Pseudomonas aeruginosa bscR gene, BscR protein, its engineered strains and applications

Abstract

This application relates to a species of Pseudomonas aeruginosa. bscR Genes, BscR protein, its engineered strains, and applications. A novel regulatory factor, BscR, was identified in the genome of *Pseudomonas aeruginosa*, which regulates... bscR Genes are used to regulate the virulence of *Pseudomonas aeruginosa*. Regulation in *Pseudomonas aeruginosa* bscR Following gene sequencing, multiple virulence-related modules changed, resulting in enhanced motility but decreased efficiency in biofilm, pyocyanin, and siderophore synthesis. This not only helps elucidate the pathogenic molecular mechanisms of *Pseudomonas aeruginosa*, but the regulatory factor BscR can also serve as a new target for the development of drugs for the prevention and treatment of *P. aeruginosa*, which is of great significance for the prevention and control of *P. aeruginosa* infection.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more particularly to a strain of Pseudomonas aeruginosa. bscR Genes, BscR proteins, their engineered bacteria, and applications. Background Technology

[0002] Pseudomonas aeruginosa is an important opportunistic pathogen that primarily infects immunocompromised or deficient patients, causing bacteremia and urinary tract infections. Specifically, Pseudomonas aeruginosa readily develops drug resistance and exhibits varying degrees of pathogenicity, infectivity, and prevalence, making it a significant source of hospital-acquired infections. In recent years, the resistance rate of Pseudomonas aeruginosa to drugs such as aztreonam, levofloxacin, ciprofloxacin, or trimethoprim-sulfamethoxazole has been increasing annually, and Pseudomonas aeruginosa isolated from patients of different age groups has also demonstrated resistance to various antibiotics.

[0003] Therefore, research and development of anti-Pseudomonas aeruginosa infection control methods is urgently needed for the prevention and control of common multidrug-resistant pathogens in clinical practice. Summary of the Invention

[0004] The technical problem to be solved by this invention is: how to regulate the virulence of Pseudomonas aeruginosa in order to enhance the prevention and control of Pseudomonas aeruginosa infection.

[0005] To solve the above-mentioned technical problems, in a first aspect, the present invention provides a method for treating Pseudomonas aeruginosa. bscR Genes, the ones mentioned bscR The gene includes a nucleotide sequence as shown in SEQ ID No. 1.

[0006] Secondly, the present invention provides a method according to the above description. bscR The application of genes, wherein the application is any one of F1) - F2):

[0007] Application of F1 in regulating the virulence of Pseudomonas aeruginosa;

[0008] The application of F2 in the research and development or preparation of drugs against Pseudomonas aeruginosa infection.

[0009] Furthermore, in the above applications, by knocking out or overexpressing the aforementioned strains of Pseudomonas aeruginosa... bscR Genes enable the application of F1-F2.

[0010] Furthermore, in the above applications, the regulation of Pseudomonas aeruginosa virulence is as follows: positively regulating Pseudomonas aeruginosa biofilm production, pyocyanin production, and siderophore biosynthesis; and / or negatively regulating Pseudomonas aeruginosa motility.

[0011] Thirdly, the present invention also protects a method for regulating the virulence of *Pseudomonas aeruginosa*, by modifying the above-described *Pseudomonas aeruginosa* genome... bscR Genes are knocked out or overexpressed using genetic engineering methods.

[0012] Fourthly, the present invention also protects an engineered strain of *Pseudomonas aeruginosa*, wherein the engineered strain is a knockout strain of the aforementioned strain. bscR Pseudomonas aeruginosa gene or overexpression of the gene described bscR Genetically modified Pseudomonas aeruginosa.

[0013] Fifthly, the present invention also protects a method for preparing engineered bacteria according to the above-described method, using the M1 method to prepare knockout bacteria. bscR Pseudomonas aeruginosa gene, or, using the M2 method to prepare overexpression bscR Genes of Pseudomonas aeruginosa, including:

[0014] The M1 method includes the following steps: using gene knockout technology to remove *Pseudomonas aeruginosa*... bscR Gene knockout, resulting in knockout bscR Pseudomonas aeruginosa with genetic defects;

[0015] The M2 method includes the following steps: [The text abruptly ends here, likely due to an incomplete sentence or a missing section bscR The gene expression vector was transformed into Pseudomonas aeruginosa, resulting in overexpression. bscR Genetically modified Pseudomonas aeruginosa.

[0016] Sixthly, the present invention also protects a BscR protein, as described above. bscR The BscR protein is encoded by a gene, and its amino acid sequence is shown in SEQ ID No. 2.

[0017] Seventhly, the present invention also protects an application of the BscR protein described above, wherein the application is any one of P1)-P2):

[0018] P1) Application in regulating the virulence of Pseudomonas aeruginosa;

[0019] The application of P2 in the research and development or preparation of drugs against Pseudomonas aeruginosa infection.

[0020] Eighthly, the present invention also protects a drug for treating Pseudomonas aeruginosa infection, the drug targeting the aforementioned... bscR Gene or the stated bscR The gene-encoded BscR protein.

