SNP molecular markers associated with pig carcass length and muscle color value, their detection primers and kits, and their applications.

Abstract

This invention belongs to the field of marker-assisted breeding technology, and specifically relates to a SNP molecular marker related to pig carcass length and muscle color value, its detection primers and kits, and their applications. The SNP molecular marker has GG, CC, and CG genotypes, with pigs of the GG genotype exhibiting superior meat quality traits compared to those of the CG and CC genotypes. This invention, by detecting the genotype of this molecular marker, can transform phenotypic judgment into genotype identification, providing a detection technique for simultaneous early selection of multiple traits and improving the breeding efficiency of superior meat-quality pigs. It also provides a reliable target site for the genetic improvement of pork quality traits. By selecting breeding pigs that retain the GG genotype, the frequency of the GG genotype in the population can be gradually increased, which is beneficial for rapidly breeding pig populations with high meat yield and good meat quality, providing a rapid and effective approach for the population improvement of pig carcass length and muscle color value.

Description

Technical Field

[0001] This invention relates to the field of molecular marker-assisted breeding technology, and in particular to an SNP molecular marker related to pig carcass length and muscle color value, its detection primers and kits, and its applications. Background Technology

[0002] Pork is one of the most widely consumed meats globally. Carcass and muscle color values ​​are important economic traits in pork. Carcass traits reflect a pig's meat production performance, while muscle color values ​​reflect muscle quality. Healthy pork muscle should be bright red or vivid red with a sheen, and these are the meat quality indicators that consumers care about most. Genetic improvement of these traits directly impacts the economic benefits of pig farming and is one of the core breeding goals of pig genetic improvement.

[0003] Currently, carcass and meat quality traits of pigs are usually measured after slaughter, which has problems such as high measurement costs, long measurement cycles, and large workload, greatly increasing breeding costs and lengthening generation intervals. This slows down the progress of phenotypic selection-based breeding work and greatly limits the selection of superior meat quality replacement pigs in production.

[0004] Genetic factors are key to improving meat quality. Meat quality traits are mostly quantitative traits, controlled by multiple genes, and exhibit major gene effects. The rapid development of molecular biology techniques and the construction of pig genome linkage maps have enabled the identification of major genes controlling meat quality traits or closely linked molecular markers at the DNA level. These markers are used for marker-assisted selection in breeding, facilitating the improvement of carcass and meat quality traits at the gene level. Several major candidate genes influencing pork quality traits have been identified, such as leptin, leptin receptor, adiponectin, adiponectin receptor, lipoprotein lipase, and forkhead transcription factor group O1 genes. However, the current analysis of functional genes that simultaneously affect carcass and meat quality traits is insufficient, and there are few molecular markers that can be applied to genetic breeding. Therefore, finding key molecular genetic markers that control pig carcass and meat quality traits and applying them to molecular marker-assisted breeding to simultaneously improve meat yield and meat quality has become one of the current hot topics in pig genomics and genetic breeding research.

[0005] Single nucleotide polymorphism (SNP) molecular markers refer to DNA sequence polymorphisms caused by variations in a single nucleotide at the genomic level, including single-base transversions, transitions, insertions, and deletions. They are the most numerous and widely distributed molecular markers in the genome, possessing advantages such as ease of genotyping, good genetic stability, and ease of automation and batch processing, and are considered the most valuable next-generation genetic markers. Discovering and applying SNP markers associated with carcass and muscle color values ​​in pigs is of great significance for improving the overall economic benefits and healthy, sustainable development of the pig farming industry. Summary of the Invention

[0006] To address the problems existing in the prior art, this invention provides a SNP molecular marker related to pig carcass length and muscle color value. This molecular marker indicates the intergroup carcass length, muscle color value L1, and muscle color value L1 of different genotype populations. 24 Significant phenotypic differences were observed, with individuals of the GG genotype exhibiting longer carcasses and better muscle color values. Therefore, detecting the genotype of this molecular marker allows for the conversion of phenotypic judgment into genotypic identification, providing a detection technique for simultaneous early selection of multiple traits and improving the breeding efficiency of superior meat-quality pigs. It also provides a reliable target site for the genetic improvement of pork quality traits. This invention thus provides the application of this SNP molecular marker, its detection primers, or kits in meat quality trait assessment or breeding. Specifically, this invention is achieved through the following technical solutions:

