Molecular marker for identifying or assisting in identifying soybean oil content and application

By using the SNP site T20G in soybeans to design primer combinations for PCR amplification and fluorescence signal detection, the problem of screening high-oil-content soybean varieties in the existing technology was solved, rapid and efficient breeding screening was achieved, and breeding efficiency was significantly improved.

CN120624705AActive Publication Date: 2025-09-12INST OF CEREAL & OIL CROPS HEBEI ACAD OF AGRI & FORESTRY SCI

Patent Information

Application Number
CN202510870798.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-26
Publication Date
2025-09-12
Estimated Expiration
2045-06-26

AI Technical Summary

Technical Problem

Existing technologies make it difficult to quickly and efficiently screen out soybean varieties with high oil content, which affects the soybean breeding process.

Method used

Based on the SNP site T20G SNP site in the soybean Wm82.a2.v1 genome, a specific primer combination was designed for PCR amplification and fluorescence signal detection, or sequencing, to identify the soybean genotype as TT or GG, so as to screen soybeans with high oil content.

Benefits of technology

It has achieved rapid and efficient screening of soybean varieties with high oil content, significantly improved breeding efficiency and shortened the breeding process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120624705A_ABST
    Figure CN120624705A_ABST
Patent Text Reader

Abstract

The invention discloses a molecular marker for identifying or assisting in identifying soybean oil content and application, and relates to the technical field of biology and application of an SNP (Single Nucleotide Polymorphism) locus, the SNP locus takes a soybean Wm82. A2. V1 genome sequence as a reference genome, the SNP is the 41859817th SNP on a soybean chromosome 5, and the SNP is the 41859817th SNP on the soybean chromosome 5. Corresponding to the 20th basic group from the 5'terminal of the sequence shown in SEQ ID NO: 1, when the site is TT homozygosis, the corresponding genotype is A; when the site is GG homozygous, the corresponding genotype is B; according to the application, soybeans with different oil contents are screened or screened in an auxiliary mode, and the different oil contents of the soybeans are as follows: the soybean with the homozygous genotype A is higher than the soybean with the homozygous genotype B or the soybean with the homozygous genotype B in a candidate mode. The invention has important theoretical significance and economic value for molecular marker-assisted selection of soybean germplasm or breeding progeny materials with high oil content.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to molecular markers for identifying or assisting in identifying soybean oil content and applications thereof. Background Art

[0002] Soybean (Glycine max (Linn.) Merr.) is an important food and oil crop in my country. With the development of social economy and the continuous improvement of people's living standards, the consumption of soybean in my country is increasing.

[0003] 56% of the fat humans need comes from edible oils. While providing the body with essential calories, edible oils also provide essential fatty acids and fat-soluble vitamins that the human body cannot synthesize. Soybean oil is a significant component of human edible oil intake, accounting for approximately 31%. Studies have shown that since the 21st century, the consumption structure of edible oils in China has shifted from rapeseed oil to soybean oil, with soybean oil consumption showing a sustained upward trend, reaching an annual growth rate of 10.4%. Therefore, cultivating soybean varieties with high oil content is crucial. Molecular-assisted breeding is an important method for accelerating soybean breeding. The development of molecular markers related to soybean oil content is crucial for breeding new soybean varieties with high oil content. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide a molecular marker for identifying or assisting in identifying the soybean oil content and its application.

[0005] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows.

[0006] Use of a SNP site, wherein the SNP site uses the soybean Wm82.a2.v1 genome sequence as a reference genome, the SNP is the 41859817th SNP on soybean chromosome 5, corresponding to the 20th base from the 5' end of the sequence shown in SEQ ID NO: 1, and when the site is homozygous for TT, the corresponding genotype is A; when the site is homozygous for GG, the corresponding genotype is B;

[0007] The application is to screen or assist in screening soybeans with different oil contents, wherein the oil contents of soybeans with different oil contents are as follows: soybeans with homozygous genotype A are higher or are potentially higher than soybeans with homozygous genotype B.

