Soybean oil content trait-related major single nucleotide polymorphism site and application thereof
By locating the SNP site CHr20_8561008 on soybean chromosome 20 and designing PCR primer combinations, and using KASP marker-assisted selection breeding, the problem of difficulty in rapidly screening soybean varieties with high oil content in existing technologies has been solved, and a highly efficient breeding process has been achieved.
Patent Information
- Application Number
- CN202510870806.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-26
- Publication Date
- 2026-01-02
- Estimated Expiration
- 2045-06-26
AI Technical Summary
Existing technologies make it difficult to quickly and efficiently screen soybean varieties with high oil content, which affects the soybean breeding process.
Using the SNP locus CHr20_8561008 located on soybean chromosome 20, specific primer combinations 20PC-4-FAM, 20PC-4-VIC, and 20PC-4-R were designed for PCR amplification. Soybean genotypes were detected by quantitative real-time PCR, and KASP molecular marker-assisted selection breeding was used to rapidly screen soybean varieties with high oil content.
This method enables rapid and efficient screening of soybean varieties with high oil content, significantly improving breeding efficiency and shortening the breeding process, and has important theoretical and economic value.
Smart Images

Figure CN120624706B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of biotechnology, in particular to a soybean oil content trait-related major single nucleotide polymorphism site and application thereof. BACKGROUND
[0002] Soybean (Glycine max (Linn.) Merr.) is an important food and oil crop in China. With the development of social economy and the continuous improvement of people's living standards, the consumption of soybean in China is increasing, which leads to a serious contradiction between supply and demand of soybean in China.
[0003] 56% of human required fat comes from edible oil, which provides the required heat for the human body and also provides essential fatty acids and fat-soluble vitamins that the human body cannot synthesize. Soybean oil is an important type of edible oil for human consumption, accounting for about 31%. Research has found that since the 21st century, the consumption structure of edible oil varieties in China has shifted from rapeseed oil to soybean oil, and the consumption of soybean oil has been increasing by 10.4% per year. Therefore, it is particularly important to breed soybean varieties with high oil content. Molecular assisted breeding is an important method to speed up the breeding process of soybean, and the development of molecular markers related to soybean oil content is of great significance for breeding new soybean varieties with high oil content. SUMMARY
[0004] The technical problem to be solved by the present application is to provide a soybean oil content trait-related major single nucleotide polymorphism site and application thereof.
[0005] To solve the above technical problems, the technical solutions adopted by the present application are as follows.
[0006] A SNP site related to soybean oil content, the SNP site is located on chromosome 20 of soybean, the physical distance of the SNP site in the soybean genome version number Wm82.a2.v1 is CHr20_8561008, the SNP site corresponds to the 20th base of the sequence shown in SEQ ID NO: 1, when the site is GG homozygous, the corresponding genotype is A; when the site is AA homozygous, the corresponding genotype is B; the oil content is: the oil content of soybean with genotype A homozygous is greater than or candidate greater than that of genotype B homozygous.
[0007] A reagent or kit for identifying or assisting in identifying soybean oil content traits, the reagent or kit is used for detecting the SNP site, and the reagent or kit contains a combination of PCR amplification specific primers corresponding to the SNP site and template DNA, buffer, dNTPs and other necessary components for gene detection.
[0008] Further preferably, the PCR amplification specific primer combination comprises the primer combination 20PC-4-FAM, 20PC-4-VIC and 20PC-4-R consisting of SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4.
[0009] A primer combination for detecting single nucleotide polymorphism of the SNP site located on chromosome 20 of soybean in the soybean genome, the physical distance of the SNP site in the soybean genome version number Wm82.a2.v1 is CHr20_8561008, the SNP site corresponds to the 20th base of the sequence shown in SEQ ID NO: 1, when the site is GG homozygous, the corresponding genotype is A; when the site is AA homozygous, the corresponding genotype is B; the oil content is: the oil content of soybean with genotype A homozygous is greater than or candidate greater than that of genotype B homozygous; the primer combination is primer pair 20PC-4-FAM, 20PC-4-VIC and 20PC-4-R consisting of SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4 in the sequence listing.
[0010] The application of the above-mentioned SNP site in molecular marker assisted selection breeding of soybean.