[0021] Technical effects of the present invention:

[0022] This invention is the first to identify a novel regulatory factor, BscR, in the genome of *Pseudomonas aeruginosa*, which regulates...bscR Genes provide an effective pathway for regulating the virulence of *Pseudomonas aeruginosa*. Specifically, this involves regulating... bscR Following gene mutation, multiple modules related to virulence underwent changes, resulting in enhanced motility but decreased efficiency in biofilm, pyocyanin, and siderophore synthesis. This not only helps elucidate the pathogenic molecular mechanisms of *Pseudomonas aeruginosa*, but the regulatory factor BscR can also serve as a new target for the development of drugs for the prevention and treatment of *P. aeruginosa*, which is of great significance for the prevention and control of *P. aeruginosa* infection.

[0023] Other features and aspects of this disclosure will become clear from the following detailed description of exemplary embodiments with reference to the accompanying drawings. Attached Figure Description

[0024] The accompanying drawings, which are included in and form part of this specification, illustrate exemplary embodiments, features, and aspects of this disclosure together with the specification and serve to explain the principles of this disclosure.

[0025] Figure 1 The illustration provided for the embodiments of the present invention bscR Schematic diagram showing the effect of gene knockout on bacterial biofilm;

[0026] Figure 2 The illustration provided for the embodiments of the present invention bscR Schematic diagram showing the effect of gene knockout on bacterial motility; Figure 2 In the diagram, A: Swarming motility and Swimming motility plate diffusion images of the test strain, with motility characterized by the diffusion diameter at the colony edge; B: The average colony migration diameter calculated from three independent biological replicates of the Swarming motility in A; C: The average colony migration diameter calculated from three independent biological replicates of the Swimming motility in A; EV represents an empty plasmid.

[0027] Figure 3 The illustration provided for the embodiments of the present invention bscR Schematic diagram showing the effect of gene knockout on flagellar synthesis; Figure 3 A: WT (wild type) and overexpression bscR WT of genes (WT( bscR A) Comparison of flagellar transmission electron microscopy observation results from A; B) Quantitative statistical analysis of flagellar length based on 11 samples from A; C) WT, Δ bscR Knockout strains and complements Δ bscR ( bscR qRT-PCR results of expression levels of flagella synthesis-related genes in the plasmid; EV represents an empty plasmid;

[0028] Figure 4The illustration provided for the embodiments of the present invention bscR Schematic diagram showing the effect of gene knockout on pyocyanin; Figure 4 In the diagram, A: Results of pyocyanin production measurement and color changes in the culture medium of the tested strain; B: Genes related to pyocyanin synthesis (…). phzA1 , phzB1 , phzC1 Expression level determination of ); EV represents empty plasmid;

[0029] Figure 5 The figures WT and Δ provided for embodiments of the present invention are shown. bscR A schematic diagram of transcriptome analysis of the knockout strain; Figure 5 In the middle, A: Δ bscR Volcano plot of differentially expressed genes between knockout strains and WT, highlighting the expression differences of functional genes related to siderophore synthesis, flagellar formation, biofilm formation, and pyocyanin biosynthesis; Legend: Up indicates upregulation; Down indicates downregulation; NS indicates no significant difference; B: GO functional enrichment analysis of differentially expressed genes;

[0030] Figure 6 The illustration provided for the embodiments of the present invention bscR Schematic diagram illustrating the effect of gene knockout on siderophores; Figure 6 In the middle, A: RT-qPCR analysis of WT and Δ bscR Knockout strains and complements Δ bscR ( bscR A: Expression levels of PVD synthesis genes in WT and Δ; B: RT-qPCR analysis of WT and Δ bscR Knockout strains and complements Δ bscR ( bscR Expression levels of PCH synthesis genes in ) ; C: Dynamic measurement of WT, Δ bscR Knockout strains and complements Δ bscR ( bscR PVD yield in (); EV represents empty plasmid;

[0031] Figure 7 The diagram shows the microscopic imaging and statistical analysis of the BscR protein localization at the cell poles, as provided in an embodiment of the present invention. Figure 7 In the image, A: Confocal fluorescence microscopy image of the GFP and BscR-GFP fusion protein in the cell (magnification ×100), where the green fluorescent label shows the localization characteristics of the BscR protein at the cell poles; B: Bar chart of pole distribution ratio obtained after statistical analysis of 100 cells.

[0032] Figure 8 This diagram illustrates how BscR, as provided in an embodiment of the present invention, regulates biofilm and swimming motility through cell-level localization. Figure 8In the image, A: Subcellular localization of the BscR-GFP fusion protein detected by laser scanning confocal microscopy; B: Biofilm yield determination of the test strain; C: Swimming motility plate diffusion image of the test strain; D: Average colony migration diameter calculated from three independent biological replicates based on the Swimming motility in C; EV represents an empty plasmid. Detailed Implementation

[0033] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0034] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0035] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0036] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This application specification and embodiments are merely exemplary.