[0008] A method for screening or assisting in screening soybeans with different oil contents, comprising the following steps: detecting whether the genotype of the soybean to be tested is genotype TT or genotype GG, wherein the oil content of soybeans with genotype TT is greater than the oil content of soybeans with genotype GG;

[0009] The soybean of genotype TT is a soybean of homozygous TT genotype based on the T20G SNP site;

[0010] The soybean of genotype GG is a soybean of homozygous GG genotype based on the T20G SNP site;

[0011] The T20G SNP site is based on the soybean Wm82.a2.v1 genome sequence as a reference genome, is the 41859817th SNP on soybean chromosome 5, and corresponds to the 20th nucleotide from the 5' end of SEQ ID NO: 1.

[0012] Further preferably, the step of detecting whether the genotype of the soybean to be tested is genotype TT or genotype GG is as follows:

[0013] (a1) using the genomic DNA of the soybean to be tested as a template and using a primer combination to perform PCR amplification to obtain a PCR amplification product;

[0014] The primer combination consists of the upstream primer 14020-05-FAM shown in SEQ ID NO: 2, the upstream primer 14020-05-VIC shown in SEQ ID NO: 3, and the downstream primer 14020-05-R shown in SEQ ID NO: 4;

[0015] (a2) After completing step (a1), the fluorescence signal of the PCR amplification product is detected by an instrument, and the genotype of the soybean to be tested is obtained according to the color of the fluorescence signal. If the fluorescence of the amplification product is consistent with the fluorescence of the fluorescent group labeled with primer 14020-05-FAM, showing orange fluorescence, the soybean sample to be tested is of TT genotype; if the fluorescence of the amplification product is consistent with the fluorescence of the fluorescent group labeled with primer 14020-05-VIC, showing blue fluorescence, the soybean sample to be tested is of GG genotype.

[0016] Further preferably, the step of detecting whether the genotype of the soybean to be tested is genotype TT or genotype GG is as follows:

[0017] (b1) using the genomic DNA of the soybean to be tested as a template and using a primer combination to perform PCR amplification to obtain a PCR amplification product;

[0018] The primer combination consists of the upstream primer 14020-05-FAM shown in SEQ ID NO: 2, the upstream primer 14020-05-VIC shown in SEQ ID NO: 3, and the downstream primer 14020-05-R shown in SEQ ID NO: 4;

[0019] (b2) taking the PCR amplification product obtained in step (b1) and sequencing it;

[0020] (b3) Obtaining the genotype of the soybean to be tested based on the sequencing results obtained in step (b2).

[0021] A kit for identifying or assisting in identifying soybean oil content, comprising a primer combination for detecting whether the genotype of the soybean to be tested is genotype TT or genotype GG;

[0022] The primer combination consists of the upstream primer 14020-05-FAM shown in SEQ ID NO: 2, the upstream primer 14020-05-VIC shown in SEQ ID NO: 3, and the downstream primer 14020-05-R shown in SEQ ID NO: 4;

[0023] The genotype TT is based on the genotype of the T20G SNP site, which is a TT homozygous type;

[0024] The genotype GG is based on the genotype of the T20G SNP site being a GG homozygous type;

[0025] The T20G SNP site is based on the soybean Wm82.a2.v1 genome sequence as a reference genome, is the 41859817th SNP on soybean chromosome 5, and corresponds to the 20th nucleotide from the 5' end of SEQ ID NO: 1.

[0026] The molecular marker shown in SEQ ID NO: 1.

[0027] Application of the above kit or the above molecular marker in identifying or assisting in identifying soybean oil content.

[0028] Application of the above kit or the above molecular marker in screening or auxiliary screening of soybeans with different oil contents.

[0029] Application of the above kit or the above molecular marker in soybean breeding.

[0030] The invention discloses an application of a primer combination in the directional breeding or auxiliary directional breeding of soybean lines with high oil content. The primer combination consists of an upstream primer 14020-05-FAM shown in SEQ ID NO: 2, an upstream primer 14020-05-VIC shown in SEQ ID NO: 3, and a downstream primer 14020-05-R shown in SEQ ID NO: 4.

