Genetically engineered bacterium of high-yield abamectin B2a as well as construction method and application of genetically engineered bacterium
By constructing a SMARTS plasmid and finely regulating multiple target genes, the problem of low avermectin B2a production in the existing technology was solved, and efficient avermectin B2a production was achieved, which is suitable for industrial-grade amplification.
Patent Information
- Application Number
- CN202510569134.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-30
- Publication Date
- 2025-09-12
AI Technical Summary
It is difficult to significantly increase the production of avermectin B2a with existing technologies, and traditional gene mutation strategies are uncertain and complex, making it impossible to achieve the production of a single component.
Using multi-target optimization technology, the aveC and aveD genes were knocked out to construct the SMARTS plasmid, and a variety of mutant promoters and gRNA sequences were used to finely regulate the expression of multiple target genes to form a genetically engineered strain with high production of avermectin B2a.
Efficient production of avermectin B2a was achieved, with a shake flask fermentation yield of 6.90 g/L and an industrial-grade fermentation yield of 8.4 g/L, demonstrating the feasibility and robustness of this method.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of genetic engineering, and in particular relates to a genetically engineered bacterium with high yield of avermectin B2a and a construction method and application thereof. Background Art
[0002] Avermectin and its analogues are produced by Streptomyces avermitilis ( Streptomyces avermitilis Eight major 16-membered macrolide polyketides produced by the Chinese Academy of Sciences (Civil Science) have activity against a variety of mites, nematodes, and arthropod parasites, with minimal side effects in humans. They are widely used in animal health and agriculture (Zhuo Y, 2014, Biotechnology Journal, 9: 316-325). Abamectin contains four major components—A1a, A2a, B1a, and B2a—in varying proportions, totaling ≥80%, and four minor components—A1b, A2b, B1b, and B2b—with a total content ≤20%. B1a has the strongest acaricide activity and exhibits minimal toxicity to humans and animals (Egerton R, 1979, Antimicrob Agents Chemother 15: 372–378). B1a was the first industrialized avermectin product, with four companies producing avermectins entering the market between 1988 and 2007. With support from these companies, the Institute of Microbiology, Chinese Academy of Sciences, and other institutions have significantly increased the production of avermectin B1a, from 0.009 g / L to 9 g / L (Chen J, 2016, Synthetic and Systems Biotechnology, 1: 7-16). Recently, avermectin B2 (mainly B2a) has been shown to have strong nematicidal activity. This compound has been widely used to control crop diseases caused by infective nematodes (Wang L, 2023, ACS Omega, 8: 13038-13047).
[0003] Due to their different insecticidal activities, B1a and B2a are often used as the main components of different pesticides. However, the current industrial strains of Streptomyces avermitilis produce multiple components that need to be purified and separated. Therefore, the production of B1a or B2a alone without producing other components can reduce costs and increase efficiency. At the same time, there are many strategies to increase the production of avermectin B1a, but B2a, as an emerging pesticide, has been less studied and it is difficult to significantly increase the production of B2a. Given the potential market value of B2a, it is necessary to S. avermitilis Reprogramming was performed to produce large amounts of B2a.
[0004] The bifunctional enzyme AveC in the avermectin biosynthesis gene cluster catalyzes the formation of spironone and the selective dehydration of C22-C23, resulting in the simultaneous production of component "1" (avermectin B1a) and component "2" (avermectin B2a) (Sun P, 2013, Journal of the American Chemical Society, 135: 1540-1548). aveC The gene was mutated to enhance the ratio of avermectin B1a to B2a, and the ratio between the two increased from 0.63 to 1.33 (Yi H, 2022, AppliedMicrobiology and Biotechnology, 106: 2191-2205), proving aveC It is key to controlling the ratio of B1a to B2a. However, this technology still produces both B1a and B2a simultaneously, and cannot produce a single component. Furthermore, there are uncertainties surrounding gene mutations, and stability cannot be determined, making it unsuitable for industrial production.
[0005] Wen et al. developed a variety of strategies to increase the production of avermectin B1a, including enhancing the degradation pathway of fatty acids to increase the precursor acyl-CoA of avermectin, knocking out or overexpressing global transcription factors, and exploring S. avermitilis Other genes that promote high avermectin production (Yang M, 2024, Microbial Biotechnology, 17, e14470) (Yi H, 2024, Microbial Biotechnology, 17, e14319) (Liu L, 2019, Applied Microbiology and Biotechnology, 103: 8459-8472). Since B2a is also synthesized by the avermectin biosynthesis gene cluster, the related targets of high-yield B1a may also increase the production of B2a. However S. avermitilis The fermentation time is long and the regulatory network is complex. Strengthening or weakening a single gene can increase the yield, but combining multiple targets may not significantly increase the yield of avermectin. Therefore, dynamic synchronization technology is needed to fine-tune the expression intensity of multiple targets to achieve increased yield. Summary of the Invention
[0006] The purpose of the present invention is to provide a genetically engineered bacterium with high yield of avermectin B2a and a construction method and application thereof, in particular a method for constructing a genetically engineered bacterium with high yield of avermectin B2a using multi-objective optimization technology.
[0007] To achieve coordinated reprogramming of multiple targets and maximize avermectin B2a production, the present invention requires synchronized expression of multiple targets over time and fine-tunable intensity. This technology incorporates a multi-objective optimization technique, which often requires extensive trial and error. Therefore, this technique aims to achieve a degree of automation at the optimization level, reducing experimental and time costs.
[0008] In order to achieve the object of the present invention, in a first aspect, the present invention provides a method for constructing a genetically engineered bacterium with high yield of avermectin B2a using multi-objective optimization technology, comprising the following steps: (1) Knockout of Streptomyces avermitilis ( Streptomyces avermitilis ) aveC and aveD Gene, obtained strain △ aveCD ; (2) Design primers to amplify the P ermE - dCas9 The purified DNA fragment was then cleaved with EcoRI / XbaI digested pSET152-TSA- dCas9 The plasmid fragments were recombined in vitro using NovoRec Plus recombinase to construct the pSET152-SMARTS plasmid; Among them, pSET152-TSA- dCas9 Plasmid carrying P cymR - antA 、P QS - cebR 、P cymR - cebR and P cebR -2 - cymR sequences, whose nucleotide sequences are shown in SEQ ID NOs: 55, 57, 58 and 59, respectively; P ermE - dCas9 The nucleotide sequence is shown in SEQ ID NO: 56; (3) Integrate the pSET152-SMARTS plasmid into strain △ through conjugation transfer aveCD Genome-wise, strain AveB20 was obtained; (4) Design primers to amplify P 48 、P 46 、P 26 、P 30Mutate the promoter sequence and then 48 Target gene meiC , P 46 Target gene aveR , P 46 Target gene avtAB , P 26 Target gene fadD , P 30 Target gene bicA-ecaA The sequences were assembled together using fusion PCR technology; Design primers to amplify the P 32 Mutate the promoter sequence and combine it with the targeting sucCD The gRNA sequences of the genes were assembled together using fusion PCR technology; In the present invention, gene meiC Derived from Streptomyces nanchangensis ( Streptomyces nanchangensis ), whose reference sequence number in NCBI is AAM97313.1; Gene aveR and avtAB Derived from Streptomyces avermitilis, their reference sequence numbers in NCBI are SAVERM_935 and SAVERM_933-934; Gene fadD Derived from Streptomyces coelicolor ( Streptomyces coelicolor ), whose reference sequence number in NCBI is SCO6196; Gene bicA-ecaA Depend on bicA and ecaA composition, bicA Derived from cyanobacteria Synechococcus sp. PCC7002, ecaA Derived from Anabaena Anabaena sp. PCC7120, whose reference sequence numbers in NCBI are WP_065714188.1 and WP_012307967.1, respectively; sucCD The gene is derived from Streptomyces avermitilis, sucC1 、 sucC2 、 sucD1 and sucD2 composition, and their reference sequence numbers in NCBI are SAVERM_1818, SAVERM_3452, SAVERM_1817, and SAVERM_3451, respectively; P 48 、P 46 、P 26 、P 30 、P 32 The mutant promoter is derived from Streptomyces albicans ( Streptomycesalbidoflavus ) ON promoter mutations; P 48 、P 46 、P 26 、P 30 、P 32 The N17 sequences in the mutant promoter nucleotide sequence are as follows: P 48 :5′-CAGACAAGGAAAGACTA-3′ P 46 :5′-TGGAATCCCTGAGAACC-3′ P 26 :5′-CGCGCAAAACCACAACT-3′ P 30 :5′-TCGCATTTCCTCACCCA-3′ P 32 :5′-TTTCTTAAACGTCAAGT-3′ The P ON The nucleotide sequence of the promoter is shown in SEQ ID NO: 3; (5) The target gene expression cassettes controlled by the six mutant promoters obtained above were recombined in vitro with the pSOK616 plasmid fragment double-digested with SpeI / HindIII using NovoRec Plus recombinase to construct the pSOK616-AveB22 plasmid, which was then integrated into the genome of the strain AveB20 by conjugation transfer.
