Difunctional oligonucleotide RNA (Ribonucleic Acid), extracellular vesicle containing RNA and pharmaceutical application of extracellular vesicle

Abstract

The invention belongs to the technical field of biological pharmacy, and particularly relates to a difunctional oligonucleotide RNA (imm-miR22), a vesicle containing the RNA and pharmaceutical application of the difunctional oligonucleotide RNA (imm-miR22), according to the RNA, a seed sequence of FOXO3a targeted by miR-223 is reserved, an AGAUAAAAA complementary stem region is designed, and 5 '-triphosphate modification is conducted, so that the dual functions of inhibiting expression of FOXO3a and activating an RIG-I signal channel at the same time are achieved. The RNA is loaded by adopting extracellular vesicles (EVs) from hepatic stellate cells to form the imm-miR223-EVs; the EVs are extracted by virtue of ultracentrifugation, and the imm-miR22 is loaded by virtue of an exosome transfection reagent (Ex-FectExosome Transfection Kit). In-vitro experiments show that the imm-miR223-EVs can inhibit autophagy, reduce the IC50 value of adriamycin by 56% and induce secretion of cell factors such as IFN-beta and IL-6. In an HCC mouse model, the tumor volume is reduced by 72% by combining arterial injection of adriamycin, immune-related genes such as RSAD2, Ddx58 and ISG56 are remarkably up-regulated, and secretion of cell factors such as IFN-beta and IL-6 is induced. The drug resistance bottleneck of traditional TACE treatment is broken through, and an innovative scheme is provided for liver cancer treatment through nucleic acid drug-chemotherapy synergy and an immune activation mechanism.

Description

Technical Field

[0001] The present invention belongs to the field of biopharmaceutical technology, and specifically relates to a bifunctional oligonucleotide RNA, an extracellular vesicle containing the RNA, and pharmaceutical uses thereof. Background Art

[0002] Liver cancer is the fourth most common cancer in my country. Primary liver cancer primarily includes hepatocellular carcinoma (HCC) and intrahepatic bile duct carcinoma. HCC is the most common type of liver cancer, accounting for 75%-85% of all primary liver cancers. Surgical resection is the preferred treatment for early-stage liver cancer. However, due to the lack of typical early symptoms, most patients have already progressed to the advanced stage by the time of diagnosis, and only 30%-40% of patients are eligible for surgical treatment. For patients with advanced HCC who are not candidates for surgery, transcatheter arterial embolization (TACE) is the preferred local treatment for this condition. It involves the delivery of chemotherapy drugs (usually doxorubicin) and embolic agents (usually lipiodol) through the hepatic artery. However, TACE alone has drawbacks such as difficulty completely eliminating tumors and a high risk of recurrence and metastasis. With a five-year recurrence rate exceeding 70%, the treatment outcome is not promising. Therefore, further improvements in TACE efficacy are urgently needed to improve the survival rate of liver cancer patients. Summary of the Invention

[0003] To address the above issues, the present invention provides a bifunctional oligonucleotide RNA, extracellular vesicles containing the RNA, and pharmaceutical uses thereof. The present invention constructs a bifunctional RNA oligonucleotide and uses EVs derived from normal liver cells to deliver the functional RNA for adjuvant treatment of HCC. The combined treatment of these EVs with DOX can effectively enhance the efficacy of DOX in vitro and in vivo by targeting FOXO3a, inhibiting HCC tumor growth, and stimulating tumor immunity by activating the RIG-I pathway, thereby inhibiting tumor recurrence. This invention provides a novel nucleic acid drug with significant efficacy in the treatment of HCC.

[0004] In order to achieve the above object, the technical solution adopted by the present invention is as follows: 1. While retaining the miR-223 seed sequence targeting FOXO3a, miR-223 was modified to have both the regulatory function of targeting FOXO3a and the immune regulatory function of activating RIG-I (hereinafter referred to as imm-miR223) and synthesized by in vitro transcription (IVT).

