRI and SalI using an In-Fusion Cloning kit to obtain pCL_PrhtB. After digesting the resulting pCL_PrhtB vector with ScaI, the mutant gene fragment obtained by PCR was cloned using an In-Fusion Cloning kit. Cloning was performed by reacting at 50°C for 60 minutes, thus constructing the pCL_PrhtB-yhhS gene mutant plasmid library. Thereafter, the obtained plasmid was transformed into the OPS-producing strain CA07-0012 by electroporation.

[0194] Among these strains, two strains containing variants were selected. Plasmids were obtained from these strains, and the nucleotide sequences were analyzed by sequencing. Based on the nucleotide sequence analysis results, the selected variants were determined to be a variant in which the serine residue at amino acid position 129 in the wild-type YhhS amino acid sequence was substituted with glycine, and a variant in which the isoleucine residue at amino acid position 241 was substituted with glutamine.

[0195] The primer sequences used are shown in Table 3 below.

[0196] [Table 3]

[0197]

[0198]

[0199] Example 2-2: Preparation of vectors and strains for introducing YhhS (S129A / G) mutations

[0200] In order to confirm the OPS-producing ability of a strain in which the serine at position 129 of YhhS was substituted with glycine (as obtained in Example 2-1) or with another amino acid, strains were prepared and evaluated.

[0201] In order to insert the amino acid 129 mutation of YhhS into the chromosome of the strain, the trc promoter was used, and the mgsA locus was used as the insertion site.

[0202] Specifically, the pSKH130ΔmgsA plasmid was generated to introduce an alanine or glycine substitution at amino acid residue 129 of YhhS into the mgsA locus. To obtain the pSKH130ΔmgsA plasmid, PCR was performed using primers corresponding to SEQ ID NOS:37 and 38, and SEQ ID NOS:39 and 40, respectively, to obtain gene fragments from the upstream and downstream regions of the mgsA gene. The pSKH130 vector was digested with BamHI, and the plasmid was obtained using an In-Fusion Cloning Kit.

[0203] To obtain the trc promoter fragment, PCR was performed using SEQ ID NOS:41 and 42. To obtain two variant YhhS ORFs, upstream and downstream fragments of each variant were obtained using primer pairs SEQ ID NOS:43 and 44, SEQ ID NOS:45 and 46, SEQ ID NOS:43 and 47, and SEQ ID NOS:48 and 46, respectively. The two upstream and downstream fragments obtained, the trc promoter fragment, the pSKH130ΔmgsA vector digested with ScaI, and an In-Fusion Cloning kit were used to construct two plasmids: pSKH130ΔmgsA::Ptrc_yhhS(S129A) and pSKH130ΔmgsA::Ptrc_yhhS(S129G). Furthermore, to obtain a control strain in which wild-type yhhS was introduced into the mgsA locus, the pSKH130ΔmgsA::Ptrc_yhhS plasmid was constructed. To obtain YhhS ORF, PCR was performed using primers of SEQ ID NOS: 43 and 46. A plasmid was constructed using the obtained YhhS ORF, the trc promoter fragment, the pSKH130ΔmgsA vector digested with ScaI, and an In-Fusion Cloning Kit.

[0204] The primer sequences used are shown in Table 4 below.

[0205] [Table 4]

[0206] SEQ ID NO:37 CCTGCCATCGGATCCGGTATCCGTTTTTGCCACCA SEQ ID NO:38 ACCTGTGCAATAAGTACTAATGTACATCCGTAGTT SEQ ID NO:39 CGGATGTACATTAGTACTTATTGCACAGGTGGCAA SEQ ID NO:40 TGATATCGAATTCCTTCGCTGTTGGTGATGACTGG SEQ ID NO:41 CGGATGTACATAGTCGCTTGCTGCAACTCTCTCA SEQ ID NO:42 GATAGCTCTCCTGTGTGAAATTGTTATCCGCTCAC SEQ ID NO:43 CACAGGAAAGATATCATGCCCGAACCCGTAGCCGA SEQ ID NO:44 TCCCGTTCCGGCAAAcgcTTGCCCAATCCCAAGGA SEQ ID NO:45 CTTGGGATTGGGCAAgcgTTTGCCGGAACGGGATC SEQ ID NO:46 ACCTGTGCAATAAGTTTAAGATGATGAGGCGGCCT SEQ ID NO:47 ATTGGGCAAgGTTTTGCCGG SEQ ID NO:48 CCGGCAAAACcTTGCCCAAT