[0009] Preferably, the targeting in step (4) sucCD The gRNA sequences of the genes are as follows: Targeted sucC1 The gRNA sequence was: 5′-CCCTTGCCTGGTGTTCGTAC-3′; Targeted sucC2 The gRNA sequence was: 5′-GTCGCCTCGCGGGCCGCCTC-3′; Targeted sucD1 The gRNA sequence was: 5′-GGACCTTGCTCTCCTTGGTG-3′; Targeted sucD2 The gRNA sequence is: 5′-TGACCTTGCTGTCCTTGTTG-3′.
[0010] In a second aspect, the present invention provides a genetically engineered bacterium that produces high-yield avermectin B2a constructed according to the method.
[0011] In a third aspect, the present invention provides the use of the genetically engineered bacteria in the fermentation production of avermectin B2a.
[0012] In a fourth aspect, the present invention provides a method for increasing the fermentation yield of avermectin B2a, wherein the high-yielding avermectin B2a-producing genetically engineered bacteria are used to carry out fermentation production of avermectin B2a.
[0013] Furthermore, the method includes: culturing the genetically engineered bacteria with MS solid medium for 3-4 days, collecting spores of the genetically engineered bacteria with 2×YT medium, inoculating them into industrial seed medium for culturing for 2-3 days, and then inoculating them into industrial fermentation medium for culturing for 10-12 days.
[0014] Preferably, after the genetically engineered bacteria are cultured on MS solid medium for 4 days, spores of the genetically engineered bacteria are collected on 2×YT medium, inoculated on industrial seed medium for 2 days, and then inoculated on industrial fermentation medium for 12 days.
[0015] Wherein, the formula of the MS solid culture medium is: soybean powder 16-20 g / L, mannitol 16-20 g / L and agar powder 20 g / L; preferably, the formula of the MS solid culture medium is: soybean powder 20 g / L, mannitol 20 g / L and agar powder 20 g / L; The formula of the 2×YT medium is: peptone 16-20 g / L, yeast extract 8-10 g / L and sodium chloride 10 g / L; preferably, the formula of the 2×YT medium is: peptone 16 g / L, yeast extract 10 g / L and sodium chloride 10 g / L; The formula of the industrial seed culture medium is: 28-34 g / L soluble starch, 4-5 g / L yeast extract, 2-3 g / L soybean meal or soybean peptone, and 5 mL / L of a 1 g / L cobalt chloride hexahydrate solution; preferably, the formula of the industrial seed culture medium is: 30 g / L soluble starch, 4 g / L yeast extract, 2 g / L soybean meal or soybean peptone, and 5 mL / L of a 1 g / L cobalt chloride hexahydrate solution; The formula of the industrial fermentation medium is: 60-70 g / L corn starch, 10-15 g / L soy flour or soy peptone, 10-15 g / L yeast extract, 0.4-0.6 g / L dipotassium phosphate trihydrate or potassium dihydrogen phosphate, 0.4-0.5 g / L magnesium sulfate heptahydrate or magnesium chloride heptahydrate, 1-2 g / L calcium carbonate, and 5 mL / L of a 1 g / L cobalt chloride hexahydrate solution; preferably, the formula of the industrial fermentation medium is: 70 g / L corn starch, 15 g / L soy flour or soy peptone, 10 g / L yeast extract, 0.5 g / L dipotassium phosphate trihydrate or potassium dihydrogen phosphate, 0.5 g / L magnesium sulfate heptahydrate or magnesium chloride heptahydrate, 1 g / L calcium carbonate, and 5 mL / L of a 1 g / L cobalt chloride hexahydrate solution.
[0016] Furthermore, the culture temperature is 28-30°C, preferably 28°C.
[0017] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects: The present invention is based on the developed Streptomyces multi-channel artificial control system ( Streptomyces A dynamic, synchronized, and optimized production technology for Streptomyces secondary metabolites was designed using a multiplexed artificial control system (SMARTS). This technology automatically calculates the optimal expression intensities of multiple target genes, allowing them to dynamically and combinatorially reprogram these target genes to synergistically promote the production of secondary metabolites. The method was applied to the optimized production of berbermectin, confirming its feasibility. Subsequent industrial-scale scale-up of the fermentation process, using 120 tons of fermentation, achieved a yield of 8.4 g / L, demonstrating the robustness of the engineered strain. Therefore, this invention serves as an engineering paradigm for the production of Streptomyces secondary metabolites. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1 Schematic diagram of the multi-objective optimization technology based on SMARTS in a preferred embodiment of the present invention.
[0019] Figure 2 The engineered strain AveB20, in a preferred embodiment of the present invention, specifically produces avermectin. (a) Schematic diagram of the biosynthesis of the four main components of avermectin. (b) Determination of fermentation products of the engineered strain AveB20.
[0020] Figure 3 Optimizing the biosynthetic machinery of berbermectin in a preferred embodiment of the present invention. (a) Determining the expression strength of the three targets in Group I using response surface modeling. (b) Optimizing berbermectin production in strain AveB21.
[0021] Figure 4Optimization of independent pathways involved in the synthesis of berberatin in preferred embodiments of the present invention. (a) Determination of the expression intensity of the three targets in Group II using response surface modeling. (b) Optimization of berberatin production in strain AveB22. P <0.001).
[0022] Figure 5 The robustness of the SMARTS multi-objective optimization technology in a preferred embodiment of the present invention. (a) Schematic diagram of the industrial scale-up of berbermectin. (b) Transcription profile of the target gene in the primary seed tank. (c) Transcription profile of the target gene in the secondary seed tank. (d) Transcription profile of the target gene in the fermentation tank.
[0023] Figure 6 This is the production curve of berbermectin amplified in a 120-ton fermenter in a preferred embodiment of the present invention.
[0024] Figure 7 This is a trigger-responsive Streptomyces quorum sensing system in a preferred embodiment of the present invention. (a) Trigger Response S. coelicolor The quorum sensing system of M145. (b) Trigger response S. avermitilis The quorum sensing system of MA-4680. (c) The stringency of the trigger. (d) The universality of the trigger.
[0025] Figure 8 Optimization of the bistable circuit in a preferred embodiment of the present invention. (a) Schematic diagram of the bistable circuit. (b) Response curves of four suppression systems. (c) CymR Dose-response curve of CebR. Dose-response curves of four P cebR Response curve of the variant. (f) Switching effect of the optimized bistable circuit. ( P <0.05, P <0.01).
[0026] Figure 9 In a preferred embodiment of the present invention, the stabilizer can convert a transient signal into a stable signal. (a) The bistable circuit is in a stable off state. (b) The bistable circuit is in a stable on state. (c) The stabilizer can produce a stable signal output after packaging. (d) The stabilizer's universality. (e) The stabilizer's orthogonality.
[0027] Figure 10Figure 2 shows the amplification effect of the amplifier in a preferred embodiment of the present invention. (a) Orthogonality of the amplifier. (b) Amplification effect of the amplifier at the translation level. (c) Amplification effect of the amplifier at the transcription level.
[0028] Figure 1 { In a preferred embodiment of the present invention, the promoter library can be used to finely regulate the target gene 。 (a) Characterization of 50 promoters. (b) Correlation between the transcriptional and translational levels of the 10 selected promoters. (c) Universality of the promoter library.
[0029] Figure 12 The inhibitory effects of the flipper in a preferred embodiment of the present invention. (a) The inhibitory effects of 50 promoters. (b) The multi-effector achieves independent outputs of strengthening and weakening.
[0030] Figure 13 In the preferred embodiment of the present invention, cebR -2 Schematic diagram of the promoter structure.
[0031] Figure 14 In the preferred embodiment of the present invention, ON Schematic diagram of the promoter structure. DETAILED DESCRIPTION
[0032] The present invention utilizes multi-objective optimization technology to synchronously and dynamically control multiple target genes in the production of secondary metabolites of Streptomyces (such as Streptomyces avermitilis), so that the secondary metabolites can be produced synergistically and efficiently.
[0033] The present invention adopts the following technical solutions: 1. Reprogramming the production of berbermectin using multi-objective optimization technology Abamectin B2a is a secondary metabolite, and its overproduction requires precise reprogramming (activation or repression) of multiple targets. Therefore, the present invention utilizes a multi-target optimization technique to fine-tune the dynamic expression levels of these targets. For sequential optimization, genes / pathways involved in secondary metabolite production were divided into two groups based on their hierarchy. Group I includes genes specifically involved in the biosynthesis, transport, and cluster-specific regulation of a particular secondary metabolite. These targets, all derived from secondary metabolism, are integral components of the biosynthetic machinery, converting precursors to the final product through sequential enzymatic reactions. Therefore, precise coordination is required to achieve efficient production. The occurrence of synthetic bottlenecks should be minimized, particularly when integrating heterologous enzymes with native biosynthetic machinery. Group II includes independent genes or pathways that support the biosynthesis of secondary metabolites. These targets influence precursor supply, competing pathways, cofactor balance, and the maintenance of specific production profiles. Considering that these targets are also involved in numerous cellular processes beyond the biosynthesis of secondary metabolites, the targets in Group II were combinatorially and dynamically reprogrammed after the optimization of Group I, thus achieving a strategic trade-off towards maximizing production ( Figure 1 ).