[0005] 2. EVs secreted by hepatic stellate cells (LX2) were extracted by ultracentrifugation and characterized by transmission electron microscopy (TEM), nanoparticle tracking analysis (NTA), and western blot. Imm-miR223 was then loaded into EVs (imm-miR223-EVs) using Exo-Fect transfection reagent. The loading efficiency of imm-miR223 into EVs was verified by bead-assisted flow cytometry.

[0006] 3. During TACE, imm-miR223-EVs were injected into the arteries of liver cancer tissue in combination with doxorubicin, replacing the chemotherapy drug doxorubicin currently used in clinical TACE.

[0007] Specifically include the following preferred technical solutions: A bifunctional oligonucleotide RNA comprising the following sequence structure: (a) Loop sequence: a sequence extracted from the seed sequence of miR-223 that interacts with FOXO3a. The seed sequence is a sequence that retains the targeting function of miR-223 for FOXO3a. (b) Stem sequence: a sequence complementary to the sequence AGAUAAAAA; (c) A triphosphate group is coupled to the 5' end.

[0008] Preferably, the bifunctional oligonucleotide RNA has a sequence of: 5'-ppp-GGGAGAUAAAAAUGUCAGUUUGCAUUUUUAUCUCCC-3'=SEQ ID NO.1.

[0009] The present invention also discloses the use of the bifunctional oligonucleotide RNA in preparing a product having the functions of simultaneously targeting FOXO3a and inducing RIG-I pathway activation.

[0010] The present invention also discloses a biological product comprising a nucleic acid delivery vector, wherein the vector carries the oligonucleotide RNA according to claim 1 or 2.

[0011] The present invention further discloses the use of the above biological product in preparing a medicine for treating hepatocellular carcinoma.

[0012] Furthermore, in the above use, the drug is a drug that simultaneously inhibits the expression of FOXO3a and activates the RIG-I signaling pathway in hepatocellular carcinoma.

[0013] Furthermore, in the above use, the drug is more specifically a drug that enhances the sensitivity of doxorubicin DOX to hepatocellular carcinoma.

[0014] Furthermore, in the above-mentioned biological products, the nucleic acid delivery vector is EVs or liposomes.

[0015] Furthermore, in the above-mentioned biological products, the EVs are EVs derived from hepatic stellate cells.

[0016] The present invention also discloses a pharmaceutical composition for treating hepatocellular carcinoma, characterized in that it comprises the biological product according to claim 4 and the chemotherapy drug doxorubicin DOX.

[0017] Compared with the prior art, the present invention has the following beneficial effects: Conventional doxorubicin (DOX) chemotherapy for hepatocellular carcinoma (HCC) suffers from inadequate efficacy and high recurrence and metastasis. This study, based on the low expression of miR-223 in HCC, designed a bifunctional miR-223 variant (imm-miR223) through structural engineering: the loop retains the seed sequence of miR-223 targeting the oncogene FOXO3a, while the stem is designed with a complementary AGAUAAAAA stem-loop structure. A triphosphate group is coupled to the 5' end, enabling the variant to simultaneously inhibit FOXO3a and activate the RIG-I signaling pathway. Furthermore, imm-miR223-EVs, loaded with extracellular vesicles (EVs) derived from hepatic stellate cells, effectively protect nucleic acids from degradation and reduce immune rejection while significantly improving drug targeting and delivery efficiency to the liver. In vitro and in vivo experiments demonstrated that imm-miR223-EVs combined with DOX therapy synergistically enhanced HCC sensitivity to DOX, reversed chemotherapy resistance by inhibiting FOXO3a, and simultaneously activated the RIG-I pathway to induce anti-tumor immune responses, ultimately significantly inhibiting tumor growth and reducing the risk of recurrence. This combined therapy provides an innovative strategy for improving the efficacy of transarterial chemoembolization (TACE) for HCC. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Bioinformatics analysis shows the differential expression of FOXO3a in normal liver and HCC tissues (AB). High FOXO3a expression in HCC is associated with poor prognosis (C), and FOXO3a expression is further elevated in cases with lymph node metastasis (D). Also shown is the differential expression of miR-223 in normal liver and HCC tissues (E).

