Enhancer regulatory elements for transcriptional regulation of expression of bovine ltf gene and uses

Abstract

The application discloses an enhancer regulatory element for transcriptional regulation and expression of a dairy cow LTF gene and application thereof, and the sequence of the regulatory element is SEQ ID No.1. The technical scheme of the application can accurately regulate the expression of the LTF gene, optimizes mammary gland function, has a wide application prospect, and has important practical value in animal breeding and dairy product production.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of animal molecular genetics and precision breeding technology, and specifically relates to the identification of specific enhancer regulatory elements of lactoferrin (LTF) gene (including eQTL regulatory region at upstream 4660bp, enhancer-1 in downstream 29248bp intron region, and enhancer-2 in 35913bp intergenic region) and its application in genetic improvement of lactation performance of ruminants. BACKGROUND

[0002] Lactoferrin (LTF) is an important functional protein in mammalian milk, and its expression regulation mechanism has always been a research hotspot in the fields of molecular genetics and animal breeding. In the prior art, the research on gene expression regulation mainly focuses on the relationship between sequence variation of the gene itself and gene expression, especially the function of expression quantitative trait loci (eQTLs) and regulatory elements. Many studies have identified regulatory elements and their variations related to gene expression through high-throughput sequencing technologies such as ATAC-seq and RNA-seq, which have been widely used in agriculture, animal breeding, and human disease research. For example, through eQTL analysis and exploration of open chromatin regions, researchers have identified many genetic variations related to the expression of specific genes, revealing the functional differences in gene regulation mechanisms (such as the regulatory elements of LTF gene) between different species.

[0003] However, the existing technology has some limitations:

[0004] (1) Differences in conservation between species: Existing researches mostly focus on the comparison of gene expression regulation within a single species or between species, while the research on the evolutionary conservation of regulatory elements between different species, especially non-model species, is still lacking. Although some studies have analyzed the regulatory network of specific genes through cross-species comparison, most of these studies lack comprehensive and in-depth analysis of gene expression regulation, especially for complex non-coding regions.

[0005] (2) Complexity of gene expression: Gene expression is regulated by multiple factors, including DNA sequence variation, chromatin spatial structure, transcription factor binding, and cell or tissue specificity. Existing technologies often focus on a single aspect of analysis, lacking multi-level and comprehensive integrated analysis, resulting in incomplete understanding of gene expression regulation mechanisms.

[0006] (3) Species-specific factors: Although some studies attempt to compare gene regulation mechanisms across species, species-specific differences still make it difficult to directly translate cross-species research into practical applications. For example, there can be significant differences in gene regulatory elements and transcription factor binding sites between different species, and directly applying research findings from one species to another can lead to inaccurate results.

[0007] Therefore, although some progress has been made in the field of gene expression regulation, there are still limitations in comparing between species, difficulties in verifying the function of regulatory elements, and a lack of comprehensive mechanistic understanding. To address these issues, this study provides a more systematic solution by integrating data from different species, conducting multi-level analysis, and providing functional verification, especially for the in-depth analysis of LTF gene regulatory elements, filling some technical gaps in this field. SUMMARY

[0008] Based on the above reasons, the present application provides an enhancer regulatory element for the transcriptional regulation of the LTF gene in dairy cows and its application. Specifically, to achieve the purpose of the present application, the present application proposes the following technical solutions:

[0009] One aspect of the present application relates to an enhancer regulatory element for the transcriptional regulation of the LTF gene in dairy cows, which has the sequence of SEQ ID No. 1, specifically:

[0010]

[0011] Another aspect of the present application relates to a vector containing the enhancer regulatory element of the transcriptional regulation of the dairy cow LTF gene.

[0012] In a preferred embodiment of the present application, the vector comprises pGL4.17[luc2 / Neo] and pcDNA3.1.

[0013] Another aspect of the present application relates to the use of the enhancer regulatory element of the transcriptional regulation of the dairy cow LTF gene or the above-mentioned vector in improving the expression of the LTF gene.

[0014] In a preferred embodiment of the present application, the improvement of the expression of the LTF gene refers to the improvement of the expression of the LTF gene in dairy cows.

[0015] The beneficial effects of the present application are: the present application reveals the regulation mechanism of LTF gene expression by combining eQTL analysis, ATAC-seq data, cross-species comparison and functional verification experiments. By discovering and verifying the key enhancer regulatory elements upstream and downstream of the LTF gene and their conservation, a new idea and method for future mammary gland-related gene regulation research are provided. In addition, the present application also reveals for the first time the key role of EHF transcription factor in the regulation of LTF gene expression, providing a potential molecular target for the regulation of mammary gland function.

