High-fidelity Pfu DNA polymerase mutant as well as preparation method and application thereof

Abstract

The invention relates to the technical field of polymerase, and provides a high-fidelity Pfu DNA polymerase mutant and a preparation method and application thereof.The mutant at least comprises one mutation of the following sites on the basis of wild-type Pfu DNA polymerase with the amino acid sequence shown as SEQ ID NO: 1: V82A, G211R, E383K, R594K and W616V. A plurality of mutant Pfu DNA polymerases with good enzyme activity and high fidelity are obtained by performing mutation modification on amino acids at multiple sites (V82A, G211R, E383K, R594K and W616V) of wild Pfu DNA, and mutants with five sites protruding all have the best enzyme activity and the highest fidelity and are suitable for a DNA sequencing technology, an NGS library building technology and the like.

Description

Technical Field

[0001] The present invention relates to the technical field of polymerases, in particular to a high-fidelity Pfu DNA polymerase mutant and a preparation method and application thereof. Background Art

[0002] With the rapid development of molecular biology, a series of revolutionary technologies have emerged, greatly promoting the research and application of life sciences. Among these technologies, polymerase chain reaction (PCR) has become an indispensable core tool in molecular biology research due to its high efficiency and precision. PCR technology can amplify large numbers of target gene fragments in a short period of time, providing strong support for research such as gene cloning, expression analysis, and mutation detection. In addition, PCR has also demonstrated a wide range of application value in medical diagnosis (such as genetic disease screening and tumor marker detection), pathogen detection (such as rapid identification of viruses and bacteria), and forensic identification (such as DNA fingerprint analysis).

[0003] DNA polymerase is a key component of the PCR reaction, and its function directly determines the specificity, fidelity, and yield of PCR products. Among the many DNA polymerases available, Pfu DNA polymerase is highly favored for its exceptional fidelity. Originally isolated from the thermophilic archaeon Pyrococcus furiosus, this enzyme maintains activity at extremely high temperatures, making it well-suited to the high-temperature conditions of PCR reactions. Pfu DNA polymerase not only possesses 5'-3' DNA polymerase activity, enabling efficient DNA synthesis, but also possesses 3'-5' exonuclease activity. This exonuclease activity recognizes and removes erroneously incorporated bases during polymerization, significantly reducing the error rate in PCR reactions and improving the accuracy of amplified products. Consequently, Pfu DNA polymerase has been widely used in applications requiring high fidelity, such as molecular cloning, site-directed mutagenesis, and DNA sequencing.

[0004] Although wild-type Pfu DNA polymerase has demonstrated high fidelity, with the rapid development of DNA sequencing technologies (such as Sanger sequencing) and next-generation sequencing (NGS) library construction technologies, researchers have placed higher demands on the fidelity of DNA polymerases. For example, in the preparation of NGS libraries, an extremely low error rate is crucial to ensuring the accuracy of sequencing data. To meet this demand, scientists have modified Pfu DNA polymerase through protein engineering and developed mutants with ultra-low error rates (such as PfuUltra, Pfu Turbo, etc.). These improved enzymes not only retain the high-fidelity characteristics of the wild type, but also have improvements in amplification efficiency, thermal stability, and inhibitor resistance, further broadening their application prospects in genomics, synthetic biology, and precision medicine.

[0005] In the future, as gene editing technologies (such as CRISPR) and single-cell sequencing become more prevalent, the requirements for DNA polymerase performance will become even more stringent. Therefore, the continuous exploration and improvement of the functions of new or existing enzymes to meet the growing demand for molecular biology applications has become a core task of research in this field. Summary of the Invention

[0006] In view of this, the present invention proposes a high-fidelity Pfu DNA polymerase mutant, a preparation method and application thereof. The high-fidelity Pfu DNA polymerase mutant is based on the wild-type Pfu DNA polymerase, and one or more mutations (V82A, G211R, E383K, R594K, W616V) are performed. After the mutation, its fidelity is improved compared with the wild-type, and the enzyme activity is not much different from that of the wild-type.

[0007] The technical solution of the present invention is achieved as follows: In the first aspect, the present invention provides a high-fidelity Pfu DNA polymerase mutant, which, based on the wild-type Pfu DNA polymerase with an amino acid sequence as shown in SEQ ID NO: 1, comprises at least one mutation in the following sites: V82A, G211R, E383K, R594K and W616V.

