Use of circFARSA as a diagnostic marker in the preparation of a diagnostic kit for early pregnancy loss

Abstract

The application provides application of circFARSA as a diagnostic marker in preparation of an early pregnancy loss diagnosis kit, relates to the technical field of biological diagnosis targets, and proves through experiments that the expression level of circFARSA in chorionic tissue of patients with early pregnancy loss is significantly changed, and circFARSA can be used as a novel clinical diagnostic marker for early pregnancy loss. Through specific verification experiments, it is found that by detecting the expression level of circFARSA in the tissue sample of a subject, the occurrence of early pregnancy loss can be effectively judged. It is also found that circFARSA can play a protective role in early pregnancy loss by regulating the apoptosis process. These findings not only provide important clues for in-depth understanding of the pathogenesis of early pregnancy loss, but also lay a theoretical foundation for the development of clinical diagnosis and treatment strategies, and have important scientific research value and clinical application prospect.

Description

Technical Field

[0001] This invention relates to the field of biological diagnostic target technology, and in particular to the application of circFARSA as a diagnostic biomarker in the preparation of diagnostic kits for early pregnancy loss. Background Technology

[0002] Early pregnancy loss refers to the natural loss of the embryo or fetus before 12 weeks of gestation and is one of the common complications in early pregnancy. The pathogenesis of early pregnancy loss is complex, involving multiple factors such as chromosomal abnormalities, genetic factors, reproductive tract malformations, infections, immune dysfunction, endocrine abnormalities, environmental factors, and psychological factors. However, the specific pathogenic mechanisms are not yet fully understood. Current research indicates that many differentially expressed genes exist in the chorionic villi tissue of early pregnancy loss. These genes may affect cell function and survival through signaling pathways such as apoptosis and oxidative stress, thereby affecting the maintenance of pregnancy.

[0003] Circular RNAs (circRNAs) are a class of special RNA molecules with closed circular structures and high stability. Recent studies have found that circRNAs play important roles in various physiological and pathological processes, such as regulating gene expression and influencing apoptosis. In early pregnancy, circRNAs may participate in placental development and function through multiple pathways, such as by interacting with other proteins or RNA molecules to form complex regulatory networks that affect placental development and function. In-depth research on the role of circRNAs in early pregnancy loss will help to reveal its pathogenesis, provide new biomarkers and therapeutic targets for the diagnosis and treatment of early pregnancy loss, thereby improving pregnancy outcomes and enhancing the reproductive health of women of childbearing age. Summary of the Invention

[0004] The purpose of this invention is to address the lack of research on the mechanism of action of circRNA in early pregnancy loss in the prior art.

[0005] To achieve the above objectives, the present invention adopts the following technical solution: Application of circFARSA as a diagnostic biomarker in the preparation of diagnostic kits for early pregnancy loss.

[0006] Preferably, detecting changes in circFARSA expression levels can provide objective evidence for the diagnosis of early pregnancy loss.

[0007] Preferably, the kit uses quantitative real-time PCR to analyze and detect the expression level of circFARSA in the subject's tissue samples.

[0008] Preferably, the sample tissue is villous tissue.

[0009] Preferably, the sequence information of the circFARSA is: The sequence of the circFARSA is shown in SEQ ID: NO 01; Preferably, the primer information for circFARSA is as follows: circFARSA-F: 5'AAGGTCCGCTCCCAGTT 3'; circFARSA-R: 5' TGCTCACCCAGTAGGTCTTC 3'.

[0010] This application also provides a diagnostic kit for diagnosing early pregnancy loss, wherein the diagnostic kit targets circFARSA. Preferably, the diagnostic kit is a diagnostic kit that uses quantitative real-time PCR for detection.

[0011] Compared with the prior art, this application has the following beneficial effects: This invention experimentally demonstrates that the expression level of circFARSA in the chorionic villus tissue of patients with early pregnancy loss is significantly altered, and circFARSA can serve as a novel clinical diagnostic biomarker for early pregnancy loss. This application, through specific verification experiments, discovered that detecting the expression level of circFARSA in tissue samples from subjects can effectively determine the occurrence of early pregnancy loss. More importantly, this application finds that circFARSA can play a protective role in early pregnancy loss by regulating the apoptosis process. These findings not only provide important clues for a deeper understanding of the pathogenesis of early pregnancy loss but also lay a theoretical foundation for the development of clinical diagnostic and treatment strategies, possessing significant scientific research value and clinical application prospects. Attached Figure Description

[0012] Figure 1 Figure A shows the expression pattern of circFARSA in early pregnancy loss. Figure A shows the expression level of circFARSA in chorionic villus tissue of patients with early pregnancy loss and normal chorionic villus tissue (Student's t-test was used, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001, total sample size N=46, control group and experimental group each had 23 samples); Figure B shows the expression pattern of circFARSA in HTR-8 / SVneo cells.