[0011] The application of the above-mentioned SNP site in the early screening, and / or rescreening, and / or identification, and / or classification, and / or assisted identification of soybean oil content in molecular marker assisted selection breeding of soybean.
[0012] The application of the above-mentioned primer combination in the directional breeding or assisted directional breeding of soybean lines with high oil content.
[0013] A method for identifying or assisting in identifying soybean oil content in the early breeding stage, based on the above-mentioned SNP site, using the primer combination 20PC-4-FAM, 20PC-4-VIC and 20PC-4-R consisting of SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4 as the template for fluorescence quantitative PCR amplification in the early molecular marker assisted selection breeding, and performing genotyping according to the fluorescence detection results of the obtained amplification product, if the fluorescence of the amplification product is consistent with that of the fluorescent group labeled by primer 20PC-4-FAM, showing orange fluorescence, then the soybean sample to be tested is a soybean variety with high oil content; if the fluorescence of the amplification product is consistent with that of the fluorescent group labeled by primer 20PC-4-VIC, showing blue fluorescence, then the soybean sample to be tested is a soybean variety with low oil content.
[0014] According to the above-mentioned SNP site, a molecular marker related to soybean oil content is developed.
[0015] Further preferably, the molecular marker is a KASP molecular marker.
[0016] The KASP marker for identifying the genotype GG and AA allelic variation and the correlation between the KASP marker and the soybean oil content are provided in the present application, and the KASP marker in the present application is applied to the molecular marker assisted selection of the soybean oil content, so that the soybean varieties (germplasm) with high oil content can be quickly and efficiently screened, thereby accelerating the breeding process of high-quality soybean new varieties. The present application has important theoretical significance and economic value for utilizing molecular marker assisted selection to obtain soybean germplasm or breeding offspring materials with high oil content. BRIEF DESCRIPTION OF DRAWINGS
[0017] Figure 1 FIG. 1 is a QTL positioning analysis result diagram of the oil content trait of the 14019 population in Example 1 of the present application;
[0018] Figure 2 FIG. 2 is a normal distribution marker selection efficiency diagram of the oil content of the 14019 population in Example 1 of the present application;
[0019] Figure 3 FIG. 3 is a KASP marker genotyping and oil content variance analysis result diagram of the oil content of the 14019 population in 2019 and 2021 in Example 2 of the present application. DETAILED DESCRIPTION
[0020] The following examples illustrate the present application. The various raw materials and equipment used in the present application are all conventional commercially available products, which can be directly obtained by market purchase. The experimental methods used in the following examples are conventional methods unless otherwise specified.
[0021] It should be understood that when used in the specification and the appended claims of the present application, the term "comprising" indicates the presence of the described features, integers, steps, operations, elements, and / or components, but does not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and / or groups thereof.
[0022] It should also be understood that the term "and / or" as used in the specification and the appended claims of the present application refers to any combination of one or more of the associated listed items and all possible combinations, and includes these combinations.
[0023] Reference in the specification to "one embodiment" or "an embodiment" means that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment of the application. The appearances of the phrase "in one embodiment" or "in some embodiments" in various places in the specification are not necessarily all referring to the same embodiment, however, but can refer to different embodiments.
[0024] In addition, in the description of the specification and the appended claims, the terms "first", "second", "third", etc. are used only to distinguish descriptions, and cannot be understood as indicating or implying relative importance.
[0025] The technical solutions of the present application will be described below in conjunction with specific embodiments of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, not all. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor are within the scope of protection of the present application.
[0026] Example 1: Discovery of soybean oil content-specific SNP sites
[0027] The soybean material in this embodiment is derived from: In 2006, the cultivated soybean Jidou 12 in the laboratory was used as the female parent, and the wild soybean ZYD02738 was used as the male parent to carry out hybridization and establish a RIL population. In 2012, Jidou 12 was used as the female parent, and the RIL population was used as the male parent to carry out backcrossing, and the BC1F1 population was obtained in 2013. In 2014, Jidou 12 was used as the female parent, and the BC1F2 of Jidou 12 and ZYD02738 combination was used as the male parent to carry out backcrossing; the BC2F1 population was obtained in 2015. After selfing 4 times, the BC2F4:5 population, i.e. 53 strains of population No. 14019, was obtained. In December 2018, Sanya, the leaves were taken from the strains of BC2F4:5, and the DNA was extracted by Baimaik company. The genotype of each strain was identified, and the genetic map was constructed.