[0019] Figure 2miR-223 targets and regulates FOXO3a. (A) Seed sequence for miR-223 binding to the FOXO3a 3'UTR. Transfection with miR-223 mimics significantly upregulated miR-223 expression and downregulated FOXO3a protein (B) and mRNA (C) levels in HCC cells.

[0020] Figure 3 Schematic diagram of the structure of miR-223 variant (imm-223), with red representing the seed sequence.

[0021] Figure 4 In vitro transfection of imm-223 significantly reduced the IC50 of DOX (A), inhibited DOX-induced autophagy (BC), upregulated the mRNA levels of the RIG encoding gene Ddx58 and RLR downstream effector molecules (including MVAS, RSAD2, IFNB, IRF3, IRF7 and ISG56) (D), and increased the levels of cytokines IFN-β, TNF-α, IL-6 and IL-10 released by HCC cells (E).

[0022] Figure 5 Identification of hepatic stellate cell-derived EVs. (A) Electron microscopy revealed typical cup-shaped particles with a double membrane structure, consistent with EV morphology. (B) NTA analysis revealed a particle size of approximately 150 nm, consistent with the diameter of EVs. (C) Western blot analysis revealed the presence of EV-positive markers Flot1, CD63, and CD9, but lacked the EV-negative marker Calnexin. (D) Bead-assisted flow cytometry revealed a homogeneous population of EVs exhibiting FAM fluorescence after loading with Exo-Fect.

[0023] Figure 6 Treatment with imm-miR223-EVs significantly reduced the IC50 of DOX in vitro.

[0024] Figure 7 imm-miR223-EVs treatment significantly inhibited DOX-induced autophagy in vitro.

[0025] Figure 8 Imm-miR223-EVs treatment significantly inhibited the proliferation (A) and migration (C) of HCC cells in vitro and promoted the apoptosis of HCC cells (B).

[0026] Figure 9 Imm-miR223-EVs treatment significantly upregulated the mRNA levels of the RIG encoding gene Ddx58 and RLR downstream effector molecules (including MVAS, RSAD2, IFNB, IRF3, IRF7 and ISG56) in vitro.

[0027] Figure 10 Imm-miR223-EVs treatment significantly increased the levels of cytokines IFN-β, TNF-α, IL-6, and IL-10 released by HCC cells in vitro.

[0028] Figure 11 Schematic diagram of the experimental process for the construction of a mouse HCC subcutaneous tumor-bearing model and imm-miR223-EVs treatment.

[0029] Figure 12 imm-miR223-EVs combined with DOX treatment significantly inhibited HCC tumor growth in mice.

[0030] Figure 13 imm-miR223-EVs treatment inhibited the expression of FOXO3a in mouse tumor tissues.

[0031] Figure 14 Imm-miR223-EVs combined with DOX treatment significantly upregulated the mRNA levels of the RIG encoding gene Ddx58 and RLR downstream effector molecules (including MVAS, RSAD2, IFNB, IRF3, IRF7 and ISG56) in mouse tumor tissues.

[0032] Figure 15 The combined treatment of imm-miR223-EVs with DOX significantly upregulated the levels of cytokines IFN-β, TNF-α, IL-6, and IL-10 in mouse tumor tissues. DETAILED DESCRIPTION

[0033] The following is a clear and complete description of the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts are within the scope of protection of the present invention.

[0034] Example 1 Bioinformatics Analysis of Hepatocellular Carcinoma We analyzed the expression and prognosis of FOXO3a in HCC using the UALCAN and HPA databases (https: / / www.proteinatlas.org / ), and analyzed the expression of miR-223 in HCC using data from the UALCAN public database (https: / / ualcan.path.uab.edu / ).