[0031] The beneficial effects of the above technical solution are as follows: the present invention provides KASP markers for identifying genotype TT and GG allelic variations and their correlation with soybean oil content. The KASP markers of the present invention are applied to molecular marker-assisted selection for soybean oil content, enabling rapid and efficient screening of soybean varieties (germplasm) with high oil content, thereby accelerating the development of new high-quality soybean varieties. This invention has important theoretical significance and economic value for the use of molecular marker-assisted selection for soybean germplasm or breeding material with high oil content. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 This is a diagram showing the results of QTL mapping analysis of the oil content trait of population numbered 14020 in Example 1 of the present invention;

[0033] Figure 2 This is a normal distribution and marker selection efficiency diagram of the oil content of the population numbered 14020 in Example 1 of the present invention;

[0034] Figure 3 This is a diagram showing the genotyping and oil content results of the KASP marker for oil content in population No. 14020 in Example 2 of the present invention. DETAILED DESCRIPTION

[0035] The following examples illustrate the present invention in detail. The various raw materials and equipment used in the present invention are conventional commercial products and can be directly obtained through commercial purchase. The experimental methods used in the following examples are all conventional methods unless otherwise specified.

[0036] It should be understood that when used in the present specification and the appended claims, the term "comprising" indicates the presence of described features, integers, steps, operations, elements and / or components, but does not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components and / or collections thereof.

[0037] It will also be understood that the term "and / or" used in this specification and the appended claims refers to and includes any and all possible combinations of one or more of the associated listed items.

[0038] References to "one embodiment" or "some embodiments" in this specification mean that one or more embodiments of the present application include the features described in conjunction with the embodiment.

[0039] Therefore, the phrases "in one embodiment," "in some embodiments," "in other embodiments," "in yet other embodiments," etc., appearing in various places in this specification do not necessarily refer to the same embodiment, but rather mean "one or more but not all embodiments," unless otherwise specifically emphasized. The terms "including," "comprising," "having," and variations thereof mean "including but not limited to," unless otherwise specifically emphasized.

[0040] In addition, in the description of the present application specification and the appended claims, the terms "first", "second", "third", etc. are only used to distinguish the descriptions and cannot be understood as indicating or implying relative importance.

[0041] The following will be combined with specific embodiments of the present invention to clearly and completely describe the technical solutions of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0042] Example 1: Discovery of soybean oil content-specific SNP sites

[0043] The soybean material in the present embodiment comes from: in 2006, the cultivated soybean Jidou 12 of this laboratory was used as the female parent, and the wild soybean ZYD02738 was used as the male parent, and hybridization was carried out to establish a RIL population. In 2012, Jidou 12 was the female parent, and the RIL population was used as the male parent, and backcrossing was performed. The BC1F1 population obtained in 2013 was obtained. In 2014, Jidou 12 was the female parent, and the BC1F2 of Jidou 12 and ZYD02738 combination was used as the male parent and backcrossed; BC2F1 population was obtained in 2015. Self-pollination was performed 4 times to obtain a BC2F4:5 population, which was numbered as 55 strains of the 14020 population. In December 2018, in Sanya, BC2F4:5 plants took leaves, and DNA was extracted by Baimix Company, and genotype identification was performed on each strain respectively to construct a genetic map.

[0044] Combined with phenotypic data, QTL mapping for soybean oil content was performed. A QTL locus, qOil-14020-05, associated with soybean oil content, was located on chromosome 5 of soybean, with an LOD value of 7.29 and an explanation of 45.70% of the phenotypic variation. The marker associated with the QTL is CHr05_41859817_T_G. The SNP, identified as SNP 41859817 on chromosome 5, has a nucleotide variant of either T or G, corresponding to nucleotide position 20 of SEQ ID NO: 1, using the soybean Williams82 (Wm82.a2.v1) genome sequence as the reference genome.

[0045] Table 11 QTL mapping analysis results of oil content traits in population 4020

[0046]

[0047] The genotypes of each family in the population corresponding to the soybean SNP marker CHr05_41859817_T_G are divided into three types: TT, GG, and T / G. Among them, the genotype TT is the homozygous type of T, the genotype AA is the homozygous type of A, and the genotype TA is the heterozygous type of T and G. The oil content phenotypic values ​​of the 55 soybean lines in this example and the genotype identification results of CHr05_41859817_T_G are shown in Figure 2. Figure 2As shown in Table 2, the average oil content of the TT genotype and GG genotype families were 19.70% and 18.53%, respectively. Compared with the average oil content of the GG genotype family, the average oil content of the TT genotype family was significantly higher by 6.30% (P < 0.001).