[0008] Based on the above technical solution, preferably, the mutant comprises mutations at five sites: V82A, G211R, E383K, R594K and W616V, and its amino acid sequence is shown in SEQ ID NO: 2.

[0009] In a second aspect, the present invention provides a nucleotide sequence encoding the high-fidelity Pfu DNA polymerase mutant.

[0010] In a third aspect, the present invention provides a recombinant expression vector capable of expressing the high-fidelity Pfu DNA polymerase mutant and an engineered cell transformed with the vector.

[0011] In a fourth aspect, the present invention provides a high-fidelity Pfu DNA polymerase mutant, a recombinant expression vector, and an engineered cell transformed with the vector, and uses thereof in a molecular detection kit.

[0012] In a fifth aspect, the present invention provides a method for preparing a high-fidelity Pfu DNA polymerase mutant, comprising the following steps:

[0013] S1, artificially synthesizing the nucleotide sequence of the high-fidelity Pfu DNA polymerase mutant according to claim 1 or 2, and then ligating it into an expression vector to obtain a recombinant expression vector;

[0014] S2, the recombinant expression vector is then transformed into host cells to obtain a genetically engineered strain;

[0015] S3, induce the expression of target protein, collect bacteria, isolate and purify to obtain high-fidelity Pfu DNA polymerase mutant.

[0016] Based on the above technical solution, preferably, the expression vector is pET28a; and the host cell is Escherichia coli BL21.

[0017] Based on the above technical solution, the preferred separation and purification method is: the collected bacteria are lysed and precipitated to obtain a crude enzyme sample; the crude enzyme sample is then subjected to Ni affinity chromatography, cation exchange chromatography and dialysis treatment in sequence to obtain a purified protein.

[0018] Preferably, the Ni affinity chromatography eluent is: 10-50 mM Tris, 50-1000 mM NaCl, 0-500 mM imidazole and 5%-20% (v / v) glycerol.

[0019] Preferably, the cation exchange chromatography buffer is: 10-50 mM Tris, 0.1-0.5 mM EDTA, 1-2 mM DTT and 0-1 M NaCl, 5%-20% (v / v) glycerol.

[0020] Preferably, the dialysis buffer used in the dialysis treatment is: 10-50 mM Tris, 100-500 mM NaCl, 0.1-0.2 mM EDTA, 1-2 mM DTT and 50% (v / v) glycerol.

[0021] On the basis of the above technical solution, preferably, the method for collecting bacterial cells for lysis, crushing and precipitation to obtain crude enzyme samples is: resuspending the bacterial cells with lysis buffer, crushing them with a cell high-pressure crusher, collecting the supernatant, and sequentially performing PEI treatment and ammonium sulfate precipitation and re-dissolution to obtain crude enzyme samples.

[0022] Preferably, the lysis buffer comprises: 10-50 mM Tris, 50-250 mM NaCl, 5-20 mM imidazole and 5%-15% (v / v) glycerol.

[0023] The high-fidelity Pfu DNA polymerase mutant and its preparation method and application of the present invention have the following beneficial effects compared with the prior art:

[0024] (1) The present invention obtains multiple mutant Pfu DNA polymerases with good enzyme activity and high fidelity by mutating amino acids at multiple sites (V82A, G211R, E383K, R594K and W616V) of wild-type Pfu DNA. Among them, the mutant with mutations at all five sites has the best enzyme activity and the highest fidelity, and is suitable for DNA sequencing technology and NGS library construction technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0026] Figure 1 This is a map of the pET 28a-Pfu DNA polymerase recombinant expression vector involved in Example 2 of the present invention. DETAILED DESCRIPTION

[0027] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0028] In one aspect, the present invention provides a high-fidelity Pfu DNA polymerase mutant, which is a wild-type Pfu DNA polymerase having an amino acid sequence as shown in SEQ ID NO: 1 and undergoes point mutations.

[0029] The present invention obtained 16 mutants through preliminary screening, including 7 single-point mutants, 6 double-point mutants, 4 triple-point mutants and 1 five-point mutant.

[0030]

[0031]

[0032] The bold and underlined mutation sites.

[0033] The mutation sites of each mutant are shown in Table 1.

[0034] Table 1 Mutation sites of each mutant

[0035]

[0036] The reliability and enzyme activity were verified by the following examples.