[0035] We analyzed data from the public databases UALCAN and HPA (https: / / www.proteinatlas.org / ) and found that FOXO3a expression in HCC tissues was significantly increased compared with normal liver tissues ( Figure 1 AB). At the same time, high expression of FOXO3a is closely related to poor prognosis of patients ( Figure 1 C), and FOXO3a expression is further increased in cases with lymph node metastasis ( Figure 1 D). At the same time, data analysis of the UALCAN (https: / / ualcan.path.uab.edu / ) public database showed that the expression of miR-223 in HCC tissues was significantly decreased compared with normal liver tissues ( Figure 1 E).

[0036] Example 2 FOXO3a is a target gene of miR-223 We predicted the candidate targets of miR-223 using the TargetScan (https: / / www.targetscan.org) public database, and the results showed that ( Figure 2 A) miR-223 can target and regulate FOXO3a. We synthesized a 21bp unrelated sequence RNA (NC RNA) and miR-223 mimics in vitro and transfected them into HCC cells. The mRNA and protein levels of FOXO3 were detected by qRT-PCR and WB. Figure 2 BC) showed that the mRNA and protein levels of FOXO3a in HCC cells transfected with miR-223 mimics were significantly decreased compared with those in NC RNA, indicating that miR-223 inhibited the expression of FOXO3a.

[0037] Example 3 Construction of bifunctional RNA oligonucleotide (imm-miR223) 3.1 Design of bifunctional RNA oligonucleotide (imm-miR223) Considering that activation of RIG-I requires the simultaneous presence of a triphosphate group at the 5' end and a stem-loop structure, we designed the loop sequence as a seed sequence for the interaction between miR-223 and FOXO3a ( Figure 3The red sequence in the middle) was used to retain the targeting function of miR-223; the stem region was designed to be a complementary sequence of AGAUAAAAA to form a stem of a certain length, and a triphosphate group was coupled to the 5' end to form a bifunctional RNA oligonucleotide (imm-miR223) ( Figure 3 ), the sequence is 5'-ppp-GGGAGAUAAAAAUGUCAGUUUGCAUUUUUAUCUCCC-3'=SEQ ID NO.1.

[0038] 3.2 In vitro synthesis of imm-miR223 3.2.1 Preparation of DNA template for imm-miR223 transcription In order to efficiently transcribe the RNA oligonucleotide in vitro, Shanghai Bioengineering synthesized two complementary single-stranded DNAs (sense chain Oligo A and antisense chain Oligo B), and added a T7 promoter (TAATACGACTCACTATAGGG) = SEQ ID NO. 2) to the 5' end of the sense DNA chain. The template dsDNA for subsequent transcription of imm-miR223 was obtained through in vitro annealing experiments.

[0039] Table 1 Sequences of Template Oligo A and B The system for annealing two single-stranded DNAs is shown in Table 2 below: Table 2 Annealing reaction system The conditions for annealing two single-stranded DNAs are shown in Table 3 below. Table 3 Annealing reaction system The Template Oligo A and Template Oligo B are annealed to form a double-stranded template DNA for imm-miR223 transcription.

[0040] 3.2.2 Obtaining imm-miR223 by in vitro transcription of dsDNA template The reaction system for in vitro transcription of dsDNA template is shown in Table 4 below.

[0041] Table 4 Reaction system for in vitro transcription of dsDNA template Reaction conditions: 37°C for 16 hours.

[0042] 3.2.3 DNase treatment Add 10-20 U / 20 μL of RNase-free DNase I and mix thoroughly. Incubate at 37°C for 30 minutes.

[0043] 3.2.4 RNA purification Add an equal volume of phenol / chloroform / isoamyl alcohol (25:24:1) to the reaction solution, mix by inversion, and centrifuge at 10,000 rpm at room temperature for 5 minutes. Carefully transfer the supernatant to a new EP tube and add an equal volume of 5 M ammonium acetate (pH 5.6) and 4 volumes of 99.5% ethanol. Mix by inversion and let stand at room temperature for 5 minutes. Centrifuge at 15,000 rpm at room temperature for 10 minutes. Discard the supernatant, add 100 µL of 80% ethanol (freshly prepared immediately) to wash, and centrifuge at 15,000 rpm at room temperature for 5 minutes. Discard the supernatant, air-dry for 15 minutes, and dissolve in RNase-free dH2O.