[0207] The obtained plasmid was transformed into CA07-0014 (CA07-0012ΔPn_mntH::PserC_mntH) using electroporation. After the second exchange process, two strains in which the YhhS variant was inserted into the mgsA locus were obtained. Then, by PCR and nucleotide sequence analysis using primer pairs SEQ ID NOS: 37 and 46, strains CA07-0014ΔmgsA::Ptrc_yhhS (S129A) and CA07-0014ΔmgsA::Ptrc_yhhS (S129G) were obtained. The strain CA07-0014ΔmgsA::Ptrc_yhhS into which the control was introduced was also obtained by the same method.

[0208] Strain CA07-0014ΔmgsA::Ptrc_yhhS(S129A) was named CA07-0017, strain CA07-0014ΔmgsA::Ptrc_yhhS(S129G) was named CA07-0018, and strain CA07-0014ΔmgsA::Ptrc_yhhS was named CA07-0016.

[0209] Example 2-3: Preparation of vectors and strains for introducing the YhhS (I241T / Q) mutation

[0210] In order to confirm the OPS-producing ability of a strain in which isoleucine at position 241 of YhhS was substituted with glutamine (as obtained in Example 2-1) or with another amino acid, strains were prepared and evaluated.

[0211] In order to insert the amino acid mutation at position 241 of YhhS into the chromosome of the strain, as described in Example 2-2, the trc promoter was used, and the mgsA locus was used as the insertion site.

[0212] Specifically, a variant in which amino acid residue 241 of YhhS was replaced with threonine or glutamine was introduced into the mgsA locus. To obtain two types of variant YhhS ORFs, primer pairs of SEQ ID NOS: 43 and 49, SEQ ID NOS: 50 and 46, SEQ ID NOS: 43 and 51, and SEQ ID NOS: 52 and 46 were used, respectively, to obtain upstream and downstream fragments of each variant. The obtained upstream and downstream fragments, the trc promoter fragment, the pSKH130ΔmgsA vector digested with ScaI, and an In-Fusion Cloning kit were used to construct two types of plasmids, pSKH130ΔmgsA::Ptrc_yhhS(I241T) and pSKH130ΔmgsA::Ptrc_yhhS(I241Q).

[0213] The resulting plasmid was transformed into CA07-0014 (CA07-0012ΔPn_mntH::PserC_mntH) using electroporation. After the second crossover, two strains were obtained in which the YhhS variant was inserted into the mgsA locus. Then, by PCR using primers SEQ ID NOS: 37 and 46 and nucleotide sequence analysis, strains CA07-0014ΔmgsA::Ptrc_yhhS(I241T) and CA07-0014ΔmgsA::Ptrc_yhhS(I241Q) were obtained.

[0214] The CA07-0014ΔmgsA::Ptrc_yhhS(I241T) strain was named CA07-0019, and the CA07-0014ΔmgsA::Ptrc_yhhS(I241Q) strain was named CA07-0020.

[0215] The primer sequences used are shown in Table 5 below.

[0216] [Table 5]

[0217]

[0218]

[0219] Example 2-4: Preparation of vectors and strains for introducing YhhS (S129G / I241T / D246V / V330I) mutations

[0220] To confirm the OPS-producing ability of strains into which yhhS (S129G / I241T / D246V / V330I) mutations were inserted to confirm the effects of various combinations of mutations in YhhS, strains were prepared and evaluated.

[0221] In order to insert the S129G, I241T, D246V, and V330I amino acid mutations of YhhS into the chromosome of the strain, the trc promoter was used as described in Example 2-2, and the mgsA locus was used as the insertion site.

