DsSAM50 / dsActin-coated MSNs nano-complex, preparation method thereof and application of dsSAM50 / dsActin-coated MSNs nano-complex in prevention and control of large thrips of cowpeas

Abstract

The invention belongs to the technical field of biology, and particularly discloses a dsSAM50 / dsActin-coated MSNs nano-complex, a preparation method thereof and application of the dsSAM50 / dsActin-coated MSNs nano-complex in prevention and control of large thrips of cowpeas, dsSAM50 and dsActin are simultaneously loaded by adopting nano-carrier mesoporous silica nanoparticles (MSNs), double genes (dsSAM50 / dsActin) are loaded through the mesoporous silica nanoparticles (MSNs), and the dsSAM50 / dsActin-coated MSNs nano-complex is obtained through the preparation method of the dsSAM50 / dsActin-coated MSNs nano-complex and the preparation method of the dsSAM50 / dsActin-coated MSNs nano-complex. The technical bottlenecks that bare dsRNA is easy to degrade and low in delivery efficiency in the traditional RNAi technology are broken through. The complex significantly improves the cell delivery efficiency of lethal genes by virtue of the high load capacity and targeted release characteristic of the nano-material, not only can significantly inhibit the expression of SAM50 and Actin genes of the megalurothrips megalurothrips, but also can significantly reduce the fecundity of the megalurothrips megalurothrips, significantly improves the death rate of the megalurothrips megalurothrips, and has good application prospects. After the two dsRNAs and the MSNs form a complex, the control effect on the cowpea large thrips can be improved.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to a dsSAM50 / dsActin@MSNs nanocomposite and a preparation method thereof, and application thereof in preventing and controlling cowpea bean thrips. Background Art

[0002] The bean thrips Megalurothrips usitatus (Bagnall) (Thysanoptera: Thripidae), also known as bean thrips and common giant thrips, is a significant pest in the main cowpea-producing areas of southern my country and has become a major factor restricting the healthy development of the cowpea industry in regions such as Hainan and Guangxi. The insect uses its rasp-sucking mouthparts to feed on tender parts of cowpea, such as flowers, buds, and leaves. Affected cowpea plants typically exhibit symptoms such as wrinkled leaves, failure of new leaves to unfold, and permanent shrinkage of the growing point, which inhibits plant growth. Affected pods develop deformities and dark-brown scars, forming a characteristic "black head and black tail" phenomenon, which affects the quality and yield of cowpeas and can even lead to complete crop failure in severe cases. In 2023, Megalurothrips usitatus and other vegetable thrips were listed as Class I crop pests and diseases. At present, chemical control is still the main measure to reduce the field population of bean thrips. However, due to the small size of the insects, they usually hide in the flowers and move and cause damage. The sprayed pesticides are difficult to act on the control targets, making control more difficult. At the same time, the long-term, high-dose and high-frequency use of chemical pesticides has a great negative impact on the environment. Therefore, seeking green and effective ways to control bean thrips has become a major problem that needs to be solved urgently in the development of the cowpea industry.

[0003] The SAM50 and Actin genes are key to the growth and development of Thrips leucoderma. The SAM50 protein interacts with substrate proteins through its conserved β-barrel domain, promoting their correct folding and insertion into the mitochondrial outer membrane, a process crucial for maintaining normal mitochondrial function. Actin, a highly conserved cytoskeletal component, plays a key role in fundamental biological processes such as endocytosis, cell motility, cell division, and signal transduction through its dynamic polymerization and depolymerization.

[0004] RNA interference (RNAi), also known as post-transcriptional gene silencing, offers tremendous opportunities for the development of RNA-based pesticides for sustainable pest control. Compared with traditional synthetic pesticides, RNA-based pesticides offer numerous advantages, including enhanced targeting, improved environmental compatibility, and simplified development. Discovering highly effective functional genes and constructing stable double-stranded RNA (dsRNA) delivery systems are crucial for enhancing the potential of RNAi technology.