[0048] Table 214020 soybean molecular marker and oil content test results

[0049]

[0050]

[0051] Example 2: Genetic Identification of KASP Markers in Secondary Population Soybean In practical applications, soybean genotypes can be detected using the following method: A KASP marker was designed for the specific CHr05_41859817_T_G site on chromosome 5, and the following primers were designed:

[0052] 14020-05-FAM: gaaggtgaccaagttcatgctAAAAAAGTTTCTTTTGTGCT (SEQ ID NO: 2);

[0053] 14020-05-VIC: gaaggtcggagtcaacggattAAAAAAGTTTCTTTTGTGCG (SEQ ID NO: 3);

[0054] 14020-05-R: CTAAGGAGACTCATGGTGGC (SEQ ID NO: 4);

[0055] Amplification was performed using 5 μL of KASPAssay Mix (1.2 μL each of 14020-05-FAM and 14020-05-VIC, 3 μL of 14020-05-R, and 4.6 μL of ddH2O). The reaction system is shown in Table 3. The reaction procedure was as follows: 94°C for 15 min; 10 cycles of 94°C for 20 s, followed by 61-55°C for 30 s, with the temperature decreasing by 0.6°C each cycle; 26 cycles of 94°C for 20 s, followed by 55°C for 1 min, and a final temperature of 30°C for 1 min.

[0056] Table 3 PCR reaction system of test population

[0057]

[0058] The marker CHr05_41859817_T_G was used to identify the genes of 40 bred varieties. After KASP marker detection, 27 germplasms were of TT genotype and 8 germplasms were of GG genotype. The genotype results are shown in Table 4 and Figure 3 As shown,

[0059] Table 4 Molecular markers and oil content test results of 40 bred soybean varieties

[0060]

[0061]

[0062] Note: NA indicates missing oil content data or genotype

[0063] Table 5 Statistical analysis of the relationship between CHr05_41859817_T_G allelic variation types and oil content

[0064]

[0065] The average oil content of the TT and GG genotype families was 21.44% and 19.67%, respectively. Compared with the average oil content of the GG genotype family, the average oil content of the TT genotype family was significantly higher by 9.00% (P < 0.01), indicating that the marker CHr05_41859817_T_G is reliable and effective in identifying soybean oil content.

[0066] In summary, soybeans with a genotype of TT at the CHr05_41859817_T_G locus are high-oil soybeans; soybeans with a genotype of GG at the CHr05_41859817_T_G locus are low-oil soybeans; and soybeans with a genotype of TT at the CHr05_41859817_T_G locus have higher oil content than the tested soybeans with a genotype of GG at the CHr05_41859817_T_G locus. When selecting soybean varieties with superior oil content, soybeans with a genotype of TT at the CHr05_41859817_T_G locus were selected for breeding and improvement.

[0067] While embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to these examples without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

[0068] In the above embodiments, the description of each embodiment has its own focus. For parts that are not described or recorded in detail in a certain embodiment, reference can be made to the relevant description of other embodiments.

[0069] The embodiments described above are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. These modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention, and should all be included in the scope of protection of the present invention.

Claims

1. The use of SNP sites is characterized by: The SNP site uses the soybean Wm82.a2.v1 genome sequence as a reference genome. The SNP is the 41,859,817th SNP on soybean chromosome 5, corresponding to the 20th base from the 5' end of the sequence shown in SEQ ID NO:

1. When the site is homozygous for TT, the corresponding genotype is A; when the site is homozygous for GG, the corresponding genotype is B. The application is to screen or assist in screening soybeans with different oil contents, wherein the oil contents of soybeans with different oil contents are as follows: soybeans with homozygous genotype A are higher or are likely to be higher than soybeans with homozygous genotype B.

2. A method for screening or assisting in screening soybeans with different oil contents, characterized in that: The method comprises the following steps: detecting whether the genotype of the soybean to be tested is genotype TT or genotype GG, wherein the oil content of the soybean of genotype TT is greater than the oil content of the soybean of genotype GG; The soybean of genotype TT is a soybean of homozygous TT genotype based on the T20G SNP site; The soybean of genotype GG is a soybean of homozygous GG genotype based on the T20G SNP site; The T20G SNP site is based on the soybean Wm82.a2.v1 genome sequence as a reference genome, is the 41859817th SNP on soybean chromosome 5, and corresponds to the 20th nucleotide from the 5' end of SEQ ID NO:

1.