[0037] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0038] The pathogenicity of *Pseudomonas aeruginosa* is highly dependent on the dynamic synergy of its virulence factors, with biofilm and motility playing a central role in the infection process. On one hand, the biofilm, composed of polysaccharides such as Psl, Pel, and alginate, extracellular DNA, and proteins, forms a three-dimensional protective matrix that helps bacteria adhere to host tissues or medical device surfaces. This structure not only acts as a physical barrier to hinder antibiotic penetration, such as reducing the effectiveness of β-lactam antibiotics, but also suppresses host immune defenses, such as blocking macrophage phagocytosis, becoming crucial for persistent colonization, especially in chronic infections such as those in the lungs of patients with cystic fibrosis. Biofilm formation is precisely regulated by the quorum sensing system and the c-di-GMP signaling pathway. High c-di-GMP levels promote polysaccharide synthesis and biofilm stability, while low levels trigger bacterial dispersal, leading to disseminated infection. On the other hand, motility is mediated by both flagella and type IV pili. Flagella-driven chemotactic movement helps bacteria break through the host's mucus layer and colonize damaged tissue, while simultaneously activating the TLR5 pathway and triggering excessive inflammation. Type IV pili enhance surface adhesion efficiency through "twitching movements" and participate in the early construction of biofilm structures. There is a dynamic balance between motility and biofilm formation, specifically, high motility is usually associated with acute infection, while biofilm formation marks the establishment of chronic infection.

[0039] As a common multidrug-resistant pathogen, the complexity of the virulence regulatory network of Pseudomonas aeruginosa severely restricts the effectiveness of traditional antibacterial therapies.

[0040] In view of this, the first aspect of the present invention provides a *Pseudomonas aeruginosa* strain. bscR Gene, bscR The gene includes a nucleotide sequence as shown in SEQ ID No. 1.

[0041] This invention, through research on Pseudomonas aeruginosa, has for the first time identified a regulatory factor, BscR, in the genome of Pseudomonas aeruginosa, providing an effective pathway for regulating the virulence of Pseudomonas aeruginosa.

[0042] The above bscR The coding region of the gene is 510 base pairs long, as detailed below:

[0043] ATGGCAATCAACCTGAAAGAAATCCTCGCCATGAACAAACTCGACCGCTACGACCTGGCT60

[0044] ATCCTCGAAGAACTCCAGCGCGACGCACGCATCTCCAACCAGGAACTGGCAGAACGGATA 120

[0045] GGCCTGTCGCCATCGCCCTGTTCGCGACGGGTCAAGCAGCTCGAGGACGACGGCTACATC180

[0046] GTCCGCCAGGTAGCCTTGCTGGACCGCAAGAAGCTCGGCCTGAGCCTCACCGCCTTCGTC240

[0047] CTCATAGGCATGGACCGACACACCCCGGAACGCTTCGAACATTTTCAGGAAGTCATCGGC300

[0048] AAATGCCCGGAAGTGCTGGAGTGCAGCCTGGTCACCGGGATGGACGCGGACTACCAGTTG 360

[0049] AAGGTCTGGTGCCGGACATGGACCATTACCAGAAACTCCTGCTGGGTACCCTGACGCGC420

[0050] ATCGAGGGGGTCTCCAGCGTGCGCTCCAGCTTCGTCCTCAACCAGGTGCTGGCGAGTACC480

[0051] GAACTGCCGCTGGAGCACCTGCGCGATTGA510 (SEQ ID No. 1)

[0052] Secondly, the present invention provides the above-mentioned bscR The application of genes can be any one of F1-F2:

[0053] Application of F1 in regulating the virulence of Pseudomonas aeruginosa;

[0054] The application of F2 in the research and development or preparation of drugs against Pseudomonas aeruginosa infection.

[0055] Furthermore, in the above applications, by knocking out or overexpressing the aforementioned strains of Pseudomonas aeruginosa... bscR Genes enable the application of F1-F2.

[0056] Specifically, in the above applications, the knocked-out or overexpressed sequences are all as shown in SEQ ID No. 1. bscR Gene sequence.

[0057] Furthermore, in the above applications, the regulation of Pseudomonas aeruginosa virulence is as follows: positively regulating Pseudomonas aeruginosa biofilm production, pyocyanin production, and siderophore biosynthesis; and / or negatively regulating Pseudomonas aeruginosa motility.

[0058] Among the above applications, the use in regulating the virulence of Pseudomonas aeruginosa includes:

[0059] Applications in regulating biofilm formation in Pseudomonas aeruginosa; applications in regulating the motility of Pseudomonas aeruginosa; applications in regulating the production of pyocyanin in Pseudomonas aeruginosa; applications in regulating the siderophores of Pseudomonas aeruginosa.