[0044] 3.2.5 Annealing To obtain the neck-loop secondary structure of the RNA molecule, the RNA was heated and then annealed. The reaction conditions are shown in Table 5 below: Table 5 Reaction conditions Example 4 imm-miR223 has the dual functions of targeting FOXO3a and activating the RIG-I pathway We transfected NC-RNA, imm-miR223, and miR-223 mimics into HCC cells, with NC-RNA and miR-223 mimics serving as negative and positive controls, respectively. Compared with the negative control group, the cytotoxicity assay showed that imm-miR223 significantly reduced the IC50 level of DOX ( Figure 3 A); WB results ( Figure 3 B) showed that imm-miR223 significantly downregulated the protein level of FOXO3a and the LC3-II / LC3-I ratio, and upregulated the protein level of the autophagy substrate p62. Figure 3 C) shows that imm-miR223 significantly reduced the punctate fluorescence accumulation of the autophagy protein LC3 in cells. These experimental results indicate that imm-miR223 can inhibit DOX-induced autophagy by targeting FOXO3a, thereby enhancing the sensitivity of HCC cells to DOX.

[0045] At the same time, to test the ability of imm-miR223 to activate the RIG-I signaling pathway, qRT-PCR was used to detect the expression of RIG-I-related genes. The results showed that compared with the control group, the expression of Ddx58 and RLR downstream effector molecules (including MVAS, RSAD2, IFNB, IRF3, IRF7 and ISG56) in the imm-miR223 transfection group was significantly increased, among which the IFN-stimulated gene ISG56 and the IFN-induced gene RSAD2 increased most significantly ( Figure 4 D). At the same time, ELISA results showed that compared with the control group, the levels of cytokines IFN-β, TNF-α, IL-6, and IL-10 released by HCC cells in the imm-miR223 transfection group were significantly increased, among which IL-6 and IFN-β increased most significantly ( Figure 4 E). The above results indicate that imm-miR223 activates the RIG-I signaling pathway, induces the secretion of cytokines such as type I IFN, and promotes the activation of innate immune response.

[0046] Example 5 Preparation of hepatic stellate cell-derived EVs containing bifunctional imm-miR223 (imm-miR22-EVs) 5.1 Extraction of hepatic stellate cell-derived EVs by ultracentrifugation Collect the hepatic stellate cell culture supernatant and centrifuge at 300g for 10 minutes at 4°C to remove dead cells. Centrifuge the supernatant at 2000g for 20 minutes at 4°C to remove cell debris. Centrifuge the supernatant at 10,000g for 30 minutes at 4°C to remove microvesicles. Centrifuge the supernatant at 100,000g for 90 minutes at 4°C. Discard the supernatant and resuspend the EV pellet in an appropriate amount of PBS. Store at 4°C for short-term storage or -80°C for long-term storage.

[0047] 5.2 Identification of Hepatic Stellate Cell Origin The purified EVs sample solution was adsorbed on a 400 mesh copper grid for 5 minutes. The copper grid was fixed in 2.5% glutaraldehyde for 5 minutes. Rinse with deionized water and stain with 3% ammonium molybdate at pH 7.0 for 90 seconds. Allow to dry naturally (≥30 minutes). TEM was used to observe the morphology, NTA was used to detect the size of EVs particles, and WB was used to detect EVs markers. TEM observed a typical cup-shaped and double-layer membrane structure, which is consistent with the EV morphology ( Figure 5 A). NTA particle size analysis results show that the particle size is mainly concentrated around 150nm, which matches the diameter of EVs ( Figure 5 B). WB results showed that the particles contained EVs positive markers Flot1, CD63 and CD9 molecules, but did not contain EVs negative marker Calnexin ( Figure 5C).