[0007] The first aspect of this invention provides an SNP molecular marker related to pig carcass length and muscle color value, and its detection primers or kits for use in the evaluation or breeding of pork quality traits; the SNP molecular marker is located at the 62nd base of the nucleotide sequence shown in SEQ ID NO.1, S is selected from G or C, and the SNP molecular marker has GG, CC and CG genotypes; wherein, the meat quality traits of pig individuals with the GG genotype are superior to those of pig individuals with the CG genotype and CC genotype.

[0008] Furthermore, the meat quality characteristics include carcass length, muscle color value L1, and / or muscle color value L. 24 Among them, pigs with the GG genotype have higher carcass length, muscle color value L1, and / or muscle color value L. 24 Superior to pig individuals with CG and CC genotypes.

[0009] Furthermore, the pig in question is a selenium-rich black pig.

[0010] A second aspect of the present invention provides a detection primer for detecting SNP molecular markers associated with pig carcass length and muscle color value, wherein the SNP molecular marker is located at the 62nd base of the nucleotide sequence shown in SEQ ID NO.1, and S is selected from G or C; the detection primer includes an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.3.

[0011] A third aspect of the present invention provides a kit for detecting SNP molecular markers related to pig carcass length and muscle color value, the kit comprising the detection primers as described above.

[0012] A fourth aspect of the present invention provides a method for evaluating pork quality traits, comprising the following steps:

[0013] Genomic DNA was extracted from the pigs to be tested;

[0014] The genomic DNA was amplified using polymerase chain reaction (PCR) technology using the detection primers shown in SEQ ID NO.2-3 to obtain the amplification product;

[0015] The genotype of the 62nd base of the amplification product was detected, and the 62nd base had the genotypes GG, CC, and CG.

[0016] The meat quality traits of the tested pig individuals were evaluated based on the genotype detection results at the 62nd base. The meat quality traits of the tested pig individuals with the GG genotype were superior to those of the tested pig individuals with the CG and CC genotypes.

[0017] Furthermore, the meat quality characteristics include carcass length, muscle color value L1, and / or muscle color value L. 24 Among them, pigs with the GG genotype have higher carcass length, muscle color value L1, and / or muscle color value L. 24 Superior to pig individuals with CG and CC genotypes.

[0018] The fifth aspect of this invention provides a method for genetically improving pork quality traits, comprising the following steps:

[0019] Genomic DNA was extracted from the pigs to be tested;

[0020] The genomic DNA was amplified using polymerase chain reaction (PCR) technology using the detection primers shown in SEQ ID NO.2-3 to obtain the amplification product;

[0021] The genotype of the 62nd base of the amplification product was detected, and the 62nd base had the genotypes GG, CC, and CG.

[0022] Based on the genotype detection results of the 62nd base, the tested pig individuals with the GG genotype were retained as breeding pigs.

[0023] Furthermore, the pig being tested was a selenium-rich black pig.

[0024] The advantages and positive effects of this invention are as follows:

[0025] 1. The SNP molecular markers provided by this invention are related to pig carcass traits and muscle color values ​​(L1 and L2). 24 All three are significantly associated. By determining the genotype of this SNP molecular marker, rapid, accurate, and high-throughput identification or early selection of meat quality traits such as carcass length and muscle color value in pigs can be achieved at the molecular level. This provides an effective and reliable detection technology for breeding pigs with genetic stability and excellent meat quality in multiple traits, which is conducive to accelerating breeding efficiency and accuracy.

[0026] 2. The SNP molecular markers of this invention provide reliable target sites for the genetic improvement of pork quality traits. By selecting breeding pigs that retain the GG genotype, the frequency of the GG genotype in the population can be gradually increased, which is conducive to the rapid breeding of breeding pig populations with high meat yield and good meat quality. This provides a rapid and effective way to improve the population of pig carcass length and muscle color value, which is of great significance to improving the economic benefits of pig farming enterprises. Attached Figure Description

[0027] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0028] Figure 1 This is an agarose gel electrophoresis image of the SNP molecular marker amplification products in an embodiment of the present invention;

[0029] Figure 2 This is a sequencing peak diagram of the nucleotide sequences of different genotypes of SNP molecular markers in an embodiment of the present invention. Detailed Implementation

[0030] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. The embodiments described herein are for illustrative purposes only and are not intended to limit the invention.