[0060] That is, in bscR In the process of gene regulation of Pseudomonas aeruginosa virulence, the regulation of virulence is manifested in multiple virulence modules, including inhibition of bacterial biofilm formation, pyocyanin, and siderophore synthesis. Knockout strains exhibit changes in biofilm formation, motility, pyocyanin, and siderophore synthesis. Specifically, they positively regulate Pseudomonas aeruginosa biofilm production, pyocyanin production, and siderophore biosynthesis; and / or negatively regulate Pseudomonas aeruginosa motility. That is, compared to wild-type strains, knockout strains show reduced biofilm production, increased motility, impaired pyocyanin synthesis, reduced pyocyanin production, and significantly reduced siderophore synthesis.

[0061] Thirdly, the present invention also protects a method for regulating the virulence of *Pseudomonas aeruginosa*, by modifying the above-described *Pseudomonas aeruginosa* genome... bscR Genes are knocked out or overexpressed using genetic engineering methods.

[0062] Fourthly, the present invention also protects an engineered strain of *Pseudomonas aeruginosa*, wherein the engineered strain is a knockout strain of the aforementioned strain. bscR Pseudomonas aeruginosa gene or overexpression of the gene described bscR Genetically modified Pseudomonas aeruginosa.

[0063] This invention utilizes Pseudomonas aeruginosa... bscR Gene knockout or overexpression yielded engineered Pseudomonas aeruginosa, whose virulence was effectively suppressed.

[0064] Fifthly, the present invention also protects a method for preparing engineered bacteria according to the above-described method, using the M1 method to prepare knockout bacteria. bscR Genes from *Pseudomonas aeruginosa*, or, using the M2 method, were prepared to overexpress the gene. bscR Genes of Pseudomonas aeruginosa, including:

[0065] The M1 method includes the following steps: using gene knockout technology to remove *Pseudomonas aeruginosa*... bscR Gene knockout, resulting in knockout bscR Pseudomonas aeruginosa with genetic defects;

[0066] The M2 method includes the following steps: [The text abruptly ends here, likely due to an incomplete sentence or a missing section bscR The gene expression vector was transformed into Pseudomonas aeruginosa, resulting in overexpression. bscR Genetically modified Pseudomonas aeruginosa.

[0067] In the above preparation method, knockout or overexpression is performed using genetic engineering methods. bscR Gene-engineered bacteria are prepared, and the genetic engineering method is preferably homologous recombination, more preferably homologous double crossover recombination.

[0068] Specifically, the above preparation method includes M1 or M2).

[0069] M1 gene knockout: Using the Pseudomonas aeruginosa genome as a template, primer pairs UF and UR were used for amplification. bscR The upstream homologous arm of the gene was amplified using primer pairs NF and NR; the upstream and downstream fragments were fused by overlap PCR, and the resulting fragments were introduced into the host bacteria via electroporation. Sucrose sensitivity screening and PCR verification were then performed to obtain the desired gene. bscR Gene knockout mutants without scarring;

[0070] M2 gene overexpression: Amplification was performed using primer pairs OEF and OER. bscR The full-length gene sequence was cloned into an expression vector and then transformed into a host bacterium to obtain... bscR Overexpression strains;

[0071] The sequences of primers UF, UR, NF, NR, OEF, and OER are shown in SEQ ID No. 3-8, as follows:

[0072] Primer UF: gagctcggtacccggggatccTCGGCCTGCGCCTGGACG (SEQ ID No. 3);

[0073] Primer UR: ctacgaCGGCAAGGTGAATTTGAGTGA (SEQ ID No. 4);

[0074] Primer NF: aattcaccttgccgTCGTAGCGAGACCTGGGACA (SEQ ID No. 5);

[0075] Primer NR: acgacggccagtgccaagcttTGTTCTAGGCAATGGCAAGGC (SEQ ID No. 6);

[0076] Primer OEF: gagctcggtacccggggatccGCGGGCAAAGAAAAAGGG (SEQ ID No. 7);

[0077] Primer OER: acgacggccagtgccaagcttTATACGGCATGCCGCCTG (SEQ ID No. 8).

[0078] Sixthly, the present invention also protects a BscR protein, which is derived from the above... bscR The amino acid sequence of the BscR protein, encoded by a gene, is shown in SEQ ID No. 2.

[0079] It should be noted that the BscR protein is composed of... bscR Genetically encoded bscR The nucleotide sequence of the gene is shown in SEQ ID No. 1, and the amino acid sequence of the BscR protein is shown in SEQ ID No. 2. The protein consists of 169 amino acids, has a molecular weight of 19.29 kDa, and a theoretical isoelectric point of 5.70. The specific amino acid sequences are as follows:

[0080] MAINLKEILA MNKLDRYDLR ILEELQRDAR ISNQELAERI GLSPSPCSRR VKQLEDDGYIVRQVALLDRK KLGLSLTAFV LIGMDRHTPE RFEHFQEVIG KCPEVLECSL VTGMDADYQL

[0081] KVVVPDMDHY QKLLLGTLTR IEGVSSVRSS FVLNQVLAST ELPLEHLRD (SEQ ID No. 2).