[0222] Specifically, to prepare the pSKH130ΔmgsA::Ptrc-yhhS(S129G / I241T / D246V / V330I) vector, the pSKH130ΔmgsA::Ptrc_yhhS(S129G) vector obtained in Example 2-2 was used as a template and primer pairs of SEQ ID NOS:43 and 53 and SEQ ID NOS:54 and 46 were used, respectively, to obtain upstream and downstream fragments of each variant. The two types of upstream and downstream fragments obtained, the trc promoter fragment, the pSKH130ΔmgsA vector digested with ScaI, and an In-Fusion Cloning kit were used to construct the pSKH130ΔmgsA::Ptrc_yhhS(S129G / I241T / D246V) plasmid. The obtained plasmid was used as a template and the primer pairs of SEQ ID NOS: 43 and 55 and SEQ ID NOS: 56 and 46 were used to obtain the upstream and downstream fragments of each variant. The pSKH130ΔmgsA::Ptrc_yhhS (S129G / I241T / D246V / V330I) plasmid was constructed using the obtained two types of upstream and downstream fragments, the trc promoter fragment, the pSKH130ΔmgsA vector digested with ScaI, and the In-Fusion Cloning kit.

[0223] The resulting plasmid was transformed into CA07-0014 (CA07-0012ΔPn_mntH::PserC_mntH) using electroporation. After the second crossover, a strain in which the YhhS variant was inserted into the mgsA locus was obtained. Then, PCR using primers SEQ ID NOS: 37 and 46 and nucleotide sequence analysis yielded the CA07-0014ΔmgsA::Ptrc_yhhS (S129G / I241T / D246V / V330I) strain.

[0224] Strain CA07-0014ΔmgsA::Ptrc_yhhS (S129G / I241T / D246V / V330I) was named CA07-0021.

[0225] The primer sequences used are shown in Table 6 below.

[0226] [Table 6]

[0227]

[0228] Example 3: Evaluation of OPS production capacity of an OPS production strain in which MntH expression is enhanced and a YhhS mutation is introduced force

[0229] In order to measure the OPS-producing ability of the strain having enhanced MntH expression and containing the YhhS variant, the OPS-producing ability of the OPS-producing strain constructed in Example 2 was measured.

[0230] In order to measure the OPS production ability, shake flask fermentation titer evaluation of the strain prepared in the above example was performed as follows.

[0231] Each strain was plated on solid LB medium and cultured overnight in a 33°C incubator. The strain cultured overnight in solid LB medium was inoculated into 25 mL of the following titer medium and then cultured in an incubator at 33°C at 200 rpm for 48 hours. After completion of the culture, OPS concentrations were measured using HPLC, as shown in Table 7 below.

[0232] <Titer Culture Medium>

[0233] 40g / L glucose, 6g / L KH2PO4, 17g / L (NH4)2SO4, 1g / L MgSO4·7H2O, 5mg / L MnSO4·4H2O, 10mg / L FeSO4·7H2O, 1.5g / L L-glycine, 2.5g / L yeast extract, 30g / L CaCO3, pH 6.8

[0234] [Table 7]

[0235]

[0236] As shown in Table 7, the MntH-enhanced CA07-0014 and CA07-0015 strains derived from the parent strain CA07-0012 exhibited 18% and 10% increases in OPS productivity, respectively, compared to the parent strain. The wild-type YhhS-enhanced strain based on the MntH-enhanced CA07-0014 strain exhibited a 17% increase in OPS productivity compared to the parent strain. In addition, for the CA07-0017 strain containing the yhhS (S129A) variant; the CA07-0018 strain containing the yhhS (S129G) variant; the CA07-0019 strain containing the yhhS (I241T) variant; the CA07-0020 strain containing the yhhS (I241Q) variant; and the CA07-0021 strain containing the yhhS (S129G / I241T / D246V / V330I) variant, the OPS production capacity increased by 24%, 48%, 45%, 29% and 54% respectively compared with the parent strain.