[0005] Two key genes, SAM50 and Actin, were previously discovered to have a lethal effect on bean thrips. Silencing either gene alone can lead to the death of bean thrips. However, it is still unknown whether silencing both genes simultaneously will produce a synergistic effect to enhance the insecticidal effect. At the same time, the instability of dsRNA in the environment affects its application effect. Using nanocarriers to coat dsRNA can improve its stability and thus further enhance its biological activity against pests. Summary of the Invention

[0006] In order to solve the above technical problems, the present invention provides a dsSAM50 / dsActin@MSNs nanocomposite, a preparation method thereof, and an application in the prevention and control of cowpea bean thrips. Nanocarrier mesoporous silica nanoparticles (MSNs) are used to simultaneously load dsSAM50 and dsActin to achieve efficient delivery of the two dsRNAs into the pest body, targeting the key growth and development genes of the pest, thereby achieving green and efficient prevention and control of bean thrips.

[0007] To achieve the above object, the present invention is implemented according to the following technical solutions:

[0008] The first technical solution provided by the present invention is a method for preparing a dsSAM50 / dsActin@MSNs nanocomposite, comprising the following steps:

[0009] S1. Based on the gene sequences of SAM50 and Actin, two key genes for the growth and development of Thrips leucophylla, primers carrying T7 promoters for synthesizing dsSAM50 and dsActin were designed. The primers include:

[0010] dsSAM50-F: taatacgactcactataggggCTCTTGTCTCAAAACCCGA;

[0011] dsSAM50-R:taatacgactcactataggggAGTTATGGTAATCGCCGCAC;

[0012] dsActin-F:taatacgactcactataggggGTGGTGGATATGGGAGCAAC;

[0013] dsActin-R:taatacgactcactataggggTTTCTGCTAATGGTTTCCGC;

[0014] Using the cDNA of Macrothrips beanus as a template, dsSAM50 and dsActin were synthesized using the above primers;

[0015] S2. 1500 mg of hexadecyltrimethylammonium bromide (CTAB) was ultrasonically dissolved in 50 mL of ethanol, and then 0.75 mL of triethylamine (TEA) and 300 mL of deionized water were added. After ultrasonic mixing, the mixture was stirred at 80°C for 1 h, and then 12 mL of tetraethyl orthosilicate (TEOS) was added and the reaction was continued at 80°C for 6 h. After centrifugation, a white precipitate was obtained. The precipitate was washed three times with deionized water and anhydrous ethanol, and vacuum-dried. Finally, the precipitate was calcined in a muffle furnace at 600°C for 8 h to remove the template and obtain mesoporous silica nanoparticles (MSNs).

[0016] S3, 800 μL of 3-aminopropyltriethoxysilane (ATPES) was dissolved in 40 mL of ethanol, and 400 mg of mesoporous silica nanoparticles (MSNs) were added. The mixture was stirred for 12 h, and the precipitate was washed three times with anhydrous ethanol and deionized water after centrifugation. The precipitate was then vacuum-dried to obtain MSNs-NH2.

[0017] S4, dsSAM50 and dsActin were mixed in a mass ratio of 1:1 to obtain a dsRNA complex. MSNs-NH2 and dsRNA complex were mixed in a mass ratio of (1-32):1, incubated at room temperature for 10 minutes, and then centrifuged at 10,000 rpm for 5 minutes. After centrifugation, the nanoparticles were collected and washed three times with deionized water to obtain dsSAM50 / dsActin@MSNs nanocomplex.

[0018] The second technical solution provided by the present invention is a dsSAM50 / dsActin@MSNs nanocomposite prepared by the above method.

[0019] The third technical solution provided by the present invention is an application of a dsSAM50 / dsActin@MSNs nanocomplex in the prevention and control of cowpea bean thrips. Specifically, the dsSAM50 / dsActin@MSNs aqueous solution obtained by dissolving the dsSAM50 / dsActin@MSNs nanocomplex in clean water is sprayed onto the middle and upper leaves of cowpea plants growing bean thrips, with 20 mL sprayed on each cowpea plant.

[0020] Preferably, the concentration of the dsSAM50 / dsActin@MSNs aqueous solution is 600 ng / μL.