[0016] The technical solution of the present application relates to the regulation mechanism of LTF gene expression, especially by discovering and verifying the key regulatory elements upstream and downstream of the LTF gene and their conservation in different species, an innovative method for regulating the expression of the LTF gene is proposed. The technical solution can optimize the function of mammary gland-related genes by precisely regulating the expression of the LTF gene, which has important application value for animal breeding and dairy production.

[0017] The implementation of the technical solution of the present application can accurately regulate the expression of the LTF gene, optimize the function of the mammary gland, and has a wide application prospect, especially in animal breeding and dairy production. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 ; the construction of the regulatory element vector containing 20 variant sites is shown in the figure. The pGL4.17[luc2 / Neo] is used as the backbone vector, which contains a luciferase gene (luc2) and is one of the most commonly used reporter genes in enhancer experiments. HindIII is used as the enzyme cutting site to insert the enhancer sequence behind the universal strong promoter CMV to evaluate the activity of the enhancer and the enhancer containing the variant site.

[0019] Figure 2: Schematic diagram of the construction of the vector of two conserved enhancer regulatory elements of the LTF gene of ruminants. The common core transcription factor of the two regulatory elements is EHF. First, the specific position of EHF on the two regulatory elements is shown; next, the plasmid vectors of the transcription factor EHF and the two regulatory elements are constructed respectively, the common transcription factor EHF is transfected together with the two regulatory elements respectively to detect the transfection efficiency, and the activities of the two enhancer regulatory elements are detected respectively; and they are named as EHF-enhancer-1, EHF-del-enhancer-1, EHF-enhancer-2, and EHF-del-enhancer-2 respectively.

[0020] Figure 3 : Results of the dual luciferase vector reporter gene experiment of the genetic factors affecting the transcriptional regulation level of the enhancer regulatory element of the specific expression of the LTF gene. The transcriptional regulation activity potential of the enhancer regulatory element is evaluated by using the dual luciferase vector reporter gene detection system in two different cell models (HEK-293T and MAC-T cell lines), and the results show that, compared with the control group, the activity of the reference sequence of the regulatory element is significantly increased, and compared with the reference sequence, the enhancer activity of the mutant sequence is significantly reduced. The above results show that the genetic variation of the regulatory element precisely regulates the expression of the LTF gene by changing the enhancer activity.

[0021] Figure 4 : Results of the dual luciferase vector reporter gene experiment of the expression regulation of the common transcription factor of the LTF gene and the two conserved enhancer regulatory elements in ruminants. In the bovine mammary epithelial cell line (MAC-T), compared with the control group, the enhancer activity of enhancer-1 and enhancer-2 is significantly increased, and after the two regulatory elements are transfected together with EHF, it is found that the activity of the two regulatory elements is significantly increased after the combination with EHF, but the activity of enhancer-1 is significantly higher than that of enhancer-2. DETAILED DESCRIPTION

[0022] In order to further understand the present application, the technical solutions in the embodiments of the present application will be described clearly and completely below in combination with the embodiments of the present application. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all the other embodiments obtained by a person of ordinary skill in the art without creative labor fall within the protection scope of the present application.

[0023] Unless otherwise specified, the reagents involved in the embodiments of the present application are all commercially available and can be purchased through commercial channels.

[0024] (I) Identification of the specific expression regulatory element of the LTF gene

[0025] 1.1 Identification of eQTL sites and enhancer regulatory elements in dairy cows

[0026] The milk of 585 lactating cows was collected to isolate cells for RNA-seq sequencing, and eQTLs were obtained by filling in the second-generation genome filling panel. The ATAC-seq data of 10 cows were measured, aligned, and the open chromatin region was detected, and finally the enhancer and promoter were identified by genome function annotation. 484 eQTL sites were detected in LTF±100KB, and a key regulatory element was identified at 4660bp upstream of the LTF gene (22:52946414-52947911). This region contains 20 eQTL sites (22_52946429_C_A, 22_52946430_C_T, 22_52946468_G_A, 22_52946517_G_A, 22_52946581_G_T, 22_52946587_C_G, 22_52946697_T_A, 22_52946715_T_C, 22_52946852_G_T, 22_52946897_T_C, 22_52947086_T_C, 22_52947103_A_T, 22_52947120_G_C, 22_52947257_A_G, 22_52947372_A_G, 22_52947400_T_G, 22_52947510_A_G, 22_52947610_A_G, 22_52947661_T_A and 22_52947790_C_T), and haplotype clustering analysis found that the 20 sites corresponding to this enhancer regulatory element were highly linked.

[0027] 1.2 Identification of conserved regulatory elements of LTF in ruminants

[0028] RNA and ATAC-seq sequencing were performed on lactating cows, buffaloes, goats, sheep, red deer and human milk, and mouse mammary gland tissue. After data quality control and alignment, the open chromatin region was detected and the enhancer and promoter were identified by genome annotation. Taking the transcription start site of the LTF gene in each species as the starting point, two position-conserved enhancer regulatory elements were identified within ±100KB. Further sequence alignment found that the identity of the two regulatory elements between each species was >98%, and the two regulatory elements interacted with each other, and the expression of the LTF gene was promoted by the binding of the shared transcription factor EHF to the regulatory element.