[0237] Therefore, it was determined that when MntH expression was enhanced and the strain contained the YhhS variant, the OPS productivity increased.

[0238] Example 4: Preparation of O-phosphoserine (OPS) producing strains with enhanced Ahp expression

[0239] According to previous studies, the average transcript levels of the ahpC, rhtB, serC, and rmf genes in the OPS-producing host strain were determined to be 11,123, 1,391, 24,861, and 32,205, respectively, as shown in Table 6. Relative to the average transcript level of ahpC, the average transcript level of rmf was determined to be 2.9 times, and the average transcript level of serC was determined to be 2.2 times. In contrast, the average transcript level of the rhtB gene was determined to be 0.1 times the average transcript level of the ahpC gene. Therefore, the promoters of the serC and rmf genes were determined to be relatively stronger than the promoter of the Ahp operon (ahpCF operon), and the rhtB gene promoter was confirmed to be a relatively weak promoter.

[0240] [Table 8]

[0241] Gene name Early Index Medium-term index Late Index Stablize average ahpC 11925 10860 11580 10128 11123 rhtB 1711 1842 1212 799 1391 serC 21542 21941 21352 34609 24861 rmf 30725 28192 28109 41792 32205

[0242] Therefore, a strain with enhanced ahp gene expression was prepared by additionally inserting rmf promoter and serC promoter downstream of the ahpCF operon promoter in an OPS-producing microorganism. The rmf promoter and serC promoter were identified as having stronger activity than the ahpCF operon promoter.

[0243] Specifically, PCR was performed using chromosomal DNA of wild-type Escherichia coli ATCC 27325 as a template with primers SEQ ID NOS: 57 and 58, SEQ ID NOS: 59 and 60, SEQ ID NOS: 61 and 62, and SEQ ID NOS: 63 and 64, respectively. As a result, gene fragments of the upstream and downstream regions of the wild-type ahpC gene promoter and the promoter regions of the serC and rmf genes were obtained.

[0244] Using an In-Fusion Cloning Kit, the upstream and downstream fragments of the ahpC promoter and the serC or rmf promoter fragments obtained through the above process were cloned into the chromosomal transformation vector pSKH130 digested with EcoRV restriction enzyme to obtain recombinant plasmids. The resulting recombinant plasmids were named pSKH130_Prmf-ahp and pSKH130_PserC-ahp, respectively.

[0245] The OPS production strain CA07-0012 was transformed using electroporation with the previously constructed pSKH130_Prmf-ahp and pSKH130_PserC-ahp. After the second exchange process, strains were obtained in which the promoter nucleotide sequence of the serC or rmf gene was inserted downstream of the wild-type ahp gene promoter nucleotide sequence. SEQ ID NOS: 65 and 66 were subjected to PCR using primers that can amplify the outer regions of the upstream and downstream homologous recombination sites, and nucleotide sequence analysis was performed to confirm the insertion of the serC or rmf promoter nucleotide sequence in each strain. The obtained strains were respectively designated CA07-0022 (CA07-0012ΔPn_ahpC-ahpF::Prmf_ahpC-ahpF) and CA07-0023 (CA07-0012ΔPn_ahpC-ahpF::PserC-ahpC-ahpF).

[0246] The primer sequences used are shown in Table 9 below.

[0247] [Table 9]

[0248]

[0249]

[0250] Furthermore, the OPS-producing strain prepared in Example 2 above in which MntH expression was enhanced and a YhhS mutation was introduced was further modified to enhance Ahp expression.