3. The method according to claim 2, characterized in that The steps of detecting whether the genotype of the soybean to be tested is genotype TT or genotype GG are as follows: (a1) using the genomic DNA of the soybean to be tested as a template and using a primer combination to perform PCR amplification to obtain a PCR amplification product; The primer combination consists of the upstream primer 14020-05-FAM shown in SEQ ID NO: 2, the upstream primer 14020-05-VIC shown in SEQ ID NO: 3, and the downstream primer 14020-05-R shown in SEQ ID NO: 4; (a2) After completing step (a1), the fluorescence signal of the PCR amplification product is detected by an instrument, and the genotype of the soybean to be tested is obtained according to the color of the fluorescence signal. If the fluorescence of the amplification product is consistent with the fluorescence of the fluorescent group labeled with primer 14020-05-FAM, showing orange fluorescence, the soybean sample to be tested is of TT genotype; if the fluorescence of the amplification product is consistent with the fluorescence of the fluorescent group labeled with primer 14020-05-VIC, showing blue fluorescence, the soybean sample to be tested is of GG genotype.

4. The method according to claim 2, characterized in that The steps of detecting whether the genotype of the soybean to be tested is genotype TT or genotype GG are as follows: (b1) using the genomic DNA of the soybean to be tested as a template and using a primer combination to perform PCR amplification to obtain a PCR amplification product; The primer combination consists of the upstream primer 14020-05-FAM shown in SEQ ID NO: 2, the upstream primer 14020-05-VIC shown in SEQ ID NO: 3, and the downstream primer 14020-05-R shown in SEQ ID NO: 4; (b2) taking the PCR amplification product obtained in step (b1) and sequencing it; (b3) Obtaining the genotype of the soybean to be tested based on the sequencing results obtained in step (b2).

5. A kit for identifying or assisting in identifying soybean oil content, characterized in that: The method comprises a primer combination for detecting whether the genotype of the soybean to be tested is genotype TT or genotype GG; The primer combination consists of the upstream primer 14020-05-FAM shown in SEQ ID NO: 2, the upstream primer 14020-05-VIC shown in SEQ ID NO: 3, and the downstream primer 14020-05-R shown in SEQ ID NO: 4; The genotype TT is based on the genotype of the T20G SNP site, which is a TT homozygous type; The genotype GG is based on the genotype of the T20G SNP site being a GG homozygous type; The T20G SNP site is based on the soybean Wm82.a2.v1 genome sequence as a reference genome, is the 41859817th SNP on soybean chromosome 5, and corresponds to the 20th nucleotide from the 5' end of SEQ ID NO:

1.

6. The molecular marker shown in SEQ ID NO:

1.

7. Use of the kit according to claim 5 or the molecular marker according to claim 6 in identifying or assisting in identifying soybean oil content.

8. Use of the kit according to claim 5 or the molecular marker according to claim 6 in screening or assisted screening of soybeans with different oil contents.

9. Use of the kit according to claim 5 or the molecular marker according to claim 6 in soybean breeding.

10. Use of a primer combination in directed breeding or assisted directed breeding of high-oil soybean lines, the primer combination consisting of an upstream primer 14020-05-FAM shown in SEQ ID NO: 2, an upstream primer 14020-05-VIC shown in SEQ ID NO: 3, and a downstream primer 14020-05-R shown in SEQ ID NO: 4.

Citation Information

Patent Citations

  • Molecular marker related to high oil content of soybean and method for identifying high oil content soybean

    CN113186334A

  • SNP (Single Nucleotide Polymorphism) molecular marker related to high oil content of soybean located in chromosome 5 and method for identifying high oil content soybean

    CN114134250A

  • Molecular marker related to high oil content of soybean located in chromosome 5 and method for identifying high oil content soybean

    CN114150086A

Cited By

  • Molecular marker located in chromosome 9 and related to soybean crude oil content and application of molecular marker

    CN120818633A

  • Molecular marker GmChr055102889 related to soybean crude oil content and application of molecular marker GmChr055102889

    CN120843733A