[0029] (II) Identification of LTF gene expression enhancer regulatory elements

[0030] 2.1 Construction of fluorescence reporter vector of regulatory element

[0031] The sequences 22:52946414-52947911, 22:52981819-52982561 and 22:52988484-5298921 were synthesized respectively based on the whole genome sequence of cow published by the database website NCBI as a standard sequence, and then connected to the vector pGL4.17 (Shanghai Sangon Biological Engineering Co., Ltd.).

[0032] 22:52946414-52947911

[0033]

[0034] 22:52981819-52982561

[0035] TAAGGATCAGGTGGGCTTTTGGCAATGGTTGCAATGGGGCTCAGTCAGTTCCAGAGGTGACCTTGATTCTGAGCCACAGAAGCACACTATCTGCCTGTCTCAGCCAATTGGAAGTTGAAAGTGAATGATACTTAAAAAAAAAAAAAATTGAACATATGCAAGTAAAAGTTTCCCCTTTTTAAAAAGGAAGTAGAAGGCTTCATTCAGCCCCTGTGAACTGTCAGTGGGGAGACTTCTTGGGGAGTGAATGAGGGCAAAATCACAGGCGGATGATCAAGGGAAGATCCACCAGCCAGTAGAGAACTAGCCACTCTCTCTTCTGACCTCTGGTGGAAATAATAATGATAACTTCAAGACTCAGCAGTTTGCTACCTTCTAAACTGCACCTCTGTGCTCACCTCCCATCAGCCTCCCCACCCAGAGGGAACTACCACTTCCTCCCCTGGAGAAGGACCTGCCTCAACTTTCCACCTCCCTCCTTCAGTGACAGCCACAGTCCTAGCCGCTGCTTCCTCAAGTCCCTGGGGAGAGCGACTGAGGCCAGACATGTAAATTTTGGGATGATCTGAGTATCGAATAGACAAAGCCAAGAGGTTGGAGGAAGTATTTTCTTGAGGGGAGAGGACAAAAGGAGAGAAGCAGCT GTGTGACCAGGAAGCCGTATTTGCATACACACAGGCGATTTGCATACACACAGGCGGGCATGCACACAACTGCATTTCGAATTCAGGAACCTTGAATC

[0036] 22:52988484-52989210

[0037] CAGTAGATAACTTAAGTGGAATGAAAGGCCCATGAAATCTCCTTTTCTGGCTGAAATAAAGTTTCAAAGTCTAACATCACTGTATCCATTGATGCTCAGTCACGTCTGACTCTTGTGACTCCATGGACTATAGTCCATGGAATTCTCCAGGCCAGAATACTGGAGTGGGCAGCTTTTCCCTTCTCCAGGGGATCTTCCCAACCCAGGAATCGAACTGAGATCTCCTGCATTGCAGGCAGATTCTTTACCAACTGAGCTATCAGGGCAGCCCCTGTATCCATTAGCTCATGCTAAGTTATATCAACATCCCAGTGCCTTACATAACAAAGCCACATTCATGGGTCATGGGTCACATTCATGCCTGTCGTGAGTCATCAGAGACTCTGTTGTTCATCTCTTTATTCTGAGACCCAGGCTGAACCATCAGCTCCCACCTAGGGAATGTTGGCTTTTAAACAGGGGAAAATAAAAGAGTTGGAGGCATGACACAATAACTCTTAAAGCTTCCTCCTGGGAGAGGCCATATAATTTCCATTATTTCATCACCCCAAAACAAGTCAGGAGGTCATAGCATCACTGTGTGTGTATGGGGGAGGGGTCTTTGGTCTCATATCCTTTCACTCTAACCCTGAATTGAGTGTGAACTCTATTTGGTGTCCCTGGTTTTACTTTCTGAAACCCCCAAGTTCCTTAAAATCTTCTAGGAAAGCTCATGGCCTTGCATTC

[0038] (1) Recombinant enhancer regulatory element fluorescence reporter vector is named as reference type, mutant type respectively, and the construction of fluorescence reporter vector is shown in the schematic diagram as shown in Figure 1 . Figure 1 The schematic diagram of the construction of the regulatory element vector containing 20 variation sites. The pGL4.17[luc2 / Neo] is used as a skeleton vector, which contains a luciferase gene (luc2) and is one of the most commonly used reporter genes in enhancer experiments. HindIII is used as a restriction enzyme site to insert the enhancer sequence behind the universal strong promoter CMV to evaluate the activity of the enhancer and the enhancer containing variation sites.