[0021] The fourth technical solution provided by the present invention is a cowpea bean thrips control agent composed of an aqueous solution of dsSAM50 / dsActin@MSNs with a concentration of 600 ng / μL.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] This invention utilizes mesoporous silica nanoparticles (MSNs) loaded with dual-gene dsRNA (dsSAM50 / dsActin), overcoming the technical bottlenecks of traditional RNAi technology, which often suffer from the susceptibility to degradation and low delivery efficiency of naked dsRNA. Leveraging the nanomaterial's high loading capacity and targeted release properties, the complex significantly improves the cellular delivery efficiency of the lethal gene, simultaneously inhibiting the expression of both the SAM50 and Actin genes, achieving a synergistic amplification of the gene silencing effect. Compared to treatments with either single gene sprays or a dsRNA mixture, the compound significantly increases bean thrips mortality by over 20% and reduces fertility by over 10%. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Scanning electron microscopy (SEM) images of MSNs and dsSAM50 / dsActin@MSNs nanocomposites: A, scale bar is 100 nm; B, scale bar is 0.5 μm.

[0025] Figure 2 Figure 3 shows the particle size and potential diagrams of MSNs, MSNs-NH2 and dsSAM50 / dsActin@MSNs nanocomplexes: A, particle size; B, potential.

[0026] Figure 3 N2 adsorption-desorption isotherms and corresponding pore size distribution of MSNs-NH2.

[0027] Figure 4 Thermogravimetric analysis diagrams of MSNs, MSNs-NH2 and dsSAM50 / dsActin@MSNs nanocomposites.

[0028] Figure 5 The inhibitory effect of different concentrations of dsSAM50 / dsActin@MSNs nanocomplex on the expression of lethal genes of Thrips edulis: A, SAM50 gene; B, Actin gene.

[0029] Figure 6 Effects of different concentrations of dsSAM50 / dsActin@MSNs nanocomplex on the lethality and reproductive capacity of Thrips thrips.

[0030] Figure 7 The effects of dsRNA alone, mixed use and dsSAM50 / dsActin@MSNs nanocomplex on the lethality and reproductive capacity of thrips.

[0031] Figure 8 The field control effect of dsSAM50 / dsActin@MSNs nanocomplex on thrips. DETAILED DESCRIPTION

[0032] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. The specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0033] Example 1. Synthesis of dsSAM50 / dsActin@MSNs Nanocomplex

[0034] 1) Primer design for dsRNA of the lethal gene of Thrips leucophylla

[0035] The lethal gene sequences SAM50 and Actin of Thrips bean were obtained from NCBI and Thrips bean genome databases. The sequences of SAM50 and Actin are as follows:

[0036] SAM50 gene sequence:

[0037] CTCTTGTCTCAAAACCCCGAAGTGATATAGGTCCACCCAAAAAGAAATGGTCACAGAGGCTTGGAGG

[0038] CTTACTGTTGCCAATGGGTTTCAACAGACCACAGTGAAAGAGTTGTTTGGAATACCACATCATTCGGCA

[0039] AGGGAATGTTGGCCTGGAATTGTGCCTCATTTTTAAAGAAGTTGACATTTCCTCCAATGCCAGCATATT

[0040] CTGAAGTAATACGCAATAATGTTCCACTTCGAGGAAATATTGGTTGATCTCTGCGATCAACAGAGAGG

[0041] ATATGACGCAGTGCTCCCTTCAGGCTTGTCCTGACATCTCTCGAATCTCAAATGCAGTTGTTCGATTT

[0042] AGAACGGACAAATCCCTCCATGTTGTATCCATTGCAAGTTGTGCCGAACCAAGGGAGCTGATGTAAA

[0043] AGCAAGGTCGAAAAGAATTCCTCTGTCTATCTGTTTGTATCCTGATGCTGGCTGTTCCGTGAAATGTTG

[0044] AAAAACTGAAGAGGTGAAGAAAGCATTTGCTCGGCCTCTTAATGGTTTCACAAAACCAAAATTGTAGTTGGAGGTGCGGCGATTACCATAACT (See SEQ ID NO.1).