[0028] In combination with the phenotype data, QTLs of oil content in soybean were located, and QTL sites qOil-14 019-20-19 and qOil-14 019-20-21 related to oil content in soybean were located on chromosome 9 of soybean, with LOD values of 4.47 and 3.52, and the explained phenotypic variation was 32.70% and 26.80%. The marker associated with the QTL was CHr20_8561008_G_A. The SNP was the 8561008th SNP on chromosome 20 of soybean with the Williams82 (Wm82.a2.v1) genome sequence as the reference genome, and the nucleotide species was G or A, which was the 20th nucleotide of SEQ ID NO: 1.
[0029] Table 11 QTL location analysis results of oil content trait of 2019 population
[0030]
[0031] The genotypes of each family in the population corresponding to the soybean SNP marker CHr20_8561008_G_A were divided into three types, namely GG, AA and G / A, wherein the genotype GG was the homozygous type of G, the genotype AA was the homozygous type of A, and the genotype G / A was the heterozygous type of G and A. The oil content phenotype values of the 53 soybean materials in the strain and the genotype identification results of CHr20_8561008_G_A in Table 2 and Figure 2 As shown in Table 2 and Table 3, in 2019, the average oil content of the GG genotype and the AA genotype family was 19.86% and 18.37% respectively, and the average oil content of the GG genotype family was significantly higher than that of the AA genotype family by 8.09% (P<0.001); in 2021, the average oil content of the GG genotype and the AA genotype family was 19.51% and 17.69% respectively, and the average oil content of the GG genotype family was significantly higher than that of the AA genotype family by 10.29% (P<0.001).
[0032] Table 2 QTL location analysis results of oil content trait of 2019 population
[0033]
[0034]
[0035] Example 2, Gene identification of KASP markers in secondary population
[0036] In practical application, the genotype of soybean can be detected according to the following method.
[0037] A KASP marker was designed for the specific CHr20_8561008_G_A site on chromosome 20, and the primer was designed as follows:
[0038] 20PC-4-FAM: gaaggtgaccaagttcatgctCCGCAAAATGAATGGTAACG (SEQ ID NO: 2);
[0039] 20PC-4-VIC: gaaggtcggagtcaacggattCCGCAAAATGAATGGTAACA (SEQ ID NO: 3);
[0040] 20PC-4-R: CCTTTCTTTTTAATCCCTGC (SEQ ID NO: 4);
[0041] The KASPAssay Mix enzyme 5 μL was selected for amplification: (20PC-4-FAM, 20PC-4-VIC 1.2 μL each, 20PC-4-R 3 μL, ddH2O 4.6 μL). The reaction system is shown in Table 3. The reaction procedure is: 94℃ 15min; 94℃ 20s, 61-55℃ 30s, 10 cycles, each cycle decreases by 0.6℃; 94℃ 20s, 55℃ 1min, 26 cycles, finally 30℃ 1min.
[0042] Table 3 PCR reaction system of test population
[0043]
[0044] The 53 families of 14019 population were genotyped by using the marker CHr20_8561008_G_A, among the 53 families of soybean germplasm materials, 12 germplasms were GG genotype, 29 germplasms were AA genotype, and the genotyping results are shown in Table 4 and Figure 3
[0045] Table 4 KASP molecular marker identification results and oil content detection results
[0046]
[0047]
[0048] Note: NA indicates missing genotype
[0049] Table 5 Statistical analysis of the relationship between CHr20_8561008_G_A allelic variation type and oil content
[0050]
[0051]
[0052] In 2019, the average oil content of the GG genotype and AA genotype families was 19.62% and 18.38% respectively, and the average oil content of the GG genotype family was significantly higher than that of the AA genotype family by 6.71% (P<0.001); in 2021, the average oil content of the GG genotype and AA genotype families was 18.99% and 17.91% respectively, and the average oil content of the GG genotype family was significantly higher than that of the AA genotype family by 6.02% (P<0.05). It is shown that the identification of the oil content of soybeans by the marker CHr20_8561008_G_A is reliable and effective.