[0082] Seventhly, the present invention also protects an application of the above-mentioned BscR protein, wherein the application is any one of P1)-P2):

[0083] P1) Application in regulating the virulence of Pseudomonas aeruginosa;

[0084] The application of P2 in the research and development or preparation of drugs against Pseudomonas aeruginosa infection.

[0085] Eighthly, the present invention also protects a drug for treating Pseudomonas aeruginosa infection, the drug's target being the aforementioned... bscR Gene or bscR The gene-encoded BscR protein.

[0086] This invention is based on bscR Understanding the molecular mechanisms by which gene integration regulates multiple virulence modules, including biofilm formation, motility, pyocyanin, and siderophores, drives bacterial infection processes is crucial for the prevention and control of Pseudomonas aeruginosa infections. Among these, constructing a gene through scarless gene knockout technology... bscRAfter gene deletion, the biofilm formation ability, pyocyanin synthesis level, and iron uptake capacity of the strain were significantly reduced compared to the wild-type strain, while bacterial motility was enhanced. Further research showed that the BscR protein is specifically located at the bacterial cell pole, and its regulatory role in biofilm formation and swimming motility depends on this subcellular localization. In other words, this invention provides a specific molecular target for developing novel antibacterial drugs targeting virulence pathways, and particularly offers a solution for the clinical prevention and treatment of persistent biofilm-related infections of *Pseudomonas aeruginosa*.

[0087] The present invention will be further illustrated by the following embodiments. Unless otherwise specified, the experimental methods in the following embodiments are conventional methods, performed according to the techniques or conditions described in the literature in the field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following embodiments are commercially available.

[0088] Example 1 Knockout bscR Detection of the effect of genes on bacterial biofilm production

[0089] Obtain the wild-type (WT) strain cultured overnight using fresh LB broth. bscR Gene knockout strains (Δ bscR ) and its complement Δ bscR ( bscR The sample was diluted until its absorbance (OD600) at a wavelength of 600 nm reached 0.002; specifically, the compensator construction process in this embodiment involves: diluting the full-length sample... bscR The gene was cloned into the pUCP20 vector, and the complement plasmid was transformed into Δ after triparental conjugation. bscR The mutant strain was verified by resistance screening (carbenicillin, 100 μg / mL) and DNA sequencing to confirm the successful construction of complement.

[0090] Subsequently, 120 μl of the diluted bacterial culture was transferred to a 96-well plate and incubated at 37°C for 8 hours. After incubation, the culture medium was carefully removed, and the 96-well plate was gently rinsed with sterile water to remove any unattached bacteria. Then, 200 μl of 0.1% crystal violet solution was added to the biofilm cells attached to the inner wall of the plate, and staining was performed at room temperature for 15 minutes. After staining, the plate was rinsed again with sterile water to remove any unbound dye. After the plate air-dried, 200 μl of 95% ethanol was added to each well to dissolve the biofilm. Finally, the absorbance of each solution was measured at 570 nm.

[0091] like Figure 1As shown, the experimental results indicate that after culturing the test strain in a 96-well plate for 8 hours, compared with the WT strain, Δ bscR The knockout strain exhibited a 40.6% reduction in biofilm production. (In WT and Δ) bscR Heterologous overexpression in strains bscR The gene increased biofilm production by 64.3% and 176.3%, respectively, indicating that BscR has a positive regulatory effect on biofilm formation.

[0092] Example 2 Knockout bscR Detection of the influence of genes on bacterial motility

[0093] Overnight cultured WT strain, Δ bscR Knockout strains and complements Δ bscR ( bscR Dilute with fresh LB broth to an OD600 of 1.0, and use a sterile sampling needle to aspirate 1 μL of bacterial suspension, then inoculate it onto two different motility testing plates:

[0094] (1) Swarming exercise plate (composition: 8 g / L nutrient broth, 5 g / L D-glucose, 5 g / L Bacto agar).

[0095] (2) Swimming exercise plate (composition: 5 g / L Bacto peptone, 3 g / L Bacto yeast extract, 2.5 g / L Bacto agar).

[0096] After inoculation, the plates were placed in a 37 ℃ constant temperature incubator and incubated for 14 hours. The migration ability of the strain was quantitatively analyzed by measuring the diffusion diameter at the edge of the colony (three biological replicates).

[0097] like Figure 2 As shown, the experimental results indicate that Δ bscR The swarming and swimming migration diameters of the knockout strains were significantly increased by 29.6% and 33.7% respectively compared to the WT strain, indicating that BscR deletion leads to enhanced bacterial motility. It should be noted that in WT and Δ... bscR Overexpression in knockout strains bscR The gene can further suppress the motility phenotype, with its swarming and swimming diameters decreasing by 71.3% and 93.6% respectively compared to the control group, demonstrating that BscR has a negative regulatory effect on swarming and swimming motility.

[0098] Example 3 bscR Regulation of bacterial flagella assembly by genes

[0099] Based on the differences in Swimming motility phenotypes in Example 2, this example further analyzes the regulatory mechanism of BscR on flagella assembly, selecting WT strains and bscR overexpression strain WT( bscR Transmission electron microscopy was performed. After culturing the two strains to OD600 = 1.0, the bacterial cells were collected by centrifugation (4,000 rpm, 4 ℃, 5 min), washed three times with PBS buffer (pH 7.4), and resuspended to a final concentration of 1×10⁵ CFU / mL.