[0048] 5.3 Preparation of bifunctional imm-miR22-EVs Subsequently, we used the EVs-specific transfection reagent Exo-Fect TM Exosome Transfection Kit Imm-miR223 was loaded into LX2 EVs to generate imm-miR223-EVs. The transfection reaction system was prepared in 1.5 ml of EP as shown in Table 6.

[0049] Table 6 Transfection reaction system Mix by inversion three times, incubate at 37°C for 10 minutes, and immediately place on ice. Subsequently, 30 μl of ExoQuickTC was added to further purify the transfected EVs to remove free nucleic acids from unloaded EVs. Inversion was performed six times to mix, and the tube was placed on ice for 30 minutes. Centrifuge at 14,000 rpm at 4°C for 3 minutes, discard the supernatant, and resuspend in 300 μl of PBS to obtain purified bifunctional imm-miR22-EVs for subsequent experiments.

[0050] 5.4 Detection of RNA Molecules Loading Efficiency in EVs In order to monitor the efficiency of RNA molecules loaded into EVs, we used Exo-Fect to transfect FAM-labeled small RNA into LX2 EVs, and first enriched EVs using CD63 antibody-coupled magnetic beads. Pipette 20ul of magnetic beads into the EP tube, add 200ul of separation buffer, and mix thoroughly. Place the EP tube on the magnetic separation stand for 1 minute and discard the supernatant. Add 100ul of EVs (containing FAM fluorescent RNA molecules), place at 4°C for mixing and incubation overnight. Centrifuge briefly, discard the supernatant, and collect the bottom sample. Add 300ul of separation buffer and mix thoroughly. Place the EP tube on the magnetic separation stand for 1 minute and discard the supernatant. Repeat the steps for washing three times. Subsequently, add 300ul of separation buffer and resuspend for flow cytometry analysis. The results show ( Figure 5 D) After loading with Exo-Fect, a homogeneous population of EVs displaying FAM fluorescence was detected.

[0051] Example 6 imm-miR223-EVs reverse DOX resistance by targeting FOXO3a Imm-miR223-EVs were added to the supernatant of HCC cells and incubated for 48 hours. Compared with the negative control group, the results of cytotoxicity experiments showed that the IC50 of DOX in the imm-miR223-EVs treatment group was significantly decreased ( Figure 6 ). WB detection ( Figure 7 A) It was found that FOXO3a and LC3-II / LC3-I ratio were significantly decreased, while p62 protein level was significantly increased in the imm-miR223-EVs treatment group. Figure 7 B) Compared with the control group, the imm-miR223-EVs treatment group significantly inhibited the punctate accumulation of the autophagy protein LC3 fluorescence in cells. These experimental results indicate that imm-miR223-EVs treatment can reverse the resistance of HCC cells to DOX by inhibiting autophagy.

[0052] Example 7 imm-miR223-EVs inhibit HCC proliferation and migration and promote HCC apoptosis We studied the biological behavior of HCC cells after imm-miR223-EVs treatment. The results of the cell clone formation experiment showed that the number of cell clones in the imm-miR223-EVs treatment group was significantly reduced, indicating that imm-miR223-EVs inhibited the proliferation of HCC cells ( Figure 8 A); The results of the cell migration experiment showed that the number of cells that migrated across the membrane in the imm-miR223-EVs treatment group was significantly reduced, indicating that imm-miR223-EVs inhibited the migration ability of HCC cells ( Figure 8 B); Cell apoptosis results showed that the number of apoptotic cells in the imm-miR223-EVs treatment group was significantly increased, indicating that imm-miR223-EV promoted the apoptosis of HCC cells ( Figure 8 C). The above results indicate that imm-miR223-EVs affect the biological behavior of HCC cells.