[0045] Actin gene sequence:

[0046] TGAAACAGTTGTCATTCCAGTCTTTGAAAATGTTGCTGTTTTGCATGCATGGCAAGCTCAGCCCCTTG

[0047] GATCATTTGCTGTGAAAAGACAAATTACAGATATGTTAAAGAAATATGAATCTCCAGAGCTGTTTAGAA

[0048] CGCGGGATTGTGTGATACCAGCAACACGGGTAAAAGTAGAGAAAACAGAGCCACAAGAAGCATCAG

[0049] AAACATCAGCAGAAGCTGGGGTGCCTGAGGGATATGAAGAACTTGAGGAACGGGAAGAAGATTTCA

[0050] ACTACATAACTGAAAAGCACATTGAAGACATTAAGGTTCGGACCTGCTTTGTCACGAGCCTAGCTCGA

[0051] GTACAGAAAGCAGAAGAAGGCAACCCATGCCCACCACCTCCAAATGTGGATTATCTTATTGGAAGAA

[0052] GCAGCCGAATTGTCAATATCAGTGGTGAAATTCGAGAAAATGCTTACAATGTACTGTTTGAACAGGATGGTGATCACATCAGTGTACCCACCATGATCCTAGATGCCATATCTAAATGTCCAGTTGACAT (See SEQ IDNO.2).

[0053] Then, primers carrying T7 promoter for synthesizing dsSAM50 and dsActin were designed using the primer design website E-RNAi (https: / / www.flyrnai.org / cgi-bin / RNAi_find_primers.pl), as shown in Table 1.

[0054] Table 1

[0055]

[0056]

[0057] 2) PCR cloning of lethal genes

[0058] Using the cDNA of Thrips leucophylla as a template, a high-fidelity enzyme was used to accurately amplify the silencing fragments of SAM50 and Actin with linkers. The synthesis process of the cDNA of Thrips leucophylla was as follows:

[0059] Step 1: RNA extraction from Thrips leucophylla: (Trizol extraction method)

[0060] (1) Fifty bean thrips of uniform size were selected and placed in an RNase-free centrifuge tube. 1 mL of TRIzol was added and the mixture was quickly ground with a grinding rod. The mixture was immediately vortexed and vigorously shaken to mix. The mixture was allowed to stand at room temperature for 5 min.

[0061] (2) Centrifuge (4°C, 12,000 × g) for 10 min and transfer the supernatant to a new EP tube.

[0062] (3) Phase separation: add 0.2 mL of chloroform, shake for 15 seconds, let stand at 15-30°C for 3 minutes, and centrifuge (4°C, 12,000 × g) for 15 minutes.

[0063] (4) Precipitation and removal of polysaccharides: Take the colorless phase and transfer it to a new EP tube. Add an equal volume of isopropanol and mix thoroughly by inversion. Let it stand at 15-30°C for 10 minutes. Centrifuge (4°C, 12,000 × g) for 10 minutes and discard the supernatant.

[0064] (5) Washing: Remove excess supernatant with a pipette, add 1 mL of ice-cold 75% ethanol, and vortex; centrifuge (4°C, 7500×g) for 5 min. Repeat this step twice.

[0065] (6) Discard the supernatant and let it air dry at room temperature for several minutes until a precipitate appears. Dissolve the precipitate in 30-50 μL ddH2O.

[0066] (7) The purity and integrity of the RNA were determined using a Nanodrop 2000 (Thermo) and agarose gel electrophoresis (voltage 130 V, current 130 mA, 20 min). The concentration was measured using a micro-UV spectrophotometer. The remaining RNA was stored at -80°C.

[0067] Step 2: cDNA synthesis

[0068] According to the instructions of the ToloScript ALL-in-one RT EasyMix for qPCR kit, the reaction system was configured according to Table 2 below, with reaction at 50°C for 15 minutes and 85°C for 5 seconds. Finally, cDNA of Thrips bean was obtained.

[0069] Table 2

[0070]

[0071] Afterwards, a 50 μL system was prepared, and the synthesis was performed at 58° C. for 32 cycles. The PCR amplification system and reaction conditions are shown in Table 3.

[0072] Table 3

[0073]

[0074] 3) PCR product electrophoresis detection and gel excision recovery

[0075] Preparation: Dissolve 0.8 g of agar powder in 80 mL of 1x TAE buffer, heat to dissolve, then add 8 μL of nucleic acid dye. Allow to cool and solidify for product detection. Add 50 μL of the post-PCR mixture to the gel wells and incubate at 140 V for 18 minutes to check band integrity.

[0076] Gel cutting: Place the gel block under UV light, cut the gel block with the fluorescent band of the target gene, place it in a 1.5 mL RNase-Free centrifuge tube and weigh it.