[0034] Using this multi-objective optimization technique, S. avermitilis The production of Abamectin B2a is finely regulated. To this end, we have collaborated with pharmaceutical companies to name the commercial product of B2a component as Bermectin. Currently, industrial bacteria can simultaneously synthesize multiple components of Abamectin ( Figure 2 a). In order to cultivate a strain that can specifically produce berberatin, the aveCD gene, and introduced exogenous meiC This modification specifically catalyzes the C2-C7 spirocyclic formation of the dihydroxyketone polyketide intermediate without the dehydration activity of C22-C23 (Sun P, 2013, Journal of the American Chemical Society, 135(4): 1540-1548), thereby eliminating the synthesis of the unwanted B1 component ( Figure 2 b) The strain was named AveB20, and was used as the starting strain to reprogram the production of berberine using multi-objective optimization technology.
[0035] The targets were then grouped, with Group I selecting the enhanced exogenous gene meiC , positive regulatory genes that enhance gene cluster transcription aveR (Kitani S, 2009, Applied Microbiology and Biotechnology, 82(6): 1089-1096) and enhance the gene responsible for the efflux of berbermectin avtAB(Qiu J, 2011, Applied Microbiology and Biotechnology, 92(2): 337-345). Several mutant promoters with different strengths were selected to control the above target genes, and 32 groups of mutant promoter combinations were obtained. The expression strengths of the three targets were represented by x, y, and z, respectively. The corresponding strains were named AveB2-I1~AveB2-I32. The yields (Titer) corresponding to the 32 promoter combinations were obtained by fermenting these strains. These expression strengths and yield results were calculated using a response surface model to calculate the optimal point. The obtained model equation was Titer = 6.31+0.318x+0.279y+0.299z+0.096xy+0.044xz+0.039yz-0.513x 2 -0.530y 2 -0.327z 2 ( Figure 3 a), R 2 is 0.87, and the optimal point corresponding to the mutant promoter combination is P 48 、P 46 、P 46 , using this optimal combination to drive meiC 、 aveR and avtAB , resulting in strain AveB21. This dynamically reprogrammed strain achieved a yield of 6.90 g / L in shake flask fermentation, a 61.6% increase compared to the starting strain AveB20 ( Figure 3 b).
[0036] Then, the targets of group II were selected, one of which was to enhance acyl-CoA synthetase fadD , enhance the degradation of triglycerides (Wang W, 2020, Nature Biotechnology, 38(1): 76-83), and the second is to strengthen carbonic anhydrase bicA and bicarbonate ion transporter ecaA The combination of the two can effectively concentrate carbon dioxide and make it carboxylated and reused (Hao Y, 2022, Applied Microbiology and Biotechnology, 106(5): 2191-2205). The third is to weaken the TCA cycle. sucCDTo inhibit the competitive pathway (Yang M, 2024, Microbial Biotechnology, 17(5):e14470). Several promoters with different strengths were selected to control the above target genes, and 32 groups of mutant promoter combinations were obtained. The expression strengths of the three targets were represented by x, y, and z, respectively. The corresponding strains were named AveB2-II1~AveB2-II32. The yields (Titer) corresponding to the 32 groups of mutant promoter combinations were obtained by fermenting these strains. The optimal point was calculated by the response surface model based on these expression strengths and yield results. The obtained model equation was Titer = 8.86+0.020x+0.141y+0.390z-0.119xy+0.086xz+0.106yz-0.722x 2 -0.321y 2 -0.465z 2 +0.452xyz( Figure 4 a), R 2 is 0.86. In order to determine the best promoter combination, three mutant promoter combinations were tested near the predicted optimal point, and the dynamic control fadD 、 bicA - ecaA and targeted sucCD gRNA, and obtained strain AveB22 (P 26 、P 30 、P 32 )、AveB23 (P 26 、P 30 、P 31 )、AveB24 (P 27 、P 30 、P 32 ), strain AveB22 obtained the highest berberatin production in shake flask fermentation, which was 9.22 g / L ( Figure 4 b). The results showed that the SMARTS-based multi-objective optimization technology can achieve a continuous improvement in the yield of berbermectin. This optimization technology can sequentially coordinate multiple targets in Group I and Group II.
[0037] 2. Industrial-scale scale-up production of berbermectin Industrial-scale production of the berbermectin-producing strain AveB22 was carried out using a step-by-step scale-up bioreactor, resulting in large-scale production of berbermectin. Specifically, a two-stage seed tank (0.2 tons for the first seed tank and 5 tons for the second seed tank) was used, and production was ultimately carried out in a 120-ton fermenter. Since the purpose of the two-stage seed tank is to accumulate biomass rather than to produce efficiently, cellulose disaccharide was added to maintain the growth state of the first seed tank. No inducer was added to the second seed tank, allowing the strain to gradually transition from a growth state to a production state and maintain an efficient production state throughout the fermenter. ( Figure 5 a).
[0038] The transcriptional profiles of target genes were sampled and analyzed in the primary seed tank, secondary seed tank, and fermentation tank to determine the on or off state of the strain. In the primary seed tank, despite the presence of the quorum sensing signal molecule avenolide, the transcriptional profile of the SMARTS-controlled target gene did not change with time and remained in the off state ( Figure 5 b), which confirms that the inducer maintains the off state. In the secondary seed tank, as avenolide accumulates, the transcriptional profiles of multiple target genes transition from the off state to the on state, demonstrating that the strain gradually shifts to a production state ( Figure 5 c). In the 120-ton fermenter, the transcription profiles of multiple target genes did not change with time sequence and remained in an open state, proving that the strain maintained a stable production state during fermentation ( d). Due to the robustness of the multi-objective optimization technique during the 13-day fermentation period, AveB22 achieved stable production with a final yield of 8.4 g / L ( Figure 5 ), indicating that the present invention achieves efficient and large-scale production in the production process of berbermectin.
[0039] The multi-objective optimization technology provided by the present invention has certain automation performance. Only a small number of experiments need to be input into the model to obtain the optimal ratio of multiple objectives. The efficient production of secondary metabolites can be achieved using a two-iteration optimization process.
[0040] The strategy used in the present invention is effective and robust in both laboratory and industrial scenarios, and the constructed high-yield bacteria successfully achieved 120-ton industrial-scale amplification of berbermectin.
[0041] The following examples are used to illustrate the present invention but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.
[0042] Unless otherwise specified, the bacterial strains, plasmids, vectors and other biological materials involved in the following examples were provided by Wang Weishan Laboratory, Institute of Microbiology, Chinese Academy of Sciences.
[0043] Example 1Figure 6 Construction of knockout strains aveCD Derived from Streptomyces avermitilis aveCD (purchased from Hebei Xingbai Pharmaceutical Group Co., Ltd.), in order to construct S. avermitilis The knockout strain is first amplified by amplifying the homology arms, where aveCD and aveD The knockout was performed in two steps. First, primers AveD_UpF / UpR (TAAAACGACGGCCAGTGCCACAGGCACGGTGTTCCTGAAG / GTTCCCGACCTGCGGCAACGCTGTCGAC) were used to amplify aveC The upstream homology arm of the gene was amplified using primers AveD_DnF / DnR (CGTTGCCGCAGGTCGGGAACCTCCGCAAT / TAGAGTCGACCTGCAGCCCACACGGAGCGATTCGGGGCA). aveD Downstream homology arm; amplified using primers AveC_UpF / UpR (TAAAACGACGGCCAGTGCCAGCTGTCGGCTTTCGTCATGT / TCCTCCGACCTCACGCTGTCTCACCTTCGT) aveD The upstream homology arm of the gene was amplified using primers AveC_DnF / DnR (GACAGCGTGAGGTCGGAGGAGACGGAGAAG / TAGAGTCGACCTGCAGCCCACAGGAGACCGCTGATTCCTG). aveC Downstream homology arm. Using KOD One TM Amplification was performed using PCR Master Mix, and the amplification reaction procedure was performed according to the instructions provided with the polymerase. Specific thermal cycling conditions were as follows: the initial denaturation stage was set at 98°C for 3 min; each cycle consisted of a denaturation temperature of 98°C for 10 s, an annealing temperature of 63°C for 5 s, an extension temperature of 68°C for 1 min / kb, and a final extension stage of 68°C for 3 min. The upstream and downstream homology arms were recombined in vitro with the backbone fragment of the HindIII-digested pKC1139 plasmid (Qiu S, 2023, Metabolic Engineering, 81: 210-226) using NovoRec Plus recombinase to construct the knockout plasmid pKC1139-Δ aveC and pKC1139-Δ aveD Plasmid. The two plasmids were transformed into aveCET12567 / pUZ8002 (Qiu S, 2023, MetabolicEngineering, 81: 210-226), carrying pKC1139-Δ E. coli , pKC1139-Δ aveD Plasmid aveC As a parent and E. coli Perform intergeneric conjugative transfer. S. avermitilis To OD 600 = 0.4~0.6, centrifuge 1 mL of bacterial solution, and resuspend the bacteria in 1 mL of 2×YT medium for later use. E. coli After culturing on MS solid medium for 4 days, add 2 mL of 2×YT medium to the plate. Collect fresh spores from the plate with a cotton swab to prepare a spore suspension. Heat shock the spores at 50°C for 10 minutes. Mix 15 µL of the cooled spores with 200 µL of resuspended E. coli and spread on MS plates. Incubate for 16 hours before applying antibiotics. After culturing at 28°C for 2-3 days, single colonies were selected for colony PCR verification. Conjugates that amplify the correct band were expanded.