[0053] Example 8 imm-miR223-EVs activate the RIG-I pathway to enhance immunity To test the ability of imm-miR223-EVs to activate the RIG-I signaling pathway, qRT-PCR was used to detect the expression of RIG-I-related genes. The results showed that compared with the control group, the expression of Ddx58 and RLR downstream effector molecules (including MVAS, RSAD2, IFNB, IRF3, IRF7, and ISG56) in the imm-miR223-EVs treatment group was significantly increased ( Figure 9 ), among which the IFN-stimulated gene ISG56 and the IFN-induced gene RSAD2 increased most significantly. At the same time, ELISA experimental results showed that the levels of cytokines IFN-β, TNF-α, IL-6, and IL-10 released by HCC cells in the imm-miR223-EVs treatment group were significantly increased, among which IL-6 and IFN-β increased most significantly ( Figure 10These results indicate that imm-miR223-EVs activated the RIG-I signaling pathway, promoted the secretion of cytokines such as type I IFN, and promoted the activation of the innate immune response.

[0054] Example 9 imm-miR223 combined with DOX has a significant effect in the treatment of HCC in vivo 9.1 Construction of HCC subcutaneous tumors and experimental plan for EVs treatment The experimental process is as follows Figure 11 As shown: Mouse liver cancer Hepa1-6 cells were expanded and cultured, and the cells were collected and resuspended in PBS for cell counting. The cells were mixed with equal amounts of matrigel and injected into the armpits of C57BL / 6 mice at a volume of 1×10 6 cells. Ten days later, mice were randomly divided into four groups and administered intratumorally: negative control, 4 mg / kg DOX, 4 mg / kg DOX combined with 2.5 mg / kg NC-RNA-loaded EVs, and 4 mg / kg DOX combined with 2.5 mg / kg imm-miR223-loaded EVs. Intratumoral injections were repeated every three days for a total of five times. Tumor size and weight were measured every three days. Three days after the final treatment, mice were sacrificed, and tumors were harvested for subsequent experiments.

[0055] 9.2 imm-miR223-EVs significantly inhibit HCC tumor growth in mice Compared with the Mock group, DOX treatment could inhibit the growth of HCC tumors. When the same amount of DOX was given, imm-miR223-EVs treatment could significantly inhibit the growth of HCC tumors compared with NC-EVs. At the same time, compared with DOX treatment alone, imm-miR223-EVs+DOX treatment significantly inhibited the growth of HCC tumors ( Figure 12 AB). The above experimental results show that compared with conventional DOX treatment, the combined treatment of imm-miR223-EVs and DOX can further inhibit HCC tumor growth and achieve better HCC treatment effect.

[0056] 9.3 imm-miR223-EVs inhibit FOXO3a expression in mouse tumor tissues To analyze the regulation of FOXO3a expression by imm-miR223-EVs in vivo, WB and IHC were performed on HCC tumor tissues. Figure 13A, B) There was no difference in FOXO3a expression between the control and DOX groups. Compared with the NC-EVs+DOX group, FOXO3a expression was significantly downregulated in the imm-miR223-EVs+DOX group after treatment. These results indicate that imm-miR223-EVs inhibit the expression of the cancer-promoting molecule FOXO3a in vivo.

[0057] 9.4 imm-miR223-EVs induce RIG-I pathway activation in mouse tumors To investigate the ability of imm-miR223-EVs to activate the RIG-I pathway and induce innate immune responses in vivo, we compared the expression of RIG-I pathway-related molecules and cytokine secretion in tumor tissues of each group. The results showed that although the DOX group induced some RIG-I activation, the imm-miR223-EVs + DOX group showed a more significant increase in the expression of Ddx58 and RLR downstream effector molecules (including MVAS, RSAD2, IFNB, IRF3, IRF7, and ISG56), among which the IFN-stimulated gene ISG56 and the IFN-induced gene RSAD2 increased most significantly ( Figure 14 At the same time, after imm-miR223-EV+DOX treatment, the levels of related cytokines IFN-β, TNF-α, IL-6, and IL-10 increased more significantly, among which IL-6 and IFN-β increased most significantly ( Figure 15 These results indicate that imm-miR223-EVs effectively activated the RIG-I pathway in vivo, induced the secretion of cytokines such as type I IFN, and promoted the activation of the innate immune response.