[0031] Based on the information contained herein, various changes to the precise description of the invention can be readily made by those skilled in the art without departing from the spirit and scope of the appended claims. It should be understood that the scope of the invention is not limited to the defined processes, properties, or components, as these embodiments and other descriptions are merely illustrative of specific aspects of the invention. In fact, various modifications to embodiments of the invention that will be apparent to those skilled in the art or related fields are covered within the scope of the appended claims.

[0032] To better understand the invention and not to limit its scope, all figures and other numerical values ​​used in this invention to indicate amounts, percentages, or other quantities should, in all cases, be understood to be modified by the word "approximately." Therefore, unless specifically stated otherwise, the numerical parameters listed in the specification and appended claims are approximate values ​​and may vary depending on the desired properties being sought. Each numerical parameter should at least be considered as obtained based on reported significant figures and through conventional rounding methods.

[0033] The terms “comprising,” “including,” “containing,” “having,” and similar words are non-restrictive and can include other steps and other components that do not affect the result. The term “and / or” should be considered as a specific disclosure of each of the two specified features or components, with or without the other. For example, “A and / or B” is considered to include (i) A, (ii) B, and (iii) A and B.

[0034] To make the above-mentioned objectives, features and advantages of the present invention more apparent and understandable, the specific embodiments of the present invention will be described in detail below.

[0035] This invention screened a variant site (g.11537602G>C) in the porcine CREB3L2 gene that is associated with porcine carcass traits and muscle color values ​​(L1 and L). 24 All three genotypes (GG, CC, and GC) were significantly associated, and the differences in carcass length, muscle color value L1, and muscle color value L between different genotype groups were statistically significant. 24 Phenotypic differences were significant, with GG genotype pigs showing the most significant differences in carcass length, muscle color value L1, and muscle color value L. 24 The values ​​were significantly higher than those of pigs with the CG and CC genotypes, resulting in longer carcasses and better muscle color values. The g.11537602G>C variant site of this invention can be independently developed into an SNP molecular marker, providing a new and reliable means for selecting genetically stable breeding pigs with excellent meat quality traits, and enriching genetic resources for breeding.

[0036] The aforementioned g.11537602G>C variant site is located on an intron of the CREB3L2 gene (Ensembl ID: ENSSCG00000016520.4), specifically at 11537602 bp on chromosome 18 (GeneBank ID: CM000829.5) of the pig (Sus scrofa) reference genome Sscrofa11.1 (assembly ID: GCF 000003025.6). Compared to the reference genome, there is a G>C base variation, corresponding to the site number rs345463196 in the Ensembl database.

[0037] Based on this, one embodiment of the present invention provides an application of SNP molecular markers related to pig carcass length and muscle color value, and their detection primers or kits in the evaluation or breeding of pork quality traits; the SNP molecular marker is located at the 62nd base of the nucleotide sequence shown in SEQ ID NO. 1, S is selected from G or C, and the SNP molecular marker has GG, CC and CG genotypes; wherein, the meat quality traits of pig individuals with the GG genotype are superior to those of pig individuals with the CG genotype and CC genotype.

[0038] Specifically, the meat quality characteristics include carcass length, muscle color value L1, and / or muscle color value L. 24 Among them, pigs with the GG genotype have higher carcass length, muscle color value L1, and / or muscle color value L. 24 Superior to pigs with the CG and CC genotypes. Specifically, pigs with the GG genotype have a longer carcass length than those with the CG and CC genotypes, and their muscle color values ​​L1 and / or L... 24 They are better than pigs with the CG and CC genotypes.