[0077] 4) Purification and recovery of lethal gene DNA from agarose gel

[0078] Refer to the Gel / PCR Extraction Kit (BIOMIGA, USA) for instructions; the specific steps are as follows:

[0079] Step 1: Pre-equilibration. Place a new ezBind Mini Column in a collection tube. Pipette 500 μL of Buffer GBL into the column and let it sit at room temperature for 2 minutes. Centrifuge at 12,000 × g for 2 minutes at room temperature (minicolumn). Discard the filtrate from the collection tube and re-install the ezBind Mini Column in the collection tube.

[0080] Step 2: Dissolve. Cut the gel containing the target fragment from the gel obtained in step 3) into a 1.5 mL centrifuge tube. Add at least 1 volume of GC buffer (weigh or estimate the weight of the gel to ensure at least 1 volume of GC buffer is added). Place in a 55°C–60°C water bath for 8–10 minutes, inverting the tube several times to mix thoroughly, until the gel is completely dissolved. Cool the tube to room temperature.

[0081] Step 3: Adsorption. Transfer the mixture (no more than 650 μL at a time) to an adsorption column with a collection tube. Centrifuge at 12,000 rpm for 1 minute at room temperature. Discard the waste liquid from the collection tube and return the adsorption column to the collection tube. Repeat this step until all the remaining mixture has passed through the adsorption column.

[0082] Step 4: Wash: Add 650 μL DNA Wash Buffer to the adsorption column and centrifuge at 12,000 rpm for 30 seconds at room temperature. Discard the waste liquid in the collection tube and return the adsorption column to the collection tube. Repeat this process.

[0083] Step 5: Centrifuge. Replace the tube with a new enzyme-free EP tube and centrifuge the adsorption column with the cap opened for 2 minutes at room temperature at 12,000 rpm to remove any residual ethanol.

[0084] Step 6: Elution. Transfer the adsorption column to a 1.5 mL collection tube. Add 30–50 μL of 60°C preheated ddH₂O to the center of the adsorption column membrane. Allow to stand at room temperature for 1 minute. Centrifuge at 12,000 rpm for 1 minute. To increase the yield, add the eluate back to the adsorption column and elute again.

[0085] Step 7: The obtained double-stranded DNA was tested for concentration using a UV spectrophotometer and integrity by electrophoresis. If qualified, it was stored at -80°C and used as the Template cDNA in step 5).

[0086] 5) Synthesis of dsSAM50 and dsActin

[0087] The synthesis process was performed according to the TranscriptAidT7 HighYield Transcription Kit instructions (ThermoScientific, Wilmington, DE, USA). Specifically, at room temperature, add the following reaction components according to Table 4, totaling 20 μL. Mix thoroughly on ice, centrifuge briefly, place in a PCR instrument, and incubate overnight at 37°C. Once a large amount of white flocculent material appears in the PCR tube, the dsSAM50 or dsActin mixture has been synthesized. Purify the dsRNA according to the kit instructions to obtain dsSAM50 and dsActin. The specific purification steps for dsSAM50 and dsActin are as follows:

[0088] Step 1: Eliminate DNA: Add 2 μL of Dnase I to the mixture of synthesized dsSAM50 or dsActin and incubate at 37°C for 15 minutes. Then, add 2 μL of EDTA and incubate at 65°C for 10 minutes.

[0089] Step 2: Extraction. Transfer the reaction mixture to a 1.5 mL nuclease-free centrifuge tube. Add 115 μL of RNase-Free ddH2O and 15 μL of Sodiem Acetate Buffer. Mix thoroughly, then add 150 μL of an equal volume of water-saturated phenol / chloroform mixture. Mix thoroughly, then add 300 μL of chloroform and shake vigorously.

[0090] Step 3: dsRNA precipitation: Centrifuge at 12,000 rpm for 10 minutes, transfer the supernatant to a 1.5 mL nuclease-free centrifuge tube, add 350 μL of anhydrous ethanol, mix gently, and incubate at -20°C for 2 hours.

[0091] Step 4: Wash the dsRNA pellet. Centrifuge at 12,000 rpm for 10 minutes, discard the supernatant, retain the pellet, and then add pre-chilled 75% ethanol and wash twice by inverting.

[0092] Step 5: Air-dry the pellet. Centrifuge at 4°C, 7500 rpm for 5 minutes, discard the supernatant, centrifuge briefly again, remove any remaining ethanol with a pipette, and air-dry for 3-5 minutes until the pellet becomes gelatinous and translucent.