[0037] Example 1 Preparation of mutant Pfu DNA polymerase

[0038] This example takes the five mutants in Table 1 (shown in SEQ ID NO: 2) as an example to describe in detail the preparation method of the five mutant Pfu DNA polymerases.

[0039]

[0040]

[0041] The bold and underlined mutation sites.

[0042] The specific steps of preparation are as follows:

[0043] (1) Construction of recombinant engineering strains

[0044] A Pfu DNA polymerase encoding DNA containing five mutation sites (V82A, G211R, E383K, R594K, W616V) was artificially synthesized, the nucleotide sequence of which is shown in SEQ ID NO: 3, and the codons were optimized for the Escherichia coli expression system to improve the heterologous expression efficiency.

[0045] The gene fragment shown in SEQ ID NO: 3 was cloned into the pET28a expression vector with His tag (see Figure 1 ) to obtain the recombinant expression vector.

[0046] After sequencing verification, the vector was transformed into Escherichia coli BL21 (DE3) competent cells, and a single clone was selected for preservation, stored in a culture medium containing 30% (v / v) glycerol, and stored at -80°C for a long term.

[0047] (2) Induction culture of recombinant engineering strains

[0048] The recombinant strain was streaked onto an LB agar plate containing 50 μg / mL kanamycin and incubated inverted at 37°C overnight. A single colony was picked and inoculated into 10 mL of LB liquid medium containing kanamycin and cultured at 37°C with shaking for 45 hours until the OD600 reached 0.5-1.0. The strain was inoculated into 500 mL of LB liquid medium (containing 50 μg / mL kanamycin) at a ratio of 1:100 and cultured at 37°C for 45 hours. When the OD600 reached 0.60.8, IPTG was added to a final concentration of 0.5 mM to induce expression. Induce at 30°C for 16 hours. After induction, centrifuge at 7500g and 4°C for 15 minutes, discard the supernatant, and collect the cells for subsequent protein extraction.

[0049] (3) Pretreatment of mutant Pfu DNA polymerase

[0050] The collected cells were resuspended in lysis buffer (20 mM Tris-HCl, 250 mM NaCl, 5% (v / v) glycerol, pH 8.0, 25°C) at a mass-to-volume ratio of 1:5. Subsequently, the cells were disrupted using a high-pressure cell disruptor at 4°C and 890 bar for four cycles. The lysate was heated in a 75°C water bath for 20 minutes to initially heat-treat and remove heat-sensitive contaminants.

[0051] The heat-treated lysate was centrifuged at 30,000 g for 30 minutes at 4°C. The supernatant was collected and slowly added with polyethyleneimine (PEI) at a final concentration of 0.2%. The mixture was allowed to stand on ice for 30 minutes. The supernatant was collected and slowly added with 30% ammonium sulfate, stirring to dissolve the solution. The solution was allowed to stand on ice for 1 hour and centrifuged again at 30,000 g for 30 minutes at 4°C. The precipitate was collected and reconstituted with an appropriate amount of lysis buffer to obtain a crude enzyme solution.

[0052] (4) Purification of mutant Pfu DNA polymerase

[0053] The crude enzyme solution was filtered with a 0.45 μm filter membrane and then subjected to Ni affinity chromatography (IMAC). The sample was slowly loaded onto a NiFF column (Huiyan Bio), first eluted with 45 mM imidazole to remove impurities, and then the target protein was eluted with 200 mM imidazole. The target protein was collected and diluted to a conductivity of 5 mS / cm using a low-salt buffer (20 mM Tris-HCl, 1 mM DTT, 0.1 mM EDTA, 5% (v / v) glycerol, pH 8.0, 25°C), and then loaded onto Suzhou NanoMicro UniGel 30CM for cation exchange chromatography, eluted with a gradient of 50 mM to 1 M NaCl, and the eluate was collected in separate tubes. Each component was analyzed by SDS-PAGE, and the portion containing the target enzyme was collected.

[0054] The target protein solution was mixed with dialysis buffer (20mM Tris-HCl, 200mM NaCl, 1mM DTT, 0.1mM EDTA, 50% (v / v) glycerol, pH 8.0) at a ratio of 1:100. The solution was placed in a dialysis bag with a 30kDa molecular weight cutoff and dialyzed at 4°C, 180 rpm for 16 hours. After dialysis, 0.1% NP-40 and 0.5mM PMSF were added to inhibit protease activity. The purified enzyme solution was stored at -20°C.