[0039] This invention enables rapid, accurate, and high-throughput identification of meat quality traits such as carcass length and muscle color value in pigs at the molecular level by detecting the genotype of the aforementioned SNP molecular markers. Furthermore, it allows for breeding selection based on genetic background, facilitating the prediction of meat quality at any stage of breeding, especially in early development, through SNP molecular marker detection. This allows for the early screening of individuals with superior traits, improving the accuracy and reliability of breeding selection, shortening the breeding cycle for superior pigs, and accelerating breeding efficiency. Specifically, when the SNP locus in a test pig is detected to be of the GG genotype, it can be determined that the pig possesses superior carcass length, muscle color value L1, and muscle color value L. 24 The resulting pigs have higher meat yield and better muscle quality; when the SNP locus in the tested pig is detected to be of the CC genotype, it can be determined that the pig has poor carcass length, muscle color value L1, and muscle color value L. 24The pigs exhibited low meat yield and poor muscle quality. When the SNP mutation site in the tested pig was detected to be of the CG genotype, its trait was intermediate. Furthermore, the discovery of this SNP molecular marker has significant application value for the genetic improvement of pork quality traits. By retaining individuals with the GG genotype for breeding during the breeding process, the proportion of superior genes in offspring can be gradually increased, which is beneficial to enhancing the meat quality of the population. Alternatively, by using the SNP molecular marker site of this invention as a target for genetic breeding improvement, the CC and CG genotypes can be modified to the GG genotype through gene mutation and other methods, achieving GG genotype enrichment, which provides a rapid and effective approach for the population improvement of pig carcass length and muscle color value.

[0040] In this invention, the determination of pig carcass length and muscle color value is carried out in accordance with the People's Republic of China Agricultural Industry Standard "NY / T 821-2019 Technical Specification for Determination of Pork Traits". Specifically, pig carcass length is generally the straight length of the carcass, referring to the straight-line length from the center point of the anterior edge of the pubic symphysis to the anterior edge of the first cervical vertebra; muscle color value L1 refers to the meat color value measured within 45 minutes after slaughter. 24 It refers to the meat color value measured 24 hours after slaughter. The meat color value is obtained by measuring multiple points on the cross-section of the longissimus dorsi muscle at the junction of the thoracic and lumbar vertebrae using a meat color measuring instrument, and calculating the average value.

[0041] The detection of the SNP molecular marker genotype of this invention can be performed using methods commonly used in the prior art, such as gene chip technology, competitive allele-specific PCR (KASP) technology, Taqman probe technology, high-resolution melting curve (HRM) method, allele-specific PCR (AS-PCR) technology, direct sequencing method, and matrix-assisted laser desorption / ionization time-of-flight mass spectrometry.

[0042] The present invention preferably employs the direct sequencing method of PCR products, which includes the steps of extracting the genomic DNA of the pig individual to be tested, PCR amplification of the target fragment, and sequencing of the target fragment. In the sequencing peak diagram, the SNP molecular marker genotype shows a single peak when it is homozygous, and a double peak when it is heterozygous.

[0043] Another embodiment of the present invention provides a detection primer for detecting the SNP molecular markers as described above. The detection primer includes an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer (F) is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer (R) is shown in SEQ ID NO.3.

[0044] Forward primer F: AACTGTTACCTACCTGCTCT (see SEQ ID NO.2);

[0045] Reverse primer R: TCTTGACCTCTAATCCCTC (see SEQ ID NO.3).

[0046] This invention uses the genomic DNA of the pig individual to be tested as a template, and performs PCR amplification using the above-mentioned detection primers. Accurate base information of SNP sites can be obtained through sequencing and other means. The genotyping effect is good, the primer detection results are highly consistent with the actual situation, and the specificity is good, which is conducive to the rapid and accurate identification of SNP molecular markers.

[0047] Another embodiment of the present invention provides a kit for detecting SNP molecular markers as described above, the kit comprising the detection primers as described above.

[0048] The advantages of the kit over existing technologies are the same as those of the detection primers described above, and will not be repeated here.

[0049] Optionally, the kit further includes PCR amplification reagents. The present invention does not specifically limit the source of the PCR amplification reagents; commercially available products commonly used in the art can be used. In a typical embodiment, the PCR amplification reagents include DNA polymerase, dNTPs, and buffer.