[0058] Summary of the embodiments: The embodiment of the present invention systematically verifies the design rationality and therapeutic efficacy of bifunctional RNA. First, bioinformatics analysis is performed to identify the high expression characteristics of FOXO3a in HCC and the low expression status of miR-223 ( Figure 1 ), and confirmed that miR-223 directly targets and inhibits FOXO3a through the seed sequence ( Figure 2 Based on this design, imm-miR223, which has both gene silencing and immune activation functions, was successfully synthesized through in vitro transcription ( Figure 3 Functional experiments showed that imm-miR223 could reduce the IC50 of DOX from 0.375ug / ml to about 0.25ug / ml ( Figure 4 A) and reversed chemoresistance by inhibiting the LC3-II / LC3-I ratio (decreased by 79%). Figure 4BC). At the same time, in terms of RIG-I pathway activation, imm-miR223 significantly upregulated the expression of IFN-stimulated genes ISG56 (increased 79 times) and RSAD2 (increased 460 times), and induced the secretion of cytokines IFN-β (increased 5.6 times) and IL-6 (increased 16 times). Figure 4 DE). Hepatic stellate cell EVs were further used to achieve efficient delivery, and the drug loading efficiency of microbead flow cytometry was over 95% ( Figure 5 D). In vivo experiments confirmed that imm-miR223-EVs combined with DOX reduced the weight of subcutaneous HCC tumors in mice to 20% of the control group ( Figure 12 ), which inhibited FOXO3a protein (decreased by 61%) and activated the RIG-I pathway, significantly inducing the expression of ISG56 (increased by 39 times), RSAD2 (increased by 54 times), and the secretion of cytokines IFN-β (increased by 3.2 times), IL-6 (increased by 8.9 times), etc. ( Figure 13-15 The entire set of examples fully reveals the mechanism of action of "gene regulation-immune activation-drug synergy", laying the foundation for clinical transformation.

[0059] The above are only a limited number of preferred embodiments of the present invention, and their description is relatively specific and detailed, but it should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art may make various modifications and improvements without departing from the scope of the present invention, and such modifications and improvements are within the scope of protection of the present invention.

Claims

1. A bifunctional oligonucleotide RNA, characterized in that The oligonucleotide RNA comprises the following sequence structure: (a) Loop sequence: a sequence extracted from the seed sequence of miR-223 that interacts with FOXO3a. The seed sequence is a sequence that retains the targeting function of miR-223 for FOXO3a. (b) Stem sequence: a sequence complementary to the sequence AGAUAAAAA; (c) A triphosphate group is coupled to the 5' end.

2. The bifunctional oligonucleotide RNA according to claim 1, characterized in that The sequence of the oligonucleotide RNA is: 5'-ppp-GGGAGAUAAAAAUGUCAGUUUGCAUUUUUAUCUCCC-3'=SEQ ID NO.

1.

3. Use of the bifunctional oligonucleotide RNA according to claim 1 or 2 in the preparation of a product having the functions of simultaneously targeting FOXO3a and inducing RIG-I pathway activation.

4. A biological product, characterized in that Contains a nucleic acid delivery vector, wherein the vector carries the oligonucleotide RNA according to claim 1 or 2.

5. Use of the biological product according to claim 4 in the preparation of a medicament for the treatment of hepatocellular carcinoma.

6. The use according to claim 5, characterized in that The drug is a drug that simultaneously inhibits the expression of FOXO3a in hepatocellular carcinoma and activates the RIG-I signaling pathway.

7. The use according to claim 5, characterized in that The drug is a drug that enhances the sensitivity of doxorubicin (DOX) to hepatocellular carcinoma.

8. The biological product according to claim 4, characterized in that The nucleic acid delivery vector is EVs or liposomes.

9. The biological product according to claim 8, characterized in that The EVs are EVs derived from hepatic stellate cells.

10. A pharmaceutical composition for treating hepatocellular carcinoma, characterized in that: The method comprises the biological product as claimed in claim 4 and the chemotherapy drug doxorubicin DOX.

Images