[0093] Step 6: Quality Assurance. Add 50 μL of RNase-free ddH₂O, mix thoroughly, and measure the dsRNA concentration using a UV spectrophotometer. Simultaneously, aspirate 1 μL of the dsRNA solution to check its integrity by agarose gel electrophoresis. Aliquot the remaining dsRNA solution and store at -80°C until further use. This will yield purified dsSAM50 and dsActin.

[0094] Table 4

[0095]

[0096] 6) 1500 mg of hexadecyltrimethylammonium bromide (CTAB) was ultrasonically dissolved in 50 mL of ethanol, followed by the addition of 0.75 mL of triethylamine (TEA) and 300 mL of deionized water. After ultrasonic mixing, the mixture was stirred at 80°C for 1 h, and then 12 mL of tetraethyl orthosilicate (TEOS) was added and the reaction continued at 80°C for 6 h. After centrifugation, a white precipitate was obtained. The precipitate was washed three times with deionized water and anhydrous ethanol, dried in a vacuum, and finally calcined in a muffle furnace at 600°C for 8 h to remove the template and obtain mesoporous silica nanoparticles (MSNs).

[0097] 7) Dissolve 800 μL of 3-aminopropyltriethoxysilane (ATPES) in 40 mL of ethanol, add 400 mg of mesoporous silica nanoparticles (MSNs), mix and stir for 12 h, centrifuge, wash the precipitate three times with anhydrous ethanol and deionized water, and vacuum dry to obtain MSNs-NH2.

[0098] 8) Purified dsSAM50 and dsActin were mixed at a mass ratio of 1:1 to form a dsRNA complex. The MSNs-NH2 and dsRNA complex was then mixed at mass ratios of 32:1, 16:1, 8:1, 4:1, 2:1, and 1:1. Each mixture was incubated at room temperature for 10 minutes and then centrifuged at 10,000 rpm for 5 minutes. The supernatant was analyzed by agarose gel electrophoresis. Agarose gel electrophoresis confirmed that dsRNA was completely loaded when the mass ratio of the MSNs-NH2 and dsRNA complex reached 8:1. The nanoparticles were collected and washed three times with deionized water to obtain dsSAM50 / dsActin@MSNs nanocomplexes.

[0099] The scanning electron microscopy (SEM) images of the MSNs and dsSAM50 / dsActin@MSNs nanocomposites prepared in this example are shown in FIG. Figure 1 The particle size and potential of MSNs, MSNs-NH2 and dsSAM50 / dsActin@MSNs nanocomplexes are shown in Figure 2 As shown in Figure 2, the N2 adsorption-desorption isotherms and the corresponding pore size distribution of MSNs-NH2 are shown in Figure 2. Figure 3 The thermogravimetric analysis of MSNs, MSNs-NH2 and dsSAM50 / dsActin@MSNs nanocomposites is shown in Figure 4 shown.

[0100] Depend on Figure 1 As shown in Figure A, MSNs are regular spherical with smooth surface and good dispersion and uniformity. Figure 1As shown in Figure B, the surface of the dsSAM50 / dsActin@MSNs nanocomposite becomes rougher than that of MSNs, which is presumably due to the binding of dsSAM50 / dsActin to the surface of MSNs.

[0101] Depend on Figure 2 As shown in Figure A, the particle size test shows that the particle sizes of MSNs, MSNs-NH2 and dsSAM50 / dsActin@MSNs nanocomplex are 54.26, 54.53 and 55.23 nm respectively, indicating that the particle size of MSNs increases slightly after surface modification. Figure 2 As shown in Figure B, the ζ-potentials of MSNs, MSNs-NH2 and dsSAM50 / dsActin@MSNs nanocomposites are -11.33, 16.63 and 2.77 mV, respectively, which further verifies that -NH2 and dsSAM50 / dsActin are successfully grafted onto MSNs.

[0102] Depend on Figure 3 It can be seen that MSNs-NH2 shows a typical type IV isotherm, which is a typical feature of mesoporous materials. Its specific surface area is 68.74m 2 / g, and the BJH pore size distribution is 8.74 nm. These characteristics make MSNs-NH2 have potential good performance in internal and external loading of reagents.