[0050] Based on the same inventive concept as described above, another embodiment of the present invention provides a method for evaluating pork quality traits, comprising the following steps:

[0051] Genomic DNA was extracted from the pigs to be tested;

[0052] The genomic DNA was amplified using polymerase chain reaction (PCR) technology using the detection primers shown in SEQ ID NO.2-3 to obtain the amplification product;

[0053] The genotype of the 62nd base of the amplification product was detected, and the 62nd base had the genotypes GG, CC, and CG.

[0054] The meat quality traits of the tested pig individuals were evaluated based on the genotype detection results at the 62nd base. The meat quality traits of the tested pig individuals with the GG genotype were superior to those of the tested pig individuals with the CG and CC genotypes.

[0055] Specifically, the meat quality characteristics include carcass length, muscle color value L1, and / or muscle color value L. 24 Among them, pigs with the GG genotype have higher carcass length, muscle color value L1, and / or muscle color value L. 24 Superior to pig individuals with CG and CC genotypes.

[0056] Based on the same inventive concept as described above, this invention also provides a method for genetically improving pork quality traits, comprising the following steps:

[0057] Genomic DNA was extracted from the pigs to be tested;

[0058] The genomic DNA was amplified using polymerase chain reaction (PCR) technology using the detection primers shown in SEQ ID NO.2-3 to obtain the amplification product;

[0059] The genotype of the 62nd base of the amplification product was detected, and the 62nd base had the genotypes GG, CC, and CG.

[0060] Based on the genotype detection results of the 62nd base, the tested pig individuals with the GG genotype were retained as breeding pigs.

[0061] In this invention, individuals with the superior GG genotype are selected based on the SNP molecular marker genotype and used as breeding pigs. Individuals with the GC and CC genotypes at this locus are gradually culled, which can significantly improve the carcass length, muscle color value L1, and / or muscle color value L in the herd. 24 Isophenotypes can accelerate the breeding process of pig herds with excellent meat quality.

[0062] The preferred pig species mentioned above are selenium-rich black pigs.

[0063] The present invention will be further illustrated below with reference to specific embodiments. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions, such as those described in *Molecular Cloning: A Laboratory Manual (Fourth Edition)* published by Cold Spring Harbor Laboratory, or generally under the conditions recommended by the manufacturer.

[0064] 1. Determination of carcass length and muscle color value phenotypic traits in the experimental group of pigs.

[0065] The experimental pigs used in this invention were 243 castrated male Xidu Black Pigs jointly bred by the Institute of Animal Husbandry and Veterinary Medicine of Hubei Academy of Agricultural Sciences and Hubei Tianzhili High-Quality Pig Breeding Co., Ltd. They were raised indoors at a controlled temperature of 25℃, fed a complete feed of corn and soybean meal, and given free access to feed and water throughout their rearing period. When the pigs reached a weight of 100kg, they were slaughtered at the Ministry of Agriculture's Breeding Pig Quality Supervision and Testing Center (Wuhan) at Huazhong Agricultural University. Pork traits, including carcass length and muscle color value, were measured according to the People's Republic of China agricultural industry standard "NY / T 821-2019 Technical Specifications for Pork Traits Determination".

[0066] Carcass length: The straight-line length from the anterior edge of the pubic symphysis to the anterior edge of the first cervical vertebra, measured with a soft measuring tape, in cm.

[0067] Muscle color value: The meat color is measured at a cross-section of the longissimus dorsi muscle at the thoracic-lumbar junction. The measurement within 45 minutes of slaughter is recorded as the muscle color value L1. After measuring the muscle color value L1, the meat is stored in a refrigerator at 4°C for 24 hours, and the measured value is the muscle color value L. 24 .

[0068] 2. Extraction of genomic DNA from the experimental pig population

[0069] Ear tissue from pigs was collected and extracted using a cell / tissue genomic DNA extraction kit (catalog number: DP1901) manufactured by Beijing Biotech Biotechnology Co., Ltd. The procedure was performed according to the kit instructions. After the concentration and quality of the extracted DNA were tested and found to be satisfactory, the DNA was stored at -20℃ for later use.

[0070] 3. Screening of CREB3L2 gene SNP molecular markers (g. 11537602G>C) in the experimental pig population

[0071] 3.1 PCR amplification of the CREB3L2 gene

[0072] Primer pairs were designed based on the porcine CREB3L2 gene sequence (GenBank accession number: NC_010460), and their sequences (5'-3') are shown below:

[0073] Forward primer F: AACTGTTACCTACCTGCTCT (see SEQ ID NO.2);

[0074] Reverse primer R: TCTTGACCTCTAATCCCTC (see SEQ ID NO.3).