[0044] Example 2 Construction of starting strain In order to apply SMARTS to S. avermitilis , using primers multiplexer_F / R (ACATCCGCTGCAGGTCGACTCTAGACTCTAGTATGCATGC / ACAGCTATGACATGATTACGAATTCTGAATTTTCTGTATGAGGTT) with pSET152-TSA- S. avermitilis Plasmid was used as template to amplify P ermE - dCas9 Sequence, the purified DNA fragment was combined with EcoRI / XbaI digested pSET152-TSA- dCas9 The plasmid fragments were recombined in vitro using NovoRec Plus recombinase to construct the pSET152-SMARTS plasmid. This plasmid only deleted the P ON -gRNA sequence, retaining the pSET152-TSA- dCas9 The original P on the plasmid cymR - dCas9 、P ermE - antA 、P QS - dCas9 、P cymR - cebR With P cebR -2 - cebR The plasmid contains the trigger, stabilizer, amplifier and flip-flop of SMARTS, and these sequences will not change, so they are constructed on the same plasmid. ON The target gene controlled by the mutant promoter or the gRNA sequence targeting the target gene is variable and therefore constructed on another plasmid (see Example 3). The pSET152-SMARTS plasmid is integrated into the S. cymR △ avermitilis The strain genome forms the AveB20 strain.
[0045] Example 3 Construction of optimized strains For the optimized strain of berberatin, aveCD Derived from Streptomyces nanchangensis meiC The gene sequence was synthesized by GenScript Biotech Co., Ltd., and the DNA fragment was amplified using primers meiC_F / R (CTGAGTGAAGAGGAGAAGGCATGACCGATCTCGTCGACGA / TCAGTAGCCGGCCGCCGGACGGAAGAATTC). S. nanchangensis and aveR All come from avtAB The DNA fragments were amplified using primers aveR_F / R (CTGAGTGAAGAGGAGAAGGCATGCAGGGAGTTTCCTGTCT / TCAGTTGGCCTGGTCCGCGAGGTGTCGCA) and avtAB_F / R (CTGAGTGAAGAGGAGAAGGCATGCGCGGCCGCGGGTGG / TCAGGCGTCCCGTCGGCGCAGGACCAGGT), respectively. S. avermitilis Derived from Streptomyces coelicolor S. fadD The DNA fragment was amplified using primers fadD_F / R (CTGAGTGAAGAGGAGAAGGCGTGACCGCACCCGCGCCC / TCAGGGGCGCGCTCCGTACCGCTCCCG). coelicolor Derived from cyanobacteria bicA sp.PCC7002, Synechococcus Derived from Anabaena ecaAsp. PCC7120. Both gene sequences were synthesized by GenScript Biotech Co., Ltd., and primers bicA_F / R (CTGAGTGAAGAGGAGAAGGCATGAAGAAGCTCATCCGTGG / TCAGCCGGACACGGAGAAGGTATCCGTTTC) and ecaA_F / R (CGTGCAGGACTGGGGGAGTTATGCAGATCACCAACAAGAT / TTAGCCCATCTCGCTCGAGGGCGCGGTCAC) were used to amplify DNA fragments. Anabaena The gRNA spacer sequence was obtained from CRISPy-web (https: / / crispy.secondarymetabolites.org), where the target sucCD The spacer sequence is CCCTTGCCTGGTGTTCGTAC, targeting sucC1 The spacer sequence is GTCGCCTCGCGGGCCGCCTC, targeting sucC2 The spacer sequence is GGACCTTGCTCTCCTTGGTG, targeting sucD1 The spacer sequence is TGACCTTGCTGTCCTTGTTG. These target genes were fused with promoters of different strengths by in vitro PCR to form expression cassettes. The cassettes were then recombined with a SpeI / HindIII double-digested pSOK616 plasmid (Qiu S, 2023, Metabolic Engineering, 81: 210-226) fragment in vitro using NovoRec Plus recombinase to construct pSOK616-B2-I1 to pSOK616-B2-I32 and pSOK616-B2-II1 to pSOK616-B2-II32 plasmids. The plasmids were then integrated into the pSOK616-B2-II32 plasmids by conjugation according to the method described in Example 1. sucD2 on the AveB20 genome.
[0046] The construction method of the avermectin B2a high-yielding strain AVEB22 is as follows: Primers PONmut_F / R (CCCTCCCGATCCGCCGCGTG / GCCTTCTCCTCTTCACTCAG) were used to amplify P 48 、P 46 、P 26 、P 30 Mutate the promoter sequence and separate it with S. avermitilis 、 meiC 、 aveR 、 avtAB 、fadD The sequences were assembled using fusion PCR (where P 48 Control target genes bicA-ecaA , P 46 Control target genes meiC , P 46 Control target genes aveR , P 26 Control target genes , P 30 Control target genes avtAB ), primers PONmutF / R32 (CCCTCCCGATCCGCCGCGTG / GCAGAGGAAGAGACTTGACG) were used to amplify the P 32 Mutate the promoter sequence and combine it with the targeting fadD The gRNA sequences were assembled using fusion PCR technology. The PCR conditions were as shown above to obtain six P ON The target gene expression cassette controlled by the mutant promoter was recombined with the pSOK616 plasmid fragment double-digested with SpeI / HindIII in vitro using NovoRecPlus recombinase to construct the pSOK616-AveB22 plasmid, and then the plasmid was integrated into the strain by conjugation transfer according to the method in Example 1. bicA-ecaA on the AveB20 genome.
[0047] Example 4 Fermentation production of berbermectin Cultured on MS solid medium (soybean powder 20 g / L, mannitol 20 g / L, agar powder 20 g / L) S. sucCD After 4 days of industrial bacteria cultivation, the bacteria were harvested with 2 mL of 2×YT medium (16 g / L peptone, 10 g / L yeast extract, 10 g / L sodium chloride). [[ID= Spores of the industrial strain were inoculated into industrial seed medium (30 g / L soluble starch, 4 g / L yeast extract, 2 g / L soy peptone, and 5 mL / L 1 g / L cobalt chloride hexahydrate solution) and cultured for 2 days. The culture was then inoculated at a 4% inoculum into industrial fermentation medium (70 g / L corn starch, 15 g / L soy flour, 10 g / L yeast extract, 0.5 g / L dipotassium hydrogen phosphate trihydrate, 0.5 g / L magnesium sulfate heptahydrate, 1 g / L calcium carbonate, and 5 mL / L 1 g / L cobalt chloride hexahydrate solution) and cultured for 12 days. All fermentations were performed at 28°C.
[0048] Example 5 Determination of berbermectin Bavermectin was analyzed using a Shimadzu Nexera LC-40 liquid chromatograph with a ZORBAX SB-C18 column (250 × 4.6 mm, 5 µm, Agilent). The mobile phase for eluting Bavermectin consisted of water (85%) and methanol (15%) at a flow rate of 0.5 mL / min.
[0049] Example 6 Construction of response surface model The experimental mixture design was determined using a three-dimensional response surface analysis and analysis of variance (ANOVA) using Design-Expert 13.0 software. A simplex lattice mixture design was used to optimize the three independent variables, resulting in 32 simple points. The three independent variables in the mixture design consisted of the promoter strengths of three different target genes. Since the sum of each independent variable always sums to 100%, the promoter strengths were normalized. The yield of each secondary metabolite product served as the dependent variable for model analysis and simulation. Data were fitted using multiple linear regression. Through regression analysis, the model was used to simulate the optimal ratios of each variable, resulting in the model equation and optimal point.