[0100] 10 μL of bacterial suspension was dropped onto a 300-mesh copper grid coated with a carbon membrane. After standing for 5 min for adsorption, it was negatively stained with 2% phosphotungstic acid (pH 7.4) for 20 min. After natural drying, the flagella structure was observed under a transmission electron microscope. Simultaneously, WT and Δ... bscR Knockout strains and complements Δ bscR ( bscR Total RNA was extracted from the samples and then reverse-engineered into cDNA. Real-time quantitative PCR (RT-qPCR) was used to detect flagellar synthesis-related genes in the three samples. flgB , flgF , fliA , fliC , fliD , fliE , fliG , fliM , fliK The transcriptional level of ).

[0101] like Figure 3 As shown, transmission electron microscopy analysis revealed that overexpression bscR The average flagella length of the WT strain was significantly shorter than that of the WT strain (WT: 5.62 ± 0.65 μm vs WT). bscR (4.30 ± 0.36 μm) Figure 3 (AB in the text). RT-qPCR results showed that Δ bscR In the knockout strains, the mRNA expression levels of nine flagella synthesis-related genes were upregulated by 45%-82% compared to WT, while the complement Δ bscR ( bscR The gene expression level of ) was restored to WT level. Figure 3 (C in the text). The above data confirm that BscR negatively regulates bacterial flagella assembly and motility phenotype by inhibiting the transcription of flagella synthesis genes.

[0102] Example 4 Knockout bscR Effects of genes on bacterial pyocyanin production

[0103] WT strains in the logarithmic growth phase (OD600 = 1.0) and Δ bscRKnockout strains and complements Δ bscR ( bscR The bacterial culture was inoculated into 3 mL of fresh LB liquid medium and incubated at 37 ℃ with shaking at 200 rpm for 16 hours. After centrifugation, the supernatant was collected and residual bacteria were removed through a 0.22 μm sterile filter membrane. The pyocyanin content was determined spectrophotometrically: 200 μL of the filtered supernatant was added to a 96-well plate, and the absorbance (A695) was measured at 695 nm using a microplate reader. The A695 value characterized the relative yield of pyocyanin. Then, WT and ΔP were detected by RT-qPCR. bscR Knockout strains and complements Δ bscR ( bscR Genes related to Pseudomonas aeruginosa synthesis in ) phzA1 , phzB1 , phzC1 The amount of expression of ).

[0104] like Figure 4 As shown, phenotypic observation revealed that the WT strain culture medium exhibited a typical blue-green characteristic, while Δ bscR The color of the culture medium of the knockout strain became significantly lighter. Figure 4 The result (A) indicates impaired pyocyanin synthesis. Quantitative analysis confirmed that Δ bscR The A695 value of the plant was 45.5% lower than that of the WT, while the complement Δ bscR ( bscR The pyocyanin production of Δ recovered to baseline WT. RT-qPCR analysis showed that Δ bscR The core gene for pyophyll synthesis in the knockout strain phzA1 , phzB1 , phzC1 ( Belonging to phzA1 - phzG1 The mRNA expression levels of the operon were downregulated by 34%, 30%, and 36% respectively compared to the WT level; while the expression levels of the three operons in the complement were restored to the WT level. Figure 4 (B in the text). The above results indicate that BscR positively regulates the biosynthesis of pyocyanin by directly or indirectly regulating phenazine metabolic pathways.

[0105] Example 5: Effects of BscR on Multiple Cellular Metabolic Pathways

[0106] To comprehensively investigate the regulatory role of BscR in Pseudomonas aeruginosa, this example uses the Illumina platform to study the WT and Δ of Pseudomonas aeruginosa. bscR Knockout strains underwent whole transcriptome sequencing (RNA-Seq). Significantly differentially expressed genes were screened using DESeq2 analysis (|log2FC|≥1, padj<0.05), and functional enrichment analysis of these differentially expressed genes was performed using GOATOOLS (GOterm, P<0.01).

[0107] like Figure 5 As shown, transcriptome analysis identified a total of 174 differentially expressed genes (Δ). bscR vs WT, of which 95 genes were upregulated and 79 genes were downregulated ( Figure 5 A in the text). GO enrichment analysis showed that differentially expressed genes were associated with a range of biological functions, such as iron response, iron uptake, and iron regulation. Figure 5 (B in the text). It should be noted that the differentially expressed genes include those related to biofilm, flagella, and pyocyanin synthesis, which correspond to the phenotypes of decreased biofilm formation ability, increased flagella length, and decreased pyocyanin synthesis ability in Examples 1, 3, and 4.