[0075] PCR amplification was performed using the primer pairs described above in a pool of mixed genomic DNA from 30 Xidu black pigs. The PCR reaction volume was 50 μL, including: 100 ng of genomic DNA, 1 μL of upstream primer, 1 μL of downstream primer, 25 μL of PCR mix (trade name Taq 2XPCRMix with Dye V2, purchased from Wuhan Aiboteke Biotechnology Co., Ltd., catalog number: RK20608), and ddH2O was added to bring the total volume to 50 μL. The PCR program was as follows: 98℃ pre-denaturation for 45 s; 98℃ denaturation for 10 s, 59℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 10 min; and storage at 4℃.

[0076] The PCR products were detected by 1.5% agarose gel electrophoresis, and the results are as follows: Figure 1 As shown in the figure. Lane Marker is the molecular marker DL1000, and lanes 1-5 contain PCR amplification products. The results show that the amplification product fragment is approximately 664 bp in size and presents a single target band, demonstrating that the primers have good specificity.

[0077] 3.2 Purification of PCR Products

[0078] The gel electrophoresis bands were cut off and purified using the Gel Extraction Kit from Shanghai Sangon Biotech Co., Ltd. (following the kit's instructions). The specific steps are as follows: First, cut the gel containing the target fragment from the agarose gel and place it in a 1.5 mL centrifuge tube. Add 400 μL of sol solution and incubate at 50-60°C until the gel is completely melted. While melting the gel, mix every 2 minutes. Cool to room temperature. Place the centrifuge column into a collection tube, transfer the mixture to the column, and incubate at room temperature for 2 minutes. Centrifuge at 12000 rpm for 1 minute. At this point, DNA is adsorbed. Transfer the liquid to the column; discard the waste liquid in the collection tube, place the centrifuge column into the same collection tube, add 700 μL of elution buffer, and centrifuge at 12000 rpm for 1 min; discard the waste liquid in the collection tube, and centrifuge at 12000 rpm for 1 min; place the centrifuge column into a pre-prepared sterile 1.5 mL centrifuge tube, add 40 μL of elution buffer or double-distilled water (pH>7.0), and incubate at room temperature or 37°C for 2-3 min; centrifuge at 12000 rpm for 1 min, and the liquid in the centrifuge tube is the recovered DNA fragment.

[0079] 3.3 Obtaining SNP sites

[0080] The recovered DNA fragments were sent to Wuhan Aoke Dingsheng Biotechnology Co., Ltd. for reverse sequencing using an ABI 3730XL sequencer. The sequencing results showed a variant site, g.11537602G>C, located in an intron of the CREB3L2 gene. The sequencing peak diagram of the complementary strand of the sequence containing the molecular marker g.11537602G>C is shown below. Figure 2 From top to bottom, the genotypes are CC homozygous, CG heterozygous, and GG homozygous. The results showed the presence of G and / or C bases at position 62 of the amplified product (represented as C and / or G in the peak diagram; if the peak diagram shows a G base, the molecular marker site is a C base), thus confirming the presence of the SNP molecular marker. When the sequencing result of the variant site is only a single G peak, it is the CC genotype; when the sequencing result of the variant site is only a single C peak, it is the GG genotype; and when the sequencing result of the variant site is a double G and C peak, it is the CG genotype. Furthermore, genomic DNA from individuals of the Xidu black pig with CC homozygous, CG heterozygous, and GG homozygous SNP sites were selected as templates, showing high consistency between the primer detection results and the actual situation, and good genotyping effect.

[0081] The amplification product sequence containing the molecular marker g.11537602G>C is shown below. The molecular marker g.11537602G>C is located at the 62nd S base, where S is selected from G or C.