[0013] Figure 2To investigate the effect of circFARSA knockdown on cell proliferation and apoptosis in HTR-8 / SVneo cells. (A) Verification of circRNA interference efficiency (using Student's t-test, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001); (B) CCK8 cell proliferation assay; (C) TUNEL staining of HTR-8 / SVneo cells; (D) Statistical analysis of the percentage of TUNEL-positive cells; (E) Cleaved Caspase-3 staining of HTR-8 / SVneo cells; (F) Statistical analysis of the percentage of Cleaved Caspase-3-positive cells.

[0014] Figure 3 To investigate the effect of circFARSA overexpression on cell proliferation and apoptosis in HTR-8 / SVneo cells. (A) Verification of circRNA overexpression efficiency (using Student's t-test, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001); (B) CCK8 cell proliferation assay; (C) TUNEL staining of HTR-8 / SVneo cells; (D) Statistical analysis of the percentage of TUNEL-positive cells; (E) Cleaved Caspase-3 staining of HTR-8 / SVneo cells; (F) Statistical analysis of the percentage of Cleaved Caspase-3-positive cells. Detailed Implementation

[0015] The present invention will be further described in detail below with reference to specific embodiments.

[0016] This application provides the application of circFARSA as a diagnostic biomarker in the preparation of a diagnostic kit for early pregnancy loss. By detecting changes in the expression level of circFARSA, objective evidence can be provided for the diagnosis of early pregnancy loss.

[0017] In one embodiment, the kit uses quantitative real-time PCR to analyze and detect the expression level of circFARSA in subject sample tissue. The sample tissue is villous tissue.

[0018] The primer information for circFARSA is as follows: circFARSA-F: 5'AAGGTCCGCTCCCAGTT 3'; circFARSA-R: 5' TGCTCACCCAGTAGGTCTTC 3'.

[0019] The above content will be described in detail below with reference to specific implementation methods: Experimental materials and their sources: 1 <![CDATA[Purelink TM RNA Mini Kit]]> Invitrogen 2 PrimeScript™ 1st Strand cDNA Synthesis Kit TAKARA 3 TB Green® Premix Ex Taq™ II (Tli RNaseH Plus) TAKARA 4 FISH probe Gemma Gene 5 FISH kit Gemma Gene 6 siRNA Gemma Gene 7 plasmid Jin Weizhi 8 Cell Counting Kit-8 New Saimei 9 One-step TUNEL apoptosis detection kit Azure Sky 10 Cleaved Caspase 3 CST 11 Alexa Fluor® 647 AffiniPure™ Goat Anti-rabbit IgG (H+L) Jackson ImmunoResearch Laboratories

[0020] Example 1: Expression pattern of circFARSA in early pregnancy loss The expression pattern of circFARSA was observed in the villous tissue of the control group (induced abortion group) and the experimental group (early pregnancy loss group). The expression pattern of circFARSA in villous tissue / cells was observed using methods such as quantitative real-time PCR and RNA in situ hybridization.

[0021] (1) Specimen collection: Patients with missed abortion were selected as the experimental group (early pregnancy loss group), while patients with normal pregnancies who were scheduled for termination of pregnancy during the same period were selected as the control group (induced abortion group). All selected pregnant women had no recent evidence of infection, chromosomal abnormalities, immune diseases, and had not received any treatment to prevent miscarriage. Chorionic villus samples were collected from both groups after curettage, and the blood was washed away with physiological saline. The chorionic villus tissue was placed in cryovials and placed at -80°C for half an hour, to be used for future experiments such as quantitative real-time PCR. (2) Real-time PCR Total RNA was extracted from chorionic villus tissue, and the RNA was reverse transcribed into cDNA using a reverse transcription kit, followed by amplification using a quantitative real-time PCR kit. The relative expression level of circFARSA was calculated using CT values. The quantitative real-time PCR results showed that the expression level of circFARSA was downregulated in early pregnancy chorionic villus tissue. Figure 1 A).

[0022] (3) Cell culture Human trophoblast cells HTR-8 / SVneo were cultured in a 37°C, 5% CO2 cell culture incubator using DMEM / F12 + 10% FBS + 1% P / S medium as the complete culture medium.

[0023] (4) RNA in situ hybridization staining Cells were seeded in 12-well plates and incubated overnight at 37ºC with 5% CO2. After washing twice with PBS, 1 mL of 4% paraformaldehyde was added to each well, and the cells were fixed at room temperature for 15 min. The 4% paraformaldehyde was then removed, followed by RNA in situ hybridization staining. The staining method mainly included blocking, probe incubation and washing, nucleus staining, and mounting. Finally, the cells were observed and photographed under a fluorescence microscope. The results showed that circFARSA was expressed in both the nucleus and cytoplasm. Figure 1 B).

[0024] Example 2: Functional analysis of circFARSA in an early pregnancy loss model

[0025] (1) Cell culture Human trophoblast cells HTR-8 / SVneo were cultured in a 37°C, 5% CO2 cell culture incubator using DMEM / F12 + 10% FBS + 1% P / S medium as the complete culture medium.