[0251] Specifically, the strains CA07-0017 (CA07-0012ΔPn_mntH::PserC_mntHΔmgsA::Ptrc_yhhS(S129A)), CA07-0018 (CA07-0012ΔPn_mntH::PserC_mntHΔmgsA::Ptrc_yhhS(S129G)), CA07-0019 (CA07-0019) prepared in Example 2 were transformed with pSKH130_PserC-ahp, respectively, as described above. 2ΔPn_mntH::PserC_mntHΔmgsA::Ptrc_yhhS(I241T)), CA07-0020(CA07-0012ΔPn_mntH::PserC_mntHΔmgsA::Ptrc_yhhS(I241Q)), and CA07-0021(CA07-0012ΔPn_mntH::PserC_mntHΔmgsA::Ptrc_yhhS(S129G / I241T / D246V / V330I)). After the second exchange process, strains in which the serC gene promoter nucleotide sequence was inserted downstream of the wild-type ahp gene promoter nucleotide sequence were obtained. In addition, PCR was performed using primers for SEQ ID NOS:63 and 64, and nucleotide sequence analysis was performed to confirm that the serC promoter nucleotide sequence was inserted into each strain.The obtained strains were named CA07-0023 (CA07-0012ΔPn_mntH::PserC_mntHΔmgsA::Ptrc_yhhS(S129A)ΔPn_ahpC-ahpF::PserC-ahpC-ahpF), CA07-0024 (CA07-0012ΔPn_mntH::PserC_mntHΔmgsA::Ptrc_yhhS(S129G)ΔPn_ahpC-ahpF::PserC-ahpC-ahpF), and CA07-0025 (CA07-0012ΔPn_mntH::PserC_mntHΔmgsA::Ptrc_yhhS(S129A)ΔPn_ahpC-ahpF::PserC-ahpC-ahpF). yhhS(I241T)ΔPn_ahpC-ahpF::PserC-ahpC-ahpF), CA07-0026(CA07-0012ΔPn_mntH::PserC_mntHΔmgsA::Ptrc_yhhS(I241Q)ΔPn_ahpC-ahpF::Pser C-ahpC-ahpF) and CA07-0027 (CA07-0012ΔPn_mntH::PserC_mntHΔmgsA::Ptrc_yhhS(S129G / I241T / D246V / V330I)ΔPn_ahpC-ahpF::PserC-ahpC-ahpF).

[0252] Example 5: Evaluation of OPS production capacity of an OPS-producing strain in which MntH and Ahp expression is enhanced and a YhhS mutation is introduced

[0253] In order to measure the OPS-producing ability of the strain having enhanced expression of MntH and Ahp and containing the YhhS variant, the OPS-producing ability of the OPS-producing strain constructed in Example 4 was measured.

[0254] In order to measure the OPS production ability, shake flask fermentation titer evaluation of the strain prepared in the above example was performed as follows.

[0255] Each strain was plated on solid LB medium and cultured overnight in a 33°C incubator. The strain cultured overnight in solid LB medium was inoculated into 25 mL of the following titer medium and then cultured in an incubator at 33°C at 200 rpm for 48 hours. After completion of the culture, OPS concentrations were measured using HPLC, as shown in Table 10 below.

[0256] <Titer Culture Medium>

[0257] 40g / L glucose, 6g / L KH2PO4, 17g / L (NH4)2SO4, 1g / L MgSO4·7H2O, 5mg / L MnSO4·4H2O, 10mg / L FeSO4·7H2O, 1.5g / L L-glycine, 2.5g / L yeast extract, 30g / L CaCO3, pH 6.8

[0258] [Table 10]

[0259]

[0260]

[0261] As shown in Table 10, the Ahp-enhanced strains CA07-0022 and CA07-0023 derived from the parent strain CA07-0012 showed increases in OPS production capacity of 12% and 16%, respectively, compared to the parent strain. In addition, the Ahp-enhanced strains CA07-0024, CA07-0025, CA07-0026, CA07-0027, and CA07-0028, which were based on strains enhanced with MntH and introduced with the YhhS variant, showed increases in OPS production capacity of 12%, 18%, 20%, 33%, and 20%, respectively, compared to the parent strain.

[0262] Therefore, it was determined that when the expression of MntH and Ahp was enhanced and the strain contained the YhhS variant, the OPS production ability was increased.