[0108] Example 6 Knockout bscR Effects of genes on siderophore synthesis

[0109] Based on transcriptome sequencing RNA-Seq and RT-qPCR validation, Δ was found bscR Siderophore synthesis gene in knockout strains ( pvdA , pvdE , pvdG , pvdS , pchA , pchB , pchE , pchR The mRNA expression level of ) was significantly downregulated by 1.75-2.13 times compared to WT, such as Figure 6 AB is shown in the diagram. *Pseudomonas aeruginosa* responds to host iron limitation pressure by secreting high-affinity siderophores Pyoverdine (PVD) and Pyochelin (PCH) and relying on TonB to transport iron into the cell. To quantitatively assess the effect of BscR on siderophore synthesis, PVD production was dynamically monitored using fluorescence spectrophotometry: WT, Δ... bscR and complement Δ bscR ( bscR Inoculated into iron-deficient medium and incubated at 37 °C, the fluorescence intensity was measured every 2 hours at an excitation wavelength of 400 nm and an emission wavelength of 460 nm.

[0110] like Figure 6 As shown, dynamic monitoring results indicate that the WT strain reached its peak PVD yield after 22 hours of cultivation. At this point, compared to WT, Δ bscR The knockout strain showed a significant reduction in PVD production, and the complement Δ bscR ( bscR PVD yield is higher than WT, such as Figure 6 The value of C is shown in the figure. These results indicate that BscR inhibits bacterial siderophore-mediated iron uptake by negatively regulating the expression of PVD / PCH synthesis genes.

[0111] Example 7: BscR localized at the cell pole

[0112] To elucidate the subcellular localization characteristics of BscR, this embodiment constructed a BscR-GFP fusion expression system with a C-terminus fused to green fluorescent protein (GFP). The expression plasmid pUCP20 carrying the BscR-GFP fusion gene was transformed into WT strain and Δ strain, respectively. bscR Knockout strains were created, and an empty GFP control plasmid was also included. The experimental strains were cultured in LB medium to the logarithmic growth phase (OD600 = 0.6), and the distribution of fluorescence signals was observed using a laser confocal microscope (Leica LSM 900).

[0113] like Figure 7 As shown, laser confocal microscopy imaging revealed that, in the control group: empty GFP was present in WT and Δ bscR The knockout strains all exhibited a uniform cytoplasmic distribution characteristic, such as Figure 7 As shown in Figure A; Experimental group: The BscR-GFP fusion protein exhibited a significant polar localization pattern in both genetic backgrounds, specifically: WT strain: 35% of the bacteria showed unipolar aggregation, and 62.0% showed bipolar distribution (n = 100); Δ bscR Knockout strains: 28.0% unipolar aggregation, 67.0% bipolar distribution (n = 100), such as Figure 7 B is shown in the figure.

[0114] Example 8: The modulatory function of BscR depends on its polar location.

[0115] BscR interaction protein encoding genes pipA and its key binding site mutants pipA E280A,N328A,E419A Cloned into expression vector pUCP20, transformed into complement Δ bscR ( bscR ) and WT bscR ) strain, to obtain engineered bacteria Δ bscR ( pipA , bscR ), Δ bscR ( pipA E280A,N328A,E419A , bscR ), PAO1 ( pipA , bscR ) and PAO1 ( pipA E280A,N328A,E419A , bscR The distribution of BscR within cells was observed using laser confocal microscopy. Bacterial biofilm production was determined by crystal violet staining; bacterial swimming motility was determined using the soft agar plate method.

[0116] like Figure 8 As shown, the confocal microscopy imaging results indicate that: PAO1 ( pipA , bscR In strain BscR-GFP, the fluorescence signal changed from a polar distribution (control group) to a cytoplasmic diffuse pattern, while in strain PAO1 ( pipA E280A,N328A,E419A , bscR In strains, BscR maintains polar localization, such as Figure 8 A is shown in the diagram. Δ bscR ( pipA , bscR The biofilm production of strain ) was higher than that of Δ bscR ( bscR ) decreased by 44.9%, while Δ bscR ( pipA E280A,N328A,E419A , bscR Biofilm production and Δ bscR ( bscR No significant difference, such as Figure 8 B is shown in the diagram. In contrast to Δ bscR ( bscR ), Δ bscR ( pipA , bscR The motility of the strain increased by 318%, while Δ bscR ( pipA E280A,N328A,E419A , bscR The motility of the strain did not change significantly, such as Figure 8 The CD is shown in the figure. The above results indicate that BscR regulates biofilm and swimming motility in a way that depends on its intracellular polar localization.

[0117] Therefore, this invention provides a novel toxicity regulator. bscR Genes and their application in anti-infective therapy. Addressing the technical challenges of the complex virulence regulatory network of *Pseudomonas aeruginosa* and the limited efficacy of existing antibacterial targets, this study utilizes targeted regulation... bscR The gene or its encoded product, the BscR protein, simultaneously inhibits key pathogenic pathways such as bacterial biofilm formation, motility, and pyocyanin synthesis, providing a new strategy for developing multi-effect synergistic antimicrobial drugs.