[0103] Depend on Figure 4 It can be seen that the thermogravimetric analysis graphs showed that the MSNs-NH2 and dsSAM50 / dsActin@MSNs nanocomplexes decreased by 7.5% and 14.1%, respectively, which indicated that MSNs were successfully modified by -NH2 and dsSAM50 / dsActin.

[0104] Example 2: Control Effect of dsSAM50 / dsActin@MSNs Nanocomplex on Cowpea Thrips

[0105] 1) Cowpeas grown to the 8-10 leaf stage were selected and 30 heads per plant were inoculated. dsGFP (800 ng / μL) and MSNs (800 ng / μL) were used as controls. The synthesis method of dsGFP was the same as the synthesis method of dsSAM50 and dsActin in Example 1. The primers used are shown in Table 5.

[0106] Table 5

[0107]

[0108] The dsSAM50 / dsActin@MSNs nanocomplex was dissolved in clean water and four concentration gradients of 200 ng / μL, 400 ng / μL, 600 ng / μL, and 800 ng / μL were set. 20 mL was sprayed on each plant. 1, 2, and 3 days after treatment, the expression levels of SAM50 and Actin genes were measured and analyzed by qPCR. The qPCR primer sequences of SAM50 and Actin genes are shown in Table 6.

[0109] Table 6

[0110]

[0111]

[0112] Then, the number of live bean thrips was observed and counted 1 day, 3 days, 5 days and 7 days after treatment, with 3 plants as a replicate and 3 replicates set up; 10 bean thrips were randomly selected and their cumulative egg-laying capacity was measured indoors.

[0113] 2) Cowpeas grown to the 8-10 leaf stage were selected and inoculated with 30 heads per plant. dsSAM50 (600 ng / μL), dsActin (600 ng / μL), dsSAM50 / dsActin (600 ng / μL), and dsSAM50 / dsActin@MSNs nanocomplex (600 ng / μL) were sprayed respectively. The number of live bean thrips was observed and counted 1, 3, 5, and 7 days after treatment. Every 3 plants were used as a replicate, and 3 replicates were set up. Ten bean thrips were randomly selected and their cumulative egg production was determined indoors.

[0114] 3) The dsSAM50 / dsActin@MSNs nanocomplex (600 ng / μL) was sprayed on cowpea seedlings in the field, using water and MSNs (600 ng / μL) as controls. The number of live bean thrips was counted 1, 3, 5, and 7 days after treatment, and the mortality rate was calculated. Every 5 plants were used as a replicate, and 3 replicates were set up.

[0115] The inhibitory effects of different concentrations of dsSAM50 / dsActin@MSNs nanocomplex on the expression of lethal genes of Thrips leucophylla Figure 5 As shown in Figure 2, the effects of different concentrations of dsSAM50 / dsActin@MSNs nanocomplex on the lethality and reproductive capacity of Thrips leonina are shown in Figure 2. Figure 6 As shown in Figure 2, the effects of dsRNA alone, mixed use, and dsSAM50 / dsActin@MSNs nanocomplex on the lethality and reproductive capacity of Thrips leonina. Figure 7 As shown in the figure, the field control effect of dsSAM50 / dsActin@MSNs nanocomplex on thrips is shown in the figure. Figure 8 shown.

[0116] Depend on Figure 5 、 Figure 6 and Figure 7 It can be seen that MSNs (800ng / μL) had no effect on the expression of SAM50 and Actin genes of bean thrips and had no lethal effect on bean thrips; 600ng / μL and 800ng / μL dsSAM50 / dsActin@MSNs nanocomplex had the best effect, not only significantly inhibiting the expression of SAM50 and Actin genes of bean thrips (see Figure 5 ), and can significantly reduce the reproductive capacity of Thrips leucopsis (see Figure 6 B), significantly increased the mortality of bean thrips (see Figure 6 A in Figure 1), and there was no significant difference between the two concentrations of 600ng / μL and 800ng / μL. Further experiments showed that spraying a mixture of dsSAM50 / dsActin (600ng / μL) dsRNA was more effective than spraying a single dsSAM50 (600ng / μL) and dsActin (600ng / μL). Spraying a nanocomplex of dsSAM50 / dsActin@MSNs (600ng / μL) simultaneously had a significantly better effect on the mortality and fecundity of Thrips leucopendra than dsSAM50 / dsActin (600ng / μL). Figure 7 ), the above results indicate that the combined use of the two genes' dsRNA has a synergistic effect, and the two dsRNAs forming a complex with MSNs is beneficial to improving the control effect against cowpea bean thrips.