[0055] (5) Description of some buffers and reagents

[0056] Lysis buffer: 20 mM Tris-HCl, 250 mM NaCl, 5% (v / v) glycerol, pH 8.0.

[0057] Ni column impurity removal eluent: 20 mM Tris-HCl, 250 mM NaCl, 50 mM imidazole, 5% (v / v) glycerol, pH 8.0.

[0058] Ni column target protein eluent: 20 mM Tris-HCl, 250 mM NaCl, 200 mM imidazole, 5% (v / v) glycerol, pH 8.0.

[0059] Low salt buffer: 20 mM Tris-HCl, 1 mM DTT, 0.1 mM EDTA, 5% (v / v) glycerol, pH 8.0.

[0060] Cation exchange chromatography eluent: 20 mM Tris, 0.1 mM EDTA, 1 mM DTT, 200 mM NaCl, 5% (v / v) glycerol.

[0061] Dialysis buffer: 20 mM Tris-HCl, 200 mM NaCl, 1 mM DTT, 0.1 mM EDTA, 50% (v / v) glycerol, pH 8.0.

[0062] The other mutants listed in Table 1 were prepared by referring to the above method.

[0063] Example 2 Test of mutant Pfu DNA polymerase activity

[0064] The enzyme activity test of the mutant Pfu DNA polymerase was performed according to the relevant national standard method. The specific steps are as follows:

[0065] (1) Take the dialyzed original enzyme solution and perform gradient dilution according to a certain ratio.

[0066] (2) Take an appropriate amount of diluted enzyme solution, add substrate T2 containing a hairpin structure and the required reaction accessories, and perform an amplification reaction under appropriate reaction conditions.

[0067] (3) The amplification reaction process is detected by a real-time fluorescence PCR instrument to obtain the corresponding fluorescence curve.

[0068] (4) Combined with the standard curve established using Lambda DNA as the template, the enzyme activity was quantitatively calculated based on the fluorescence signal.

[0069] The enzyme activities of the Pfu DNA polymerases of the mutants were detected according to the above method. The results are shown in Table 2.

[0070] Table 2 Test results of wild-type and mutant Pfu DNA polymerase enzyme activities

[0071] Mutant Enzyme activity (U / μl) Pfu-sso7d 24.89 V82A 24.96 I137R 8.22 G211R 25.87 K297D 12.22 E383K 25.13 R594K 23.78 W616V 27.15 V82A-G211R 29.11 V82A—E383K 27.19 V82A—W616V 25.24 G211R—E383K 28.12 G211R—R594K 24.28 R594K-W616V 27.21 V82A—G211R—E383K 25.21 V82A—G211R—W616V 26.55 G211R—E383K—R594K 27.25 E383K—R594K—W616V 26.46 V82A—G211R—E383K—R594K—W616V 28.53

[0072] As shown in Table 2, mutations at the V82A, G211R, E383K, R594K, and W616V sites, either individually or in combination, did not significantly reduce the activity of the mutant Pfu DNA polymerase. Some mutants even exhibited significantly higher activity than the wild-type. These results indicate that mutations at these sites not only do not weaken the polymerase's catalytic ability, but can actually enhance its activity to a certain extent.

[0073] Example 4 Test of the Fidelity of Mutant Pfu DNA Polymerase

[0074] To investigate the fidelity of the mutant Pfu DNA polymerase, this example uses a blue-white screening method based on the lacZ gene for testing. The specific process is as follows:

[0075] (1) Template preparation: Using plasmid pUC19 as a template, amplify using primer pair lacZ-BF / BR to obtain the pUC19-lacZ backbone.

[0076] lacZ-BF:cattaattgcgttgcgctcactg;

[0077] lacZ-BR: cgcttacagacaagctgtgaccgtc.

[0078] (2) Target fragment amplification: PCR amplification of the lacZ gene fragment was performed using different mutant Pfu DNA polymerases, and the primers used were lacZ-F / R.

[0079] lacZ-F: cacagcttgtctgtaagcggatgc;

[0080] lacZ-R:gagcgcaacgcaattaatgtgagt.