[0053] In summary, the soybean with the genotype GG of CHr20_8561008_G_A is a soybean with high oil content, and the soybean with the genotype AA of CHr20_8561008_G_A is a soybean with low oil content; the oil content of the soybean with the genotype GG of CHr20_8561008_G_A is higher than that of the soybean with the genotype AA of CHr20_8561008_G_A. When selecting the superior variety of soybean oil content, the soybean with the genotype GG of CHr20_8561008_G_A is selected for breeding and improvement.
[0054] Although the embodiments of the present application have been shown and described, it should be understood by those skilled in the art that various changes, modifications, substitutions and variations can be made to these examples without departing from the principles and spirit of the present application, and the scope of the present application is defined by the appended claims and their equivalents.
[0055] In the above embodiments, the description of each embodiment has its own focus, and the parts not described or recorded in a certain embodiment can be referred to the relevant description of other embodiments.
[0056] The above-described embodiments are only used to illustrate the technical solutions of the present application, and not to limit them; although the present application has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that they can still modify the technical solutions recorded in the foregoing embodiments, or make equivalent substitutions for part of the technical features; and these modifications or substitutions do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present application, and should be included in the protection scope of the present application.
Claims
1. A kit for identifying or assisting in the identification of soybean oil content, characterized in that: This kit is used to detect SNP sites. The kit contains a PCR amplification specific primer combination corresponding to the SNP site, as well as template DNA, buffer, dNTPs and other necessary components for gene detection. The SNP site is located on soybean chromosome 20. The physical distance of the SNP site in soybean genome version number Wm82.a2.v1 is CHr20_8561008. The SNP site corresponds to the 20th base of the sequence shown in SEQ ID NO:
1. When this site is homozygous for GG, the corresponding genotype is A; when this site is homozygous for AA, the corresponding genotype is B. The oil content is as follows: the oil content of soybeans with genotype A is greater than or can be greater than that of soybeans with genotype B. The PCR amplification specific primer combination includes the primer combination 20PC-4-FAM, 20PC-4-VIC and 20PC-4-R, which consist of SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO:
4.
2. A primer combination, characterized in that: This method is used to detect single nucleotide polymorphisms (SNPs) at the following SNP sites in the soybean genome. The SNP sites are located on soybean chromosome 20, and their physical distance in soybean genome version Wm82.a2.v1 is CHr20_8561008. The SNP site corresponds to the 20th base of the sequence shown in SEQ ID NO:
1. When this site is homozygous for GG, the corresponding genotype is A; when this site is homozygous for AA, the corresponding genotype is B. The oil content is determined as follows: soybeans with genotype A have a higher or candidate higher oil content than soybeans with genotype B. The primer combination consists of primer pairs 20PC-4-FAM, 20PC-4-VIC, and 20PC-4-R, composed of SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4 in the sequence listing.
3. The application of the primer combination described in claim 2 in the directed or assisted directed cultivation of soybean varieties with high oil content.
4. A method for identifying or assisting in the identification of soybean oil content in the early stages of breeding, characterized in that: Based on the SNP site described in claim 1, in the early stage of molecular marker-assisted selection breeding, using the soybean genomic DNA to be tested as a template, quantitative real-time PCR amplification is performed using the primer combination 20PC-4-FAM, 20PC-4-VIC, and 20PC-4-R composed of SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO:
4. Genotyping is performed based on the fluorescence detection results of the amplification products. If the fluorescence of the amplification product is consistent with the fluorescence of the fluorescent group labeled with primer 20PC-4-FAM, showing orange fluorescence, then the soybean sample to be tested is a soybean variety with high oil content; if the fluorescence of the amplification product is consistent with the fluorescence of the fluorescent group labeled with primer 20PC-4-VIC, showing blue fluorescence, then the soybean sample to be tested is a soybean variety with low oil content.
Citation Information
Patent Citations
Soybean grain oil content related molecular marker located on soybean chromosome 12 and application thereof
CN117604139A
Soybean oil component content related major mononucleotide polymorphic site and application thereof
CN117887885A