[0039] (2) The conservative recombination enhancer regulatory element fluorescent reporter vectors are named as EHF-enhancer-1, EHF-del-enhancer-1, EHF-enhancer-2, and EHF-del-enhancer-2, respectively. The schematic diagram of the construction of the fluorescent reporter vector is shown in Figure 2 The schematic diagram of the construction of the two conservative enhancer regulatory element vectors of the ruminant LTF gene is shown. The common core transcription factor of the two regulatory elements is EHF. First, the specific position of EHF on the two regulatory elements is shown; next, the plasmid vectors of the transcription factor EHF and the two regulatory elements are constructed respectively, and the common transcription factor EHF is transfected with the two regulatory elements respectively to detect the transfection efficiency, which are named as EHF-enhancer-1 and EHF-enhancer-2; and the activities of the two enhancer regulatory elements are detected respectively, which are named as EHF-del-enhancer-1 and EHF-del-enhancer-2.

[0040] 2.2 Dual fluorescence detection of regulatory element function

[0041] HEK-293T cells (Shanghai Ss Biotech Co., Ltd.) and bovine mammary epithelial cells MAC-T (Shanghai Ss Biotech Co., Ltd.) were transferred to a 24-well plate at 5 x 10 5 cells per well, and were cultured in DMEM medium (Gibco) containing 10% fetal bovine serum (FBS, Gibco). When the cell confluence reached 70%-80%, the cells were transfected with Lipofectamine TM3000 Transfection Reagent, Thermo Fisher Scientific) for transfection, and the cells were starved with opti-DMEM for 1 h before transfection, and then the complete medium containing 5% serum was replaced before transfection. The amount of plasmid used was 0.4 μg of pGL4.17 plasmid, 0.1 μg of pRL-TK (Renilla luciferase reporter vector, Promega) plasmid, and 0.4 μg of EHF-pcDNA3.1 plasmid per well. The groups were assigned as follows: the control group was transfected with pGL4.17 empty and pRL-TK plasmids; the experimental group-1 reference type was transfected with the plasmid reference sequence and pRL-TK; and the experimental group-2 mutant type was transfected with the plasmid mutant sequence and pRL-TK. For the two identified regulatory elements conserved in Artiodactyla: the first conserved regulatory element (22:52981819-52982561), the groups were assigned as follows: the control group was transfected with pGL4.17 empty and pRL-TK plasmids; experimental group 1: enhancer-1 was transfected with the plasmid enhancer-1 and pRL-TK; and experimental group 2: EHF-enhancer-1 was transfected with the plasmid EHF-enhancer-1, pRL-TK, and EHF-pcDNA3.1. Incubation was performed at room temperature for 10 min, and then the cells were cultured in a 37°C incubator for 8 h before the medium was replaced. The cells were lysed for sampling at 48 h, and the luciferase activity was identified using a dual luciferase reporter assay kit (TransDetect Double-Luciferase Reporter Assay Kit, Beijing Zhenxingjin Biotechnology Co., Ltd.). The experimental results are shown in Figure 3 and Figure 4 Figure 3 In the above-mentioned Figure 4 ​In the present application, two enhancer regulatory elements (enhancer-1 and enhancer-2) conserved in the intron region of 29248 bp (22:52981819-52982561, 742 bp) downstream of the LTF gene and the intergenic region of 35913 bp (22:52988484-52989210, 726 bp) in the Artiodactyla were used for dual luciferase reporter gene experiments on the two conserved regulatory elements and their common core transcription factor EHF. The experimental results showed that the activities of enhancer-1 and enhancer-2 were significantly increased compared with the control group; the activities of LTF-EHF+enhancer-1 and LTF-EHF+enhancer-2 were significantly enhanced compared with LTF-EHF-enhancer-1 and LTF-EHF-enhancer-2. The above results show that the above two enhancer regulatory elements conserved in the Artiodactyla have significant enhancer activity, mediate the interaction of EFH with LTF, and promote the transcriptional regulation of LTF expression.

[0042] The preferred embodiments of the present application are described above, but are not intended to limit the present application. Those skilled in the art can make improvements and changes to the embodiments disclosed herein without departing from the scope and spirit of the present application.

Claims

1. An enhancer regulatory element of transcriptional regulation of cow LTF gene, the sequence of which is SEQ ID No.

1.

2. A vector containing the enhancer regulatory element of transcriptional regulation of cow LTF gene.

3. The vector according to claim 2, wherein the vector comprises pGL4.17[luc2 / Neo] and pcDNA3.

1.

4. Use of the enhancer regulatory element of transcriptional regulation of cow LTF gene according to claim 1 in improving expression of LTF gene, wherein the improving expression of LTF gene refers to improving expression of LTF gene in cows.

5. Use of the vector according to claim 3 in improving expression of LTF gene, wherein the improving expression of LTF gene refers to improving expression of LTF gene in cows.

Images