[0026] (2) CCK-8 assay for cell proliferation Cells in the logarithmic growth phase were seeded at a density of 1 × 10⁵ cells per well into 6-well plates, with 2 mL of complete culture medium added to each well. The plates were then incubated at 37°C with 5% CO₂. After 24 hours, transfection was performed, and the cells were cultured for another 6-8 hours. Cells were then digested with 0.25% trypsin (without EDTA) and collected. The cells were then seeded at a density of 2000 cells per well into 96-well plates. Once the cells adhered, 10 μL of CCK-8 solution was added to each well, and the plates were gently shaken to ensure thorough mixing. After 2 hours of incubation, the absorbance (OD value) of each well was measured at 450 nm using a microplate reader. Cell growth curves were plotted based on the OD values ​​at different time points.

[0027] (3) TUNEL assay for cell apoptosis Logarithmically growing cells were seeded into 24-well plates and cultured at 37°C in a 5% CO2 incubator. After cell growth onto slides, the cells were pretreated for 24 hours and then cultured for another 48 hours. The cells were then fixed with 4% PFA for half an hour, washed with PBS, and treated with 0.3% Triton X-100 for 5-10 minutes. After washing twice with PBS, TUNEL assay solution was added and incubated at 37°C in the dark for 60 minutes. Care was taken to minimize the evaporation of the TUNEL assay solution. After washing three times with PBS, DNA staining, mounting, and other procedures were performed, and the cells were observed under a fluorescence microscope.

[0028] (4) Immunofluorescence staining After cell culture, the cells were pretreated for 24 hours and then cultured for another 48 hours. They were then fixed with 4% PFA for half an hour, washed with PBS, and treated with 0.3% Triton X-100 for 5-10 minutes. After blocking, the cells were incubated with primary antibody at 4°C overnight, washed three times with PBS, incubated with secondary antibody, washed with PBS, stained with DNA, and mounted. The cells were then stored in a dark box. The fluorescence signal of the target protein was recorded by observation and imaging using a fluorescence microscope.

[0029] To further investigate the role of circFARSA in HTR-8 / SVneo, circFARSA expression was silenced via siRNA transfection, and the interference efficiency was verified using qRT-PCR technology. Figure 2 A). CCK8 results showed that downregulation of circFARSA significantly inhibited cell proliferation (A). Figure 2 B). Tunel staining showed that downregulating circFARSA expression levels increased the percentage of Tunel-positive cells. Figure 2CD). Immunofluorescence results showed that downregulating circFARSA expression levels increased the ratio of Cleaved Caspase-3 positive cells. Figure 2 These results suggest that circFARSA regulates cell proliferation and apoptosis.

[0030] Simultaneously, overexpression of circFARSA was achieved through plasmid transfection, and the overexpression efficiency was verified using qRT-PCR technology. Figure 3 A). CCK8 results showed that upregulation of circFARSA significantly promoted cell proliferation. Figure 3 B). Tunel staining results also showed that upregulating circFARSA expression levels could reduce the percentage of Tunel-positive cells (B). Figure 3 CD). Immunofluorescence results showed that upregulating circFARSA expression levels reduced the percentage of Cleaved Caspase-3 positive cells. Figure 3 These results further suggest that circFARSA regulates cell proliferation and apoptosis.

[0031] In summary, this application experimentally verified that the expression level of circFARSA in the chorionic villus tissue of patients with early pregnancy loss is significantly altered, suggesting that circFARSA can serve as a novel clinical diagnostic biomarker for early pregnancy loss. The study also found that detecting the expression level of circFARSA in tissue samples from subjects can effectively determine the occurrence of early pregnancy loss. More importantly, this application discovered that circFARSA plays a protective role in early pregnancy loss by regulating the apoptosis process. These findings not only provide important clues for a deeper understanding of the pathogenesis of early pregnancy loss but also lay a theoretical foundation for the development of clinical diagnostic and treatment strategies, possessing significant scientific research value and promising clinical application prospects.

Claims

1. Application of circFARSA detection primers in the preparation of a diagnostic kit for early pregnancy loss, wherein the kit uses chorionic villus tissue as the detection sample.

2. The application of the circFARSA detection primers according to claim 1 in the preparation of an early pregnancy loss diagnostic kit, characterized in that: Detecting changes in the expression level of circFARSA in chorionic villus tissue can provide objective evidence for the diagnosis of early pregnancy loss.

3. The application of the circFARSA detection primers according to claim 2 in the preparation of an early pregnancy loss diagnostic kit, characterized in that: The kit was used to detect the expression level of circFARSA in villous tissue using real-time PCR.

4. The application of the circFARSA detection primers according to claim 1 in the preparation of an early pregnancy loss diagnostic kit, characterized in that: The sequence of the circFARSA is shown in SEQ ID NO: 01; The primer information for circFARSA is as follows: circFARSA-F: 5'AAGGTCCGCTCCCAGTT 3'; circFARSA-R: 5' TGCTCACCCAGTAGGTCTTC 3'.

Images