[0263] Based on the foregoing, it will be understood by those skilled in the art that the present disclosure may be implemented in other specific forms without modifying the technical concepts or essential features of the present disclosure. In this regard, the embodiments disclosed herein are for illustrative purposes only and should not be construed as limiting the scope of the present disclosure. The scope of this application should be interpreted as including not only the meaning and scope of the following claims, but also all modifications and variations derived from equivalent concepts.

Claims

1. A recombinant microorganism for producing O-phosphoserine, wherein: (a) The activity of MntH protein is enhanced compared with endogenous activity; and (b) The microorganism comprises a YhhS variant, wherein the amino acid at position 129 and / or 241 in the amino acid sequence corresponding to SEQ ID NO: 3 is substituted with another amino acid. 2 . The recombinant microorganism according to claim 1 , wherein the recombinant microorganism has an increased O-phosphoserine production capacity compared to endogenous O-phosphoserine production capacity.

3. The recombinant microorganism according to claim 1, wherein the MntH protein comprises the amino acid sequence of SEQ ID NO:

1. The recombinant microorganism according to claim 1 , wherein the polynucleotide encoding the MntH protein comprises the nucleotide sequence of SEQ ID NO:

2. 5 . The recombinant microorganism according to claim 1 , wherein the amino acid at position 129 in the amino acid sequence corresponding to SEQ ID NO: 3 in the YhhS variant is substituted with glycine or alanine. The recombinant microorganism according to claim 1 , wherein the amino acid at position 241 in the amino acid sequence corresponding to SEQ ID NO: 3 in the YhhS variant is substituted with threonine or glutamine.

7. The recombinant microorganism according to claim 1, wherein the amino acid at position 246 and / or 330 in the amino acid sequence corresponding to SEQ ID NO: 3 in the YhhS variant is further substituted with another amino acid.

8. The recombinant microorganism according to claim 7, wherein the amino acid corresponding to position 246 is substituted with valine.

9. The recombinant microorganism according to claim 7, wherein the amino acid corresponding to position 330 is substituted with isoleucine. 10 . The recombinant microorganism according to claim 1 , wherein the YhhS variant consists of an amino acid sequence selected from the group consisting of the amino acid sequences of SEQ ID NOS: 5 to 9.

11. The recombinant microorganism of claim 1, wherein the microorganism further has enhanced Ahp protein activity compared to endogenous activity. 12 . The recombinant microorganism according to claim 11 , wherein the microorganism has enhanced activity of any one or more selected from the group consisting of alkyl hydroperoxide reductase subunit C (AhpC) and alkyl hydroperoxide reductase subunit F (AhpF).

13. The recombinant microorganism according to claim 11, wherein the Ahp protein is encoded by ahpCF operon gene.

14. The recombinant microorganism of claim 12, wherein the AhpC comprises the amino acid sequence of SEQ ID NO:

15.

15. The recombinant microorganism of claim 12, wherein the AhpF comprises the amino acid sequence of SEQ ID NO:

17.

16. The recombinant microorganism of claim 1, wherein the microorganism further has a phosphoserine phosphatase (SerB) activity that is attenuated compared to endogenous activity.

17. The recombinant microorganism of claim 1, wherein the microorganism is of the genus Escherichia.

18. A method for producing O-phosphoserine, comprising culturing the recombinant microorganism according to any one of claims 1 to 17 in a culture medium.

19. The method of claim 18, further comprising recovering O-phosphoserine from the culture medium or the cultured microorganism.

20. A method for producing cysteine ​​or a cysteine ​​derivative, comprising: (a) culturing the recombinant microorganism according to any one of claims 1 to 17 in a culture medium to produce O-phosphoserine or a culture medium containing O-phosphoserine; and (b) reacting the O-phosphoserine produced in step (a) or the culture medium containing O-phosphoserine with sulfide in the presence of O-phosphoserine sulfhydrylase (OPSS) or a microorganism containing the same.

21. Use of the recombinant O-phosphoserine-producing microorganism according to any one of claims 1 to 17 in producing O-phosphoserine, cysteine ​​or a cysteine ​​derivative.

Images