[0082] AACTGTTACCTACCTGCTCTTAAAAATAGAAGTTGCCCGAGGCTGGGATTTCCATGTCTCCSAGGTGCCTTCTGTGAGCCATCAGGAGCAATGTTTTTCTCGTTTGATTAGTTATGACGACTTCTTGGTCCAGAAGGACAAAGACTTAGAGACATGTTCAGAGTCTACAAAATAATGAAGCACCTAGGTAGAGCGAATGGATTTACTCGTTAGATCCTGAATTATTAGAGCTTTGGGCTTCCTCTTAAAGCTGAAAAAAATAGTTCCCATACAGACGATGAGATATCATTTTAAACCAGTAAGTAGTGCTTTTAGGAGAGCTATTGTTTCTAGAGTGGATTCAGGCTAAAAGTGGTTTCAGAAAATATGGCTGGTATAAAAATGAGGAGTGCGTGTTTTCAAGTCATTGTGCGAACCCTTGTCCCTTCCCTTAAACCTAGCTGGGTGTTGGACATTTCTAACATTCATGTATTTCCTGTCCGCTTCTGCGCAAATTACATTGCTGGGAATTTACTGTGGGGTTTTGCAATTTAAGGAGCAAAACAGTCCATACTTTTTATCTTAGGTATCCTATTATATGCATTGACTCTATCTGGAAGGGTGCTCAAGAAACAGGTAATTGATATTTTTCTGGTAAGAAGTCTTGAGGGATTAGAGGTCAAGA (see SEQ ID NO. 1), where S = G or C.

[0083] The aforementioned physical location of g.11537602G>C is at 11537602 bp on chromosome 18 of the pig (Sus scrofa) reference genome Sscrofa11.1 (chr18:11537602), exhibiting a G>C base variation compared to the reference genome. Its corresponding site number in the Ensembl database is rs345463196. The CREB3L2 gene, numbered ENSSCG00000016520.4 in the Ensembl database, is located at 11533183 to 11666113 bp on chromosome 18 of the pig (Sus scrofa) reference genome Sscrofa11.1, i.e., its location information is 18:11533183-11666113. The NCBI database assembly number for the pig (Sus scrofa) reference genome Sscrofa11.1 is GCF000003025.6, and the NCBI GeneBank database number for chromosome 18 is CM000829.5.

[0084] 4. Association analysis between meat quality traits and SNP molecular marker genotypes in the experimental population

[0085] To determine whether the G>C mutation at chromosome 18, position 11537602 bp, is related to differences in pork quality traits, the established detection method was used to detect SNP polymorphisms in 243 Xidu Black Pigs. The experimental population was grouped according to the genotype of the SNP loci. Of the 243 individuals, 6 were identified as CC type, 79 as CG type, and 158 as GG type. The correlation between different genotypes (CC homozygous, CG heterozygous, and GG homozygous) at this polymorphic locus and meat quality traits was analyzed.

[0086] The carcass length and muscle color values ​​(L1 and L2) of the experimental group of pigs were used as the basis for the determination of the carcass length and muscle color values. 24 Statistical data were used as phenotypic values. ANOVA was performed on different SNP genotype groups using the GLM program of SAS statistical software (SAS Institute Inc, Version 9.4), and significance tests were conducted. The results are expressed as least squares mean ± standard error, and P < 0.05 was considered significant.

[0087] The analytical model used is: Y ijl =μ+G i +W j +e ijl In the model, Y ijl Here, μ represents the phenotypic value, and G represents the mean value. iGenotype effects (including additive and dominant effects; additive effects are represented by 1, 0, and -1 for GG, CG, and CC genotypes, respectively; dominant effects are represented by 1, -1, and 1 for GG, CG, and CC genotypes, respectively; W) j Age in days; e ijl This is due to the residual effect.

[0088] The association analysis results are shown in Table 1. In Table 1, different lowercase letters under the superscript indicate significant differences (P<0.05) between data in the same row. Additive effects refer to the linear accumulation of the influence of alleles on traits through "dosage," meaning that the effects of each allele are independent and additive. Dominant effects refer to the interaction between alleles causing the heterozygous phenotype to deviate from the homozygous mean, meaning that one allele has a dominant effect on another. It can be seen that different genotypes correspond to different pig carcass length, muscle color value L1, and muscle color value L... 24 The numerical differences were significant, with the GG genotype showing differences in carcass length, muscle color value L1, and muscle color value L. 24 The values ​​were significantly higher than those of pigs with the CG and CC genotypes, indicating that individuals with the GG genotype had longer carcasses and better muscle color values; the GG genotype is a superior genotype.