[0117] Depend on Figure 8 As can be seen, the field test results show that spraying the dsSAM50 / dsActin@MSNs (600 ng / μL) nanocomposite has excellent control effects on cowpea bean thrips. Therefore, this example also provides a cowpea bean thrips control agent composed of an aqueous solution of dsSAM50 / dsActin@MSNs at a concentration of 600 ng / μL.

[0118] In summary, it was determined that the dsSAM50 / dsActin@MSNs nanocomplex has a good control effect on cowpea bean thrips, which provides a direct scientific basis for the widespread application of the dsSAM50 / dsActin@MSNs nanocomplex in the control of cowpea bean thrips, and provides a new target technology and new ideas for innovative control methods of bean thrips.

[0119] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. Any technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. A method for preparing a dsSAM50 / dsActin@MSNs nanocomposite, characterized in that: The following steps are involved: S1. Based on the gene sequences of SAM50 and Actin, two key genes for the growth and development of Thrips leucophylla, primers carrying T7 promoters for synthesizing dsSAM50 and dsActin were designed. The primers include: dsSAM50-F:taatacgactcactataggggCTCTTGTCTCAAAACCCCGA; dsSAM50-R:taatacgactcactataggggAGTTATGGTAATCGCCGCAC; dsActin-F:taatacgactcactatagggGTGGTGGATATGGGAGCAAC; dsActin-R:taatacgactcactataggggTTTCTGCTAATGGTTTCCGC; Using the cDNA of Macrothrips beanus as a template, dsSAM50 and dsActin were synthesized using the above primers; S2. 1500 mg of hexadecyltrimethylammonium bromide (CTAB) was ultrasonically dissolved in 50 mL of ethanol, and then 0.75 mL of triethylamine (TEA) and 300 mL of deionized water were added. After ultrasonic mixing, the mixture was stirred at 80°C for 1 h, and then 12 mL of tetraethyl orthosilicate (TEOS) was added and the reaction was continued at 80°C for 6 h. After centrifugation, a white precipitate was obtained. The precipitate was washed three times with deionized water and anhydrous ethanol, and vacuum-dried. Finally, the precipitate was calcined in a muffle furnace at 600°C for 8 h to remove the template and obtain mesoporous silica nanoparticles (MSNs). S3, 800 μL of 3-aminopropyltriethoxysilane (ATPES) was dissolved in 40 mL of ethanol, and 400 mg of mesoporous silica nanoparticles (MSNs) were added. The mixture was stirred for 12 h, and the precipitate was washed three times with anhydrous ethanol and deionized water after centrifugation. The precipitate was then vacuum-dried to obtain MSNs-NH2. S4, dsSAM50 and dsActin were mixed in a mass ratio of 1:1 to obtain a dsRNA complex. MSNs-NH2 and dsRNA complex were mixed in a mass ratio of (1-32):1, incubated at room temperature for 10 minutes, and then centrifuged at 10,000 rpm for 5 minutes. After centrifugation, the nanoparticles were collected and washed three times with deionized water to obtain dsSAM50 / dsActin@MSNs nanocomplex.

2. A dsSAM50 / dsActin@MSNs nanocomposite prepared by the method according to claim 1.

3. Use of the dsSAM50 / dsActin@MSNs nanocomplex as claimed in claim 2 in the prevention and control of cowpea bean thrips.

4. The use according to claim 3, characterized in that The dsSAM50 / dsActin@MSNs aqueous solution obtained by dissolving the dsSAM50 / dsActin@MSNs nanocomplex in clean water was sprayed onto the middle and upper leaves of cowpea plants infested with Thrips leucophylla, with 20 mL sprayed per cowpea plant.

5. The use according to claim 4, characterized in that: The concentration of the dsSAM50 / dsActin@MSNs aqueous solution is 600 ng / μL.

6. A cowpea bean thrips control agent, characterized in that: It consists of an aqueous solution of dsSAM50 / dsActin@MSNs at a concentration of 600 ng / μL.

Images