[0050] Example 7 Real-time quantitative PCR analysis To determine the effectiveness of the control process during industrial fermentation, bacterial cells were collected from seed tanks and fermentation tanks at various stages by centrifugation. Sampling intervals for the primary seed tank were 24, 48, and 72 hours; for the secondary seed tank were 24, 48, and 72 hours; and for the final fermentation tank were 24, 72, 108, 168, and 216 hours. After centrifugation, the bacterial cells were smeared on double-layer filter paper to remove water and quickly frozen in liquid nitrogen. The frozen cells were ground into a powder in liquid nitrogen and placed in a 1.5 mL centrifuge tube. 600 μL of Trizol was added and vortexed. 1 mL of the supernatant was aspirated, 250 μL of chloroform was added, mixed thoroughly, and centrifuged. 650 μL of the upper aqueous phase was transferred to a new tube, an equal volume of chloroform was added, and the tube was vortexed for 30 seconds before centrifugation. Transfer 450 µL of the upper aqueous phase to a new tube, add an equal volume of isopropanol, mix thoroughly, and precipitate at -20°C for 10 minutes. Centrifuge and discard the supernatant. Rinse the precipitate with 1 mL of 75% ethanol, centrifuge and discard the supernatant. Dry the RNA at room temperature. Dissolve the RNA in 50 µL of DNase I solution, incubate at 37°C for 1 hour to digest genomic DNA, and incubate at 65°C for 10 minutes to inactivate DNase I and obtain total RNA.
[0051] Total RNA was reverse transcribed using the SynScript™ III cDNA Synthesis Mix Kit from Beijing Qingke Technology Co., Ltd. according to the manufacturer's instructions. The reaction temperature was maintained at 25°C for 10 min, then raised to 50°C for 15 min, and finally raised to 85°C for 5 min. The resulting cDNA was amplified using the 2×TSINGKE® MasterqPCR Mix Kit from Beijing Qingke Technology Co., Ltd. using an Applied biosystems-7500 fluorescence quantitative PCR instrument. To calculate the relative transcription level of the target gene, the PCR product was amplified using the 2×TSINGKE® MasterqPCR Mix Kit from Beijing Qingke Technology Co., Ltd. using the Applied biosystems-7500 fluorescence quantitative PCR instrument. hrdB The transcription level of the gene was used as an internal reference, and the relative transcription level of the gene was analyzed using the ΔΔCt method. The PCR program was as follows: the first stage was a hold stage, with a reaction at 95°C for 10 min; the second stage was an amplification stage, with a total of 40 cycles, each cycle consisting of annealing at 95°C for 15 s, followed by an extension at 60°C for 30 s; the third stage was a melting curve stage, with a reaction at 95°C for 15 s, then at 60°C for 1 min, and finally at 95°C for 15 s. of hrdB The upstream primer of the gene is SAVhrdB_TF (TGCCGATCTGCTTGAGGTAG), and the downstream primer is SAVhrdB_TR (CTTCGTACTCTCCGACGAGG), and the target gene is amplified. The upstream primer is meiC_TF (GTGTCTGTACCGGAGGTGTC), and the downstream primer is meiC_TR (GTTCATCAAGGGACTCTGCCA), to amplify the target gene. The upstream primer was fadD_TF (CGAGGACGGATACGTCGAGA), and the downstream primer was fadD_TR (GGTGGGCGTACAGGAACTC).
[0052] Example 8 Industrial Scale-up of Bavermectin The optimized AveB22 strain was scaled up industrially. Two seed tanks were used: a primary seed tank with a volume of 0.2 tons, a secondary seed tank with a volume of 5 tons, and a fermentation tank with a volume of 120 tons. Cellobiose was added to the primary seed tank at a final concentration of 300 μM. 100 mL of aliquots were collected every 24 hours during fermentation to measure berberine production, sugar consumption, and cell growth. Sugar consumption was determined by centrifuging the fermentation broth to remove bacterial cells and then diluting it 100-fold. The sugar concentration was quantified using an SBA-40E biosensor analyzer (Jinan Yanhe Biotechnology). This concentration was multiplied by 100 to determine the residual sugar concentration in the culture medium. Sugar consumption was calculated by subtracting the residual sugar concentration from the total sugar concentration. Cell growth was determined by centrifuging the cells and culture medium, pouring the supernatant into a graduated cylinder to determine the cell volume. This volume was subtracted from 100 mL to determine the cell volume, and the cell volume was divided by 100 to determine the cell volume percentage, which was used as the cell growth indicator.
[0053] Example 9 Construction of a Streptomyces multi-channel artificial control system This embodiment provides a multi-channel artificial control system for Streptomyces, which is composed of a trigger, a stabilizer, and a multi-effect device.
[0054] 1. Development of a universal artificial promoter that responds to the quorum sensing system of Streptomyces Based on the sequence analysis of the promoters of the receptor protein of Streptomyces, it was found that they all contained a conserved binding motif of 5'-AAACCNNNNNNNNGGTTT-3', and this conserved binding motif is generally located in the N17 sequence between the -35 region and the -10 region of the natural promoter. Streptomyces coelicolor ) Source P kasO The promoter starts to kasO The N17 sequence between the -35 region and the -10 region of the promoter is replaced with the conserved binding motif. The complete sequence information is 5'-TGTTCACATTCGAACGGTCTCTGCTTTGACAAACCGGCTAGCCGGTTTGTAAAGTCGTGGCCAGGAGAATACGACAGCGTGCAGGACTGGGGGAGTT-3' (where the underline is the conserved binding motif). This sequence can be obtained by annealing a pair of primers. The obtained promoter is called P QS , with a total length of 97 bp (SEQ ID NO: 1).
[0055] In order to verify P QS Can it respond to different endogenous quorum sensing systems of Streptomyces and convert P QS Control reporter gene gfpmut3.1Gene circuits were formed and transferred into Streptomyces containing different quorum sensing systems. SMM liquid culture medium was used uniformly, and samples were taken at 12 h, 24 h, 36 h, 48 h, 60 h, and 72 h of culture to test the fluorescence intensity of the unit bacteria and the intensity of the quorum sensing signal molecules at different time sequences. S. coelicolor M145 confirmed that the fluorescence intensity per unit cell is proportional to the intensity of the signal molecule SCB1 ( Figure 7 a), the temporal changes of both strains first rose to a peak value and then rapidly decreased. In Streptomyces avermitilis ( Streptomyces avermitilis ) MA-4680 confirmed that the fluorescence intensity per unit cell is proportional to the intensity of the signal molecule avenolide ( Figure 7 b). In addition, the gene circuit was transferred into the signal molecule mutant strain ( S. coelicolor △ scbA ) and receptor protein mutants ( S. coelicolor △ scbR ) in the △ scbA It is not triggered in △ scbR , indicating the stringency of the trigger, which only responds to the Streptomyces quorum sensing system ( Figure 7 c). These results confirm that the artificial promoter P QS It can interact with multiple quorum sensing receptors and respond to their quorum sensing signals.
[0056] At present, only four types of quorum sensing signal molecules with different structures have been identified in Streptomyces. In order to determine whether the artificial promoter works the same in Streptomyces with unknown signal molecules, we selected S. rimosus ATCC 10970 and S. scabiei 87.22 The fluorescence intensity of the test unit bacteria was found to be the same as S. coelicolor and S. avermitilis The results are similar to those in QS Able to receive allosteric signals from these quorum sensing receptor proteins ( Figure 7 d). The above results prove that P QS It is triggered by multiple quorum sensing systems and is universal.
[0057] 2. Develop an orthogonal stabilizer module Unlike traditional bacterial quorum sensing systems, the concentration of signal molecules in Streptomyces only reaches the threshold within a very narrow time window (Wang J, 2011, Moleculor Microbiology, 82(1): 236-250). QS The response is transient output, which does not meet the engineering requirements for stable output. In order to convert the transient output into a stable output, the P QSCombined with a stabilizer module containing a bistable circuit. The bistable circuit includes two mutually inhibiting inhibitory systems, ensuring that the initial off state (promoter P2 is ON and P1 is OFF) can be switched to the promoter P2 by quorum sensing. QS Once switched to the on state, it remains in this state regardless of subsequent fluctuations in the concentration of the quorum sensing signaling molecule. Figure 8 a).