[0089] Table 1. Association analysis of the G>C mutation at 11537602 bp on chromosome 18 of the porcine genome with meat quality traits.

[0090]

[0091] In summary, the SNP molecular marker g.11537602G>C provided by this invention, and the PCR detection primers developed based on this molecular marker, can be used to measure carcass length, muscle color value L1, and muscle color value L in replacement pig herds. 24 The identification or early selection of phenotypic traits can transform phenotypic judgment into genotypic identification, thereby rapidly identifying or screening breeding pigs with superior traits at the genotypic level. Furthermore, marker-assisted selection can be carried out simultaneously for the aforementioned traits of carcass length and muscle color value, providing a detection technique for simultaneous early selection of multiple traits and improving the breeding efficiency of high-quality meat pigs. It also provides reliable target sites for the genetic improvement of pork quality traits. By selecting breeding pigs that retain the GG genotype, the frequency of the GG genotype in the population can be gradually increased, which is conducive to rapidly breeding a high-yield and high-quality meat pig population, thereby improving the economic benefits of pig farming enterprises.

[0092] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. Use of a detection primer or a kit for detecting a SNP molecular marker associated with pork long and muscle color value in pork quality trait evaluation or breeding, characterized in that, The SNP molecular marker is located at the 62nd base of the nucleotide sequence shown in SEQ ID NO. 1, S is selected from G or C, and the SNP molecular marker has GG, CC and CG genotypes; The meat quality traits are carcass length, muscle color value L1 and / or muscle color value L 24 , and the determination method refers to the Agricultural Industry Standard of the People's Republic of China NY / T 821-2019 Technical Specification for Pork Trait Determination; wherein the pig individual of GG genotype is superior to the pig individual of CG genotype and CC genotype in carcass length, muscle color value L1 and / or muscle color value L 24 , and the pig individual is Duhe black pig.

2. Use of the detection primer or kit for detecting the SNP molecular marker associated with the carcass length and muscle color value of a pig according to claim 1 in pork quality trait evaluation or breeding, characterized in that, The detection primer comprises an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO. 2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

3.

3. Use of the detection primer or kit for detecting the SNP molecular marker associated with the carcass length and muscle color value of a pig according to claim 1 in pork quality trait evaluation or breeding, characterized in that, The kit comprises the detection primer, and the detection primer comprises an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO. 2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

3.

4. A method for evaluating pork quality traits, characterized by, The method comprises the following steps: extracting genomic DNA of a pig individual to be tested; amplifying the genomic DNA by using the detection primer shown in SEQ ID NO. 2-3 through a polymerase chain reaction technology to obtain an amplification product; detecting the genotype of the 62nd base of the amplification product, wherein the 62nd base has GG, CC and CG genotypes; According to the genotype detection result of the 62nd base, the meat quality traits of the pig individual to be tested are evaluated, and the meat quality traits are carcass length, muscle color value L1 and / or muscle color value L 24 The determination method refers to the Agricultural Industry Standard of the People's Republic of China NY / T 821-2019 Technical Specification for Pork Quality Determination; wherein the pig individual with GG genotype has better carcass length, muscle color value L1 and / or muscle color value L 24 than the pig individual with CG genotype and CC genotype, and the pig individual is a selenium black pig.

5. A method of genetic improvement of pork quality traits, characterized in that, The method comprises the following steps: extracting genomic DNA of a pig individual to be tested; amplifying the genomic DNA by using the detection primer shown in SEQ ID NO. 2-3 through a polymerase chain reaction technology to obtain an amplification product; detecting the genotype of the 62nd base of the amplification product, wherein the 62nd base has GG, CC and CG genotypes; According to the detection result of the genotype of the 62nd base, the pig individual to be tested with the GG genotype is reserved as a breeding pig. The meat quality traits are carcass length, muscle color value L1, and / or muscle color value L 24 The determination method refers to the Agricultural Industry Standard of the People's Republic of China NY / T 821-2019 "Pork Trait Determination Technical Specification", and the individual to be tested is a Seldu black pig.

Images