[0081] (3) Seamless connection: Through seamless cloning technology, the amplified lacZ fragment is connected with the pUC19-lacZ backbone fragment to obtain the recombinant product.

[0082] (4) Strain transformation: The recombinant product was transformed into TOP10 competent Escherichia coli cells.

[0083] (5) Blue-white spot screening: The transformed bacterial solution was evenly spread on a solid culture medium containing the corresponding antibiotics and suitable for blue-white spot screening, and incubated at 37°C overnight.

[0084] (6) Spot counting and analysis: Record the number of white spots and blue spots and calculate according to the following formula:

[0085]

[0086] Where F represents the proportion of blue spots (Lac+); 500 is the estimated dominant mutation site in the lacZ gene (reference: The fidelity of Taq polymerase catalyzing PCR is improved by an N-terminal deletion. Gene, 112 (1992) 29-35); E represents the polymerase error rate during each base incorporation process; m represents the actual PCR cycle number; since errors occurring in the last cycle are recessive relative to the WT, m-1 is used.

[0087] qPCR was used to estimate the amplification efficiency of the lacZ primer. The pUC19 plasmid was diluted 10-fold starting from 0.01 ng. qPCR was performed and the Ct value was plotted against the dilution factor to obtain the slope P. The amplification efficiency K = 10 was calculated. (-1 / P) , according to the amplification efficiency of lacZ primers in each reaction system in the experiment, calculate the LacZ PCR amplification multiple m,2 m =K 30, and finally the formula calculates the error rate E. The specific results are shown in Table 3 below:

[0088] Table 3 Calculation data related to each Pfu DNA polymerase mutant

[0089]

[0090] As shown in Table 3, single- or multiple-point mutations at the V82A, G211R, E383K, R594K, and W616V sites in the mutant Pfu DNA polymerase all improved fidelity compared to the wild-type. The combined five-point mutation exhibited the greatest improvement, demonstrating the highest amplification fidelity. These results demonstrate that mutations at these key sites can significantly improve the fidelity of the polymerase.

[0091] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A high-fidelity Pfu DNA polymerase mutant, characterized in that: Based on the wild-type Pfu DNA polymerase with an amino acid sequence as shown in SEQ ID NO: 1, the method comprises at least one mutation in the following sites: V82A, G211R, E383K, R594K and W616V.

2. A high-fidelity Pfu DNA polymerase mutant according to claim 1, characterized in that: The mutant comprises mutations at five sites: V82A, G211R, E383K, R594K and W616V, and its amino acid sequence is shown in SEQ ID NO:

2.

3. A nucleotide sequence encoding the high-fidelity Pfu DNA polymerase mutant according to claim 1 or 2.

4. A recombinant expression vector capable of expressing the high-fidelity Pfu DNA polymerase mutant according to claim 1 or 2, and an engineered cell transformed with the vector.

5. Use of the high-fidelity Pfu DNA polymerase mutant according to claim 1, or the recombinant expression vector according to claim 4 and the engineered cells transformed therewith in a molecular detection kit.

6. The method for preparing the high-fidelity Pfu DNA polymerase mutant according to claim 1 or 2, wherein: The following steps are involved: S1, artificially synthesizing the nucleotide sequence of the high-fidelity Pfu DNA polymerase mutant according to claim 1 or 2, and then ligating it into an expression vector to obtain a recombinant expression vector; S2, the recombinant expression vector is then transformed into host cells to obtain a genetically engineered strain; S3, induce the expression of target protein, collect bacteria, isolate and purify to obtain high-fidelity Pfu DNA polymerase mutant.

7. The preparation method according to claim 6, characterized in that The expression vector is pET28a; the host cell is Escherichia coli BL21.

8. The preparation method according to claim 6, characterized in that: The separation and purification method is as follows: the collected bacteria are lysed and precipitated to obtain a crude enzyme sample; the crude enzyme sample is then subjected to Ni affinity chromatography, cation exchange chromatography and dialysis treatment in sequence to obtain a purified protein.

9. The preparation method according to claim 6, characterized in that: The method for collecting bacterial cells for lysis, crushing and precipitation to obtain crude enzyme samples is as follows: resuspending the bacterial cells with a lysis buffer, crushing them with a high-pressure cell crusher, collecting the supernatant, and sequentially performing PEI treatment, ammonium sulfate precipitation and re-dissolution to obtain a crude enzyme sample.

Images