[0058] Based on the dynamic response range, select CymR / cuO and CebR / cebO Inhibitory system builds bistable circuit ( Figure 8 b). To visualize the on and off states, the CymR-responsive promoter P was used. cymR control cebR and gfpmut3.1 The gene, with green fluorescence as the on state, is expressed using a CebR-responsive promoter P cebR control cymR and mCherry , with red fluorescence as the off state. It was found that the natural bistable circuit had serious leakage. To enhance the rigor of the bistable circuit, the bistable circuit was optimized from both the protein and promoter aspects. First, the inhibitory protein was fused with the phage-derived oligomerization domains CI434 and CI to the C-termini of the CymR and CebR proteins, respectively. Due to the presence of the oligomerization domain, the fused proteins easily formed tetramers, which could synergistically recognize the two DNA binding sites to form a DNA loop, thereby reducing leaky expression and improving the inhibition efficiency ( Figure 8 c and Figure 8 d). The modified CymR and CebR proteins are respectively called CymR and CebR To match the activity of the two promoters, the relatively weak CebR was optimized. Identify promoter P cebR , modifying the non-recognition region of the promoter (the middle sequence from -35 to -10), generating four variants with different strengths and induction ranges ( Figure 8 e), selected the cymR A variant of P with almost identical behavior cebR -2 To construct a bistable circuit. Among them, P cebR -2 For the modified promoter P cebR (Promoter P cebR For the cebR The nucleotide sequence of the promoter is shown in SEQ ID NO: 2 ( Figure 13 ). After completing the transformation of the inhibitory protein and promoter, S. coelicolor The test was carried out, and the culture medium and inducer were replaced every 18 h. The red and green fluorescence were successfully oscillated ( Figure 8 f), which shows that the optimized bistable circuit reduces leakage and improves stability.
[0059] After optimizing the bistable circuit and introducing the quorum sensing trigger promoter P QS The performance was evaluated by measuring the fluorescence intensity per cell. The bistable circuit was maintained in the closed state by induction on a solid plate initially containing cellobiose. The signal molecule mutant strain ( S. coelicolor Δ scbA ) of the fluorescence output, only the red fluorescence has a signal output while the green fluorescence does not, confirming the stability of the closed state ( Figure 9 a). Subsequently, to prove that the quorum sensing signal can trigger the on state, the same inoculation strategy was used to inoculate S. coelicolor In the wild type, only the red fluorescence signal was output at first, proving that it was still in the closed state at the beginning of fermentation. After the quorum sensing signal was generated, the red fluorescence signal gradually decreased, while the green fluorescence signal continued to increase and remained stable in the late fermentation period, proving the stability of the open state ( Figure 9 b).
[0060] Since both the on and off states can maintain stability, in order to encapsulate the stabilizer module based on the bistable circuit, the inhibitory factor is removed. cebR and cymR Two reporter genes were co-transcribed and an additional P was introduced. cymR Promoter ( cymR The promoter of the gene, the nucleotide sequence of which is shown in SEQ ID NO: 54) is used to specifically drive the target output, and the P cymR Promoter control gfpmut3.1 Compared with the control without the stabilizer module, the encapsulated stabilizer module can increase the quorum sensing-triggered P QS The instantaneous signal is converted into a more stable signal ( Figure 9 c). In different Streptomyces species ( S. venezuelae ATCC 10712, S. avermitilis MA-4680, S. rimosus ATCC 10970) was transferred into a gene circuit with a trigger-stabilizer to obtain S. coelicolor The consistent signal output pattern shows that the stabilizer has a wide range of applicability ( Figure 9d). Because the repressor and promoter in this module have been carefully designed to avoid any homologous sequences in the native Streptomyces system, the target output is only controlled by the trigger-stabilizer, and not by the endogenous genes of Streptomyces. Similarly, the expression of the trigger-stabilizer will not interfere with the normal physiological activities of Streptomyces. S. coelicolor The RNA-seq experiment in the experiment showed that only the reporter gene had a significant change in transcription level, while other genes on the genome had no significant change in transcription level, proving the orthogonality of the stabilizer ( Figure 9 e).
[0061] 3. Develop a multi-effects module that can be finely controlled To convert stable signals into multiple outputs, we introduced a multi-effector module, which includes an amplifier-coupled promoter library for generating enhanced states of different strengths and a flipper for converting these multiplexed on states into weakened states. First, an orthogonal amplifier was constructed. To ensure broad applicability to different Streptomyces species while minimizing endogenous interference, rare extracytoplasmic functional σ factors were selected that only specifically activate their cognate target promoters. These rare extracytoplasmic functional σ factors recognize the unique -35 region and -10 region of their promoters, thereby avoiding cross-interference with endogenous promoters (Mascher T, 2023, Annual Review of Microbiology, 77: 625-644). S. albidoflavus of σ antA As an amplifier, the characteristic -35 and -10 regions of this σ factor have been reported (Seipke R, 2014, PeerJ, 2: e253). σ antA The promoter P ON Control reporter gene sfgfp (AJW68299.1) gene circuit and transferred into S. venezuelae In ATCC 10712, RNA-seq experiments were performed, and only the transcription level of the reporter gene changed significantly, while the transcription levels of other endogenous genes in the genome did not change significantly, proving that σ antA The expression of other genes in the genome has no significant effect ( Figure 10 a). Next, we determined the amplification effect of the amplifier and constructed a trigger-stabilizer-amplifier gene circuit as the experimental group, and a control group containing only the trigger-stabilizer gene circuit. σ antA The enlarged P ON The output intensity at the translational level increased approximately 9-fold ( Figure 10b), the output intensity at the transcriptional level increased approximately 85-fold ( Figure 10 c). These results indicate that this rare extracytoplasmic functional σ factor is a non-interfering amplifier in Streptomyces.
[0062] In order to convert the single amplified signal into multiple outputs, the next step is to ON A mutation was introduced into the N17 sequence between the -35 and -10 regions of the promoter ( Figure 14 ) to generate a random library, which was then transferred to S. venezuelae ATCC 10712 and use flow cytometry-based sorting technology to obtain promoters of different strengths while ensuring amplifier σ antA 50 mutant promoters (P1~P 50 The N17 sequence in their nucleotide sequence is as shown in any one of SEQ ID NOs: 4-53, that is, P is replaced with the sequence shown in any one of SEQ ID NOs: 4-53. ON CCGCCGCCTCCTCGCGC in the promoter nucleotide sequence), with the original promoter P without mutation ON The output intensity of the mutant promoters was taken as 100%, and the relative output intensity of the mutant promoters ranged from 0.41% to 219.53%. Detailed characterization was performed at the translation level ( Figure 11 a). In addition, by analyzing the correlation between expression and transcription levels, it was found that the two were positively correlated, R 2 The value reaches 0.96, confirming that the observed output changes can be attributed to the amplifier σ antA Different transcriptional activation ( Figure 11 b), thus determining the usability of 50 mutant promoters. To assess the universality, 10 mutant promoters were selected and tested in three additional Streptomyces species ( S. coelicolor M145, S. avermitilis MA-4680, S. rimosus ATCC 10970) and observed S. venezuelae The same trend was observed in ATCC 10712 ( Figure 11 c).
[0063] To further convert the multiplexed outputs into multiplexed weakened outputs, a flipper was designed that uses the multiplexed outputs to express repressors, which then inhibit the activity of the target gene to varying degrees. As the expression level of the repressor increases, the output signal gradually decays. CRISPRi was selected as the flipper, and promoters of varying strengths were used to control the gRNA, while the dCas9 protein was constitutively expressed. This configuration produced a series of weakened signal outputs, with inhibition efficiencies ranging from 2.82% to 99.51% ( Figure 12 Finally, to test whether the amplifier, promoter library, and flipper can be used simultaneously to form finely tuned signal outputs of different strengths, five promoters of different strengths were used to fine-tune activation and repression simultaneously, with enhanced output selection. sfgfp As a reporter gene, weakening output selection mCherry As a reporter gene, 25 sets of enhanced and weakened output results were generated, and the enhanced and weakened outputs were related to the promoter strength ( Figure 12 b) Demonstrating the availability of amplifiers, promoter libraries, and flippers, the three-way combination is termed a pleiotrophin, demonstrating its ability to simultaneously autoregulate multiple targets in Streptomyces. Overall, by integrating trigger, stabilizer, and pleiotrophin modules, SMARTS enables dynamic, orthogonal, and predictable fine-tuning of multiple target genes across diverse Streptomyces strains.
[0064] Specifically, the trigger is constructed as follows: Trigger artificial promoter P QS A total of 97 bp was synthesized directly in the form of long primers by Beijing Qingke Biotechnology Co., Ltd. The primers were P QS _F / R (TGTTCACATTCGAACGGTCTCTGCTTTGACAAACCGGCTAGCCGTTTGTAAAGTCGTGGCCAGGAGAATACGACAGCGTGCAGGACTGGGGGAGTT / AACTCCCCCAGTCCTGCACGCTGTCGTATTCTCCTGGCCACGACTTTACAAACCGGCTAGCCGGTTTGTCAAAGCAGAGACCGTTCGAATGTGAACA), anneal the two primers to obtain P QS The DNA sequence was annealed at 95°C for 5 min and then cooled to room temperature. To characterize the trigger, the reporter gene was amplified using primers mut3_F / R (GTGCAGGACTGGGGGAGTTGATGCGGAAGGGCGAGGAGC / CTGGTTCCTTCTTGTTGTTTCACTTGTACAGCTCGTCCATGCCG). gfpmut3.1The purified DNA fragments were recombined with the backbone fragment of the pSET152 plasmid (Qiu S, 2023, Metabolic Engineering, 81:210-226) double-digested with BamHI and XbaI in vitro using NovoRec Plus recombinase to construct pSET152-P QS - gfp plasmid.