[0118] This invention is the first to identify a regulatory factor, BscR, in the genome of *Pseudomonas aeruginosa*, and constructs a gene knockout system using a scarless gene knockout technique. bscRPhenotypic analysis of the gene-deleted mutant strain showed that, compared with the wild-type strain, the biofilm formation ability of the mutant strain was significantly reduced, by 40.6%, while the motility phenotype was significantly enhanced, with swarming and swimming increasing by 29.6% and 33.7%, respectively. Transmission electron microscopy combined with real-time quantitative PCR analysis confirmed that BscR affects bacterial flagella assembly and the expression of flagella-related genes. Furthermore, studies showed that BscR also participates in regulating the synthesis of siderophores (Pyoverdine and Pyochelin), leading to a significant limitation in bacterial iron uptake efficiency. This invention reveals for the first time the molecular mechanism by which BscR drives the bacterial infection process by integrating and adjusting multiple virulence modules such as biofilm formation, motility, iron metabolism, and pyocyanin. Based on this, targeted inhibition of BscR protein function can simultaneously weaken bacterial environmental adaptability, immune escape ability, and nutrient acquisition efficiency, providing a specific molecular target for the development of novel antimicrobial drugs with synergistic antibiofilm and antiviral effects, which is of great significance for the prevention and control of acquired Pseudomonas aeruginosa infection.

[0119] In the description of this specification, references to terms such as "an embodiment," "example," "specific example," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the invention. In this specification, illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples.

[0120] Unless otherwise defined, the technical or scientific terms used in this application shall have the ordinary meaning understood by one of ordinary skill in the art to which this application pertains. The terms "a," "an," "the," and similar words used in this application do not indicate quantity limitation and may indicate singular or plural. The terms "comprising," "including," "having," and any variations thereof used in this application are intended to cover non-exclusive inclusion. The terms "connected," "linked," "coupled," and similar words used in this application are not limited to physical or mechanical connections but include electrical connections, whether direct or indirect. The term "multiple" used in this application refers to two or more, and "and / or" describes the relationship between related objects, indicating that three relationships may exist. The character " / " generally indicates that the preceding and following related objects are in an "or" relationship. The terms "first," "second," "third," etc. used in this application are merely to distinguish similar objects and do not represent a specific ordering of objects.

[0121] The above embodiments merely illustrate several implementation methods of this application, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications or improvements without departing from the concept of this application, and these all fall within the protection scope of this application. Therefore, the protection scope of this patent application should be determined by the appended claims.

Claims

1. A knockout Pseudomonas aeruginosa bscR The application of genes is characterized by, The application is any one of F1)-F4): F1) Application in reducing the biofilm production of Pseudomonas aeruginosa; F2) Application in reducing the production of pyocyanin in Pseudomonas aeruginosa; F3) Application in reducing the biosynthesis of siderophores in Pseudomonas aeruginosa and Pyochelin; Application of F4 in increasing the motility of Pseudomonas aeruginosa; The bscR The gene sequence is shown in SEQ ID No. 1; the application described is for purposes other than disease diagnosis and treatment.

2. A knockout Pseudomonas aeruginosa bscR The application of gene-based reagents in the preparation of drugs against Pseudomonas aeruginosa infection, the aforementioned bscR The gene sequence is shown in SEQ ID No. 1, and the application is for purposes other than disease diagnosis and treatment.

3. A strain overexpressing Pseudomonas aeruginosa bscR The application of genes in reducing the motility of Pseudomonas aeruginosa, the aforementioned bscR The gene sequence is shown in SEQ ID No. 1, and the application is for purposes other than disease diagnosis and treatment.

4. A method for reducing the biofilm production of *Pseudomonas aeruginosa* and / or the production of *Pseudomonas aeruginosa* pyocyanin, characterized in that, The method includes extracting data from the genome of *Pseudomonas aeruginosa*. bscR The gene was knocked out using genetic engineering methods. bscR The gene sequence is shown in SEQ ID No. 1, and the method described is not for disease diagnosis or treatment purposes.

5. An engineered strain of *Pseudomonas aeruginosa*, characterized in that, The engineered bacteria are knockout. bscR Pseudomonas aeruginosa gene or overexpression of the gene described bscR The gene of Pseudomonas aeruginosa, the bscR The gene sequence is shown in SEQ ID No.

1.

6. A method for preparing engineered bacteria according to claim 5, characterized in that, Knockouts were prepared using the M1 method. bscR Pseudomonas aeruginosa gene, or, using the M2 method to prepare overexpression bscR Genes of Pseudomonas aeruginosa, including: The M1 method includes the following steps: using gene knockout technology to remove *Pseudomonas aeruginosa*... bscR Gene knockout, resulting in knockout bscR Pseudomonas aeruginosa with genetic defects; The M2 method includes the following steps: [The text abruptly ends here, likely due to an incomplete sentence or a missing section.] bscR The gene expression vector was transformed into Pseudomonas aeruginosa, resulting in overexpression. bscR Pseudomonas aeruginosa with genetic defects; The bscR The gene sequence is shown in SEQ ID No. 1.

Images