[0065] Specifically, the construction method of the bistable circuit is as follows: cymR and cebR Gene and its recognized promoter P cymR and P cebR and reporter genes gfpmut3.1 (XCO69042.1) and mCherry (QSL83322.1) were synthesized by GenScript Biotech Co., Ltd. The plasmid construction method of the bistable circuit was as follows: First, primers R1_F / R (GGCTGAACTCCTTACTTAGATCACCGCTTGAACTTGGCGT / ATGGTGGTCATCATGTCCCCCAAGCGG) were used to amplify cymR , using primers R2_F / R (TCTCCTCAAGGAGTGTCCATATGGTGACAGGCCACGGGGC / GTGCAGTCTCCTTACTTAGATCAGGAAGAATCCCGCCCCA) cebR ; P was amplified using primers P1_F / R (AATTGTACTAGTTCGTCACA / ATGGACACTCCTTGAGGAGA) cymR The primers P2_F / R (GGGGACATGATGACCACCATGTGCGGCCTCCTTACTTAGA / TGTGACGAACTAGTACAATTTGTTCACATTCGAACGGTCT) were used to amplify P cebR ; Amplify the reporter gene using primers Tcherry_F / R (AAAAGGAGCCTTTAATTGTACGAATTCAAGTGCATGGCCA / TCTAAGTAAGGAGTTCAGCCATGGTGAGCAAGGGCGAG) mCherry , using primers Tmut3_F / R (TCTAAGTAAGGAGACTGCACATGCGGAAGGGCGAGGAGCT / CCTGGTTCCTTCTTGTTGTTTCACTTGTACAGCTCGTCCA) to amplify the reporter gene gfpmut3.1The PCR conditions were as described above. The purified DNA fragments were recombined in vitro with the backbone fragment of the pSET152 plasmid (Qiu S, 2023, Metabolic Engineering, 81: 210-226) double-digested with BamHI and XbaI using NovoRec Plus recombinase to construct the pSET152-Toggle plasmid.
[0066] To optimize the bistable circuit, we first engineered the inhibitory protein. ci434 Derived from bacteriophage 434, ci Derived from bacteriophage λ, both were synthesized by GenScript Biotech Co., Ltd. The linker used for fusion contains 10 amino acids with the sequence: Gly-Gly-Gly-Gly-Gly-Ser-Gly-Gly-Gly-Gly-Ser. The specific plasmid construction method is as follows: Constructing CebR The method is as follows: first, primers 152cebR_F / R (AACAACAAGAAGGAACCAGG / GGAAGAATCCCGCCCCACCA) are used to amplify the cebR Gene, sfgfp The DNA fragments of the gene and the pSET152 plasmid backbone were amplified simultaneously using primers CI_F / R (TGGTGGGGCGGGATTCTTCCGGTGGCGGTGGCAGCGGTG / CCTGGTTCCTTCTTGTTGTTTCAGCCAAACGTCTCTTCAG) ci The two DNA fragments were purified and recombined in vitro using NovoRec Plus recombinase to construct pSET152-CebR Plasmid. Construction of CymR The method is as follows: first, primer 152cymR_F / R (AACAACAAGAAGGAACCAGG / CCGCTTGAACTTGGCGTACC) is used to amplify the cymR Gene, sfgfp The DNA fragments of the gene and the pSET152 plasmid backbone were amplified simultaneously using primers CI434_F / R (GGTACGCCAAGTTCAAGCGGGGTGGCGGTGGCAGCGGTGG / CCTGGTTCCTTCTTGTTGTTTCATACGAATTTTACCCTCGCTTCC). ci434 and Linker sequences, and the amplification reaction and in vitro recombination conditions were the same as CebR The construction of pSET152-CymR Then transform the P cebR Promoter, optimized P cebR The mutation sequence is located in the N17 sequence between the promoter -35 region and -10 region, where P cebR -1 5'-AGCCGACCTATAAACA-3', P cebR -2 5'-CGACCCACTTTCGCTG-3', P cebR -3 5'-ATGGGTCCGCCTCGAG-3', P cebR -4 The mutant sequences were introduced by primers.
[0067] In order to integrate the optimization results into the same plasmid to form the optimized bistable circuit, primers Tmut3_F and Tcherry_R were used to amplify the plasmid backbone and two reporter genes using pSET152-Toggle as a template, and primers R2_F and Toggle _R(GTGCAGTCTCCTACTTAGATCAGCCAAACGTCTCTTCAG) to pSET152-CebR Plasmid as template amplification cebR , using primer Toggle _F (GGCTGAACTCCTTACTTAGATCATACGAATTTTACCCTCGC) and R1_R with pSET152-CymR Plasmid as template amplification cymR The PCR conditions are as shown above. The purified DNA fragments were recombined in vitro using NovoRecPlus recombinase to construct pSET152-Toggle plasmid.
[0068] Specifically, the construction method of the trigger-stabilizer gene circuit is as follows: To obtain the stabilizer module, remove the two reporter genes gfpmut3.1 and mCherry , using primer Toggle (-)_F / R (CAGGGGCGGGGTTTTTTTTTTCATACGAATTTTACCCTCGC / GGTTCCTTCTTGTTGTTTCAGCCAAACGTCTCTTCAGGCC) with pSET152-Toggle The PCR conditions for the optimized bistable circuit for template amplification are as shown above. The purified DNA fragment was then double-digested with EcoRI and XbaI to form pSET152-Toggle NovoRec Plus recombinase was used to construct pSET152-Toggle (-). Then use primer P cymR gfp_F / R (AAGGAGCCTTTAATTGTACGGATCCTAGTTCGTCACATCCT / ACAGCATGGCCATGCACTTGCGAATTCAAGTGCATGGCC) to pSET152-CymR Plasmid was used as template to amplify another P cymR Promoter-controlled reporter gene gfpmut3.1 PCR conditions are as shown above. The purified DNA fragment was cleaved with EcoRI-digested pSET152-Toggle The (-) plasmid fragment was recombined in vitro using NovoRec Plus recombinase to construct the pSET152-Stabilizer plasmid.
[0069] To combine the trigger and stabilizer modules, first build the trigger P QS Started cebR The element was cloned into pSET152-CebR using primers TcebR_F / R (GTGCAGGACTGGGGGAGTTGATGGTGACAGGCCACGGGGC / TCTTGTTGTTTCAGCCAAACGTCTCTTCAG). Plasmid as template amplification cebR The PCR conditions were as above, and primers 152PQS_F / R (GTTTGGCTGAAACAACAAGAAGGAACCAGG / AACTCCCCCAGTCCTGCACGCT) were used to amplify the pSET152-P QS - gfp Plasmid was used as template for amplification of the QSThe pSET152 plasmid backbone was sequenced and the PCR conditions were as shown above. The purified DNA fragments were recombined in vitro using NovoRec Plus recombinase to construct pSET152-P QS - cebR Plasmid. The primers Trigger_F / R (ACAGCATGGCCATGCACTTGAATTCTGTTCACATTCGAACGGTCT / AGCATGGCCATGCACTTGCGGGCTGCAGGTCGACTCTAGT) were used to amplify the expression of pSET152-P QS - cebR P was amplified as a template QS - cebR The sequence and PCR conditions are as shown above. The purified DNA fragment was recombined with the pSET152-Stabilizer plasmid fragment digested with EcoRI in vitro using NovoRec Plus recombinase to construct the pSET152-TS plasmid.
[0070] Specifically, the amplifier is constructed as follows: σ antA and its recognized promoter P ON Derived from Streptomyces albus S. albidoflavus J1074 (Ryan F, 2014, PeerJ, 2: e253), amplified using primers antA_F / R (GTGCAGGACTGGGGGAGTTGATGAACACCGCGCACGAACTG / GACCGTTCGAATGTGAACAGGAAGGGCGATACACGAATTC) σ antA The P gene was amplified using primers antG_F / R (GCGAAGAGGCCCGCACCGATCCCTCCCGATCCGCCGCGT / CGCATGCCTTCTCCTCTTCACTCAGCCGCGG). ON Promoter, gfp_F / R (TGAAGAGGAGAAGGCATGCGGAAGGGCGAGGAGCT / CGAATTCAAGTGCATGGCCATGCTGTC) was amplified using pSET152-sfgfp plasmid (Qiu S, 2023, MetabolicEngineering, 81: 210-226) as a template sfgfpThe reporter gene and PCR conditions are as shown above. The purified DNA fragment was recombined with the pSET152-TS plasmid fragment digested with BamHI and SpeI in vitro using NovoRec Plus recombinase to construct pSET152-TSA- sfgfp plasmid.
[0071] Specifically, the construction method of the flipper is as follows: The flipper contains the constitutive promoter P ermE controlled dCas9 gene, remove the P of the RBS sequence ON or P ON The gRNA backbone and 20 nt spacer sequence under the control of the mutant promoter were first ligated to the gRNA backbone. The spacer sequence was obtained from CRISPy-web (https: / / crispy.secondarymetabolites.org) and directly annealed with primers gRNA-mCherry_F / R (CTCAGTCCTAGGTATAATACTAGTGCGCATGAACTCCTTGATGATTTTAGAGCTAGAAATAGCAAGTT / AACTTGCTATTTCTAGCTCTAAAATCATCAAGGAGTTCATGCGCACTAGTATTATACCTAGGACTGAG). The spacer sequence was then recombined in vitro with the BsaI-digested pSET-dCas9Rg-2 plasmid (Yan H, 2025, Nature communications, 16: 1883) using NovoRec Plus recombinase to construct the pSET-dCas9RgmCherry-2 plasmid.
[0072] dCas9 The gene and gRNA backbone were derived from the pSET-dCas9RgmCherry-2 plasmid and amplified using primers dCas9_F / R (AATCGCCTTGCAGCACATCCGCTGCAGGTCGACTCTAGAC / GAACAGGAAGGGCGATACACTACACTTTATGCTTCCGGCT) dCas9 The purified DNA fragments were recombined with the pSET152-TSA plasmid fragment digested with EcoRI in vitro using NovoRec Plus recombinase to construct pSET152-TSA- dCas9 plasmid.
[0073] Although the present invention has been described in detail above using general descriptions and specific embodiments, it will be apparent to those skilled in the art that modifications and improvements may be made based on the present invention. Therefore, such modifications and improvements, which do not depart from the spirit of the present invention, are intended to be within the scope of protection claimed herein.
Claims
1. A method for constructing a genetically engineered bacterium with high yield of avermectin B2a using multi-objective optimization technology, characterized in that: The following steps are involved: (1) Knockout of Streptomyces avermitilis ( Streptomyces avermitilis ) aveC and aveD Gene, obtained strain △ aveCD ; (2) Design primers to amplify the P ermE - dCas9 The purified DNA fragment was then cleaved with EcoRI / XbaI digested pSET152-TSA- dCas9 The plasmid fragments were recombined in vitro using NovoRec Plus recombinase to construct the pSET152-SMARTS plasmid; Among them, pSET152-TSA- dCas9 Plasmid carrying P cymR - antA 、P QS - cebR 、P cymR - cebR and P cebR -2 - cymR sequences, whose nucleotide sequences are shown in SEQ ID NOs: 55, 57, 58 and 59, respectively; P ermE - dCas9 The nucleotide sequence is shown in SEQ ID NO: 56; (3) Integrate the pSET152-SMARTS plasmid into strain △ through conjugation transfer aveCD Genome-wise, strain AveB20 was obtained; (4) Design primers to amplify P 48 、P 46 、P 26 、P 30 Mutate the promoter sequence and then 48 Target gene meiC , P 46 Target gene aveR , P 46 Target gene avtAB , P 26 Target gene fadD , P 30 Target gene bicA-ecaA The sequences were assembled together using fusion PCR technology; Design primers to amplify the P 32 Mutate the promoter sequence and combine it with the targeting sucCD The gRNA sequences of the genes were assembled together using fusion PCR technology; Among them, genes meiC Derived from Streptomyces nanchangensis ( Streptomyces nanchangensis ), whose reference sequence number in NCBI is AAM97313.1; Gene aveR and avtAB Derived from Streptomyces avermitilis, their reference sequence numbers in NCBI are SAVERM_935 and SAVERM_933-934; Gene fadD Derived from Streptomyces coelicolor ( Streptomyces coelicolor ), whose reference sequence number in NCBI is SCO6196; Gene bicA-ecaA Depend on bicA and ecaA composition, bicA Derived from cyanobacteria Synechococcus sp. PCC7002, ecaA Derived from Anabaena Anabaena sp. PCC7120, whose reference sequence numbers in NCBI are WP_065714188.1 and WP_012307967.1, respectively; sucCD The gene is derived from Streptomyces avermitilis, sucC1 、 sucC2 、 sucD1 and sucD2 composition, and their reference sequence numbers in NCBI are SAVERM_1818, SAVERM_3452, SAVERM_1817, and SAVERM_3451, respectively; P 48 、P 46 、P 26 、P 30 、P 32 The mutant promoter is derived from Streptomyces albicans ( Streptomyces albidoflavus ) ON promoter mutations; P 48 、P 46 、P 26 、P 30 、P 32 The N17 sequences in the mutant promoter nucleotide sequence are as follows: P 48 :5′-CAGACAAGGAAGACTA-3′ P 46 :5′-TGGAATCCCTGAGAACC-3′ P 26 :5′-CGCGCAAAACCACAACT-3′ P 30 :5′-TCGCATTTCCTCACCCA-3′ P 32 :5′-TTTCTTAAACGTCAAGT-3′ The P ON The nucleotide sequence of the promoter is shown in SEQ ID NO: 3; (5) The target gene expression cassettes controlled by the six mutant promoters obtained above were recombined in vitro with the pSOK616 plasmid fragment double-digested with SpeI / HindIII using NovoRec Plus recombinase to construct the pSOK616-AveB22 plasmid, which was then integrated into the genome of the strain AveB20 by conjugation transfer.
2. The method according to claim 1, characterized in that Targeting as described in step (4) sucCD The gRNA sequences of the genes are as follows: Targeted sucC1 The gRNA sequence was: 5′-CCCTTGCCTGGTGTTCGTAC-3′; Targeted sucC2 The gRNA sequence was: 5′-GTCGCCTCGCGGGCCGCCTC-3′; Targeted sucD1 The gRNA sequence was: 5′-GGACCTTGCTCTCCTTGGTG-3′; Targeted sucD2 The gRNA sequence is: 5′-TGACCTTGCTGTCCTTGTTG-3′.
3. A genetically engineered bacterium that produces high-yield avermectin B2a constructed according to the method of claim 1 or 2.
4. Use of the genetically engineered bacteria according to claim 3 in the fermentation production of avermectin B2a.
5. A method for increasing the fermentation yield of avermectin B2a, characterized in that: The genetically engineered bacteria according to claim 3 are used to ferment and produce avermectin B2a.
6. The method according to claim 5, characterized in that The method comprises: culturing the genetically engineered bacteria in MS solid medium for 3-4 days, collecting spores of the genetically engineered bacteria in 2×YT medium, inoculating the spores in industrial seed medium for 2-3 days, and then inoculating the spores in industrial fermentation medium for 10-12 days; The formula of the MS solid culture medium is: 16-20 g / L soybean powder, 16-20 g / L mannitol and 20 g / L agar powder; The formula of the 2×YT medium is: 16-20 g / L peptone, 8-10 g / L yeast extract and 10 g / L sodium chloride; The formula of the industrial seed culture medium is: 28-34 g / L of soluble starch, 4-5 g / L of yeast extract, 2-3 g / L of soybean powder or soy peptone, and 5 mL / L of a cobalt chloride hexahydrate solution with a concentration of 1 g / L; The formula of the industrial fermentation medium is: 60-70 g / L corn starch, 10-15 g / L soybean powder or soy peptone, 10-15 g / L yeast extract, 0.4-0.6 g / L dipotassium hydrogen phosphate trihydrate or potassium dihydrogen phosphate, 0.4-0.5 g / L magnesium sulfate heptahydrate or magnesium chloride heptahydrate, 1-2 g / L calcium carbonate, and 5 mL / L of a 1 g / L cobalt chloride hexahydrate solution.
7. The method according to claim 6, characterized in that After culturing the genetically engineered bacteria on MS solid medium for 4 days, spores of the genetically engineered bacteria were collected on 2×YT medium, inoculated on industrial seed medium for culturing for 2 days, and then inoculated on industrial fermentation medium for culturing for 12 days.
8. The method according to claim 6, characterized in that The formula of the MS solid culture medium is: 20 g / L soybean powder, 20 g / L mannitol and 20 g / L agar powder; The formula of the 2×YT medium is: 16 g / L peptone, 10 g / L yeast extract and 10 g / L sodium chloride; The formula of the industrial seed culture medium is: 30 g / L soluble starch, 4 g / L yeast extract, 2 g / L soybean powder or soy peptone, and 5 mL / L of 1 g / L cobalt chloride hexahydrate solution; The formula of the industrial fermentation medium is: 70 g / L corn starch, 15 g / L soybean powder or soy peptone, 10 g / L yeast extract, 0.5 g / L dipotassium hydrogen phosphate trihydrate or potassium dihydrogen phosphate, 0.5 g / L magnesium sulfate heptahydrate or magnesium chloride heptahydrate, 1 g / L calcium carbonate, and 5 mL / L of a 1 g / L cobalt chloride hexahydrate solution.
9. The method according to any one of claims 6 to 8, characterized in that: The culture temperature is 28-30℃.
10. The method according to claim 9, characterized in that The culture temperature was 28°C.