KASP molecular marker related to salt tolerance of mung bean germination period, primer group, kit and application

Abstract

The invention relates to the technical field of molecular genetic breeding, in particular to a KASP molecular marker related to salt tolerance in a mung bean germination period, a primer group, a kit and application. According to the KASP molecular marker Chr126769484 related to the salt tolerance in the mung bean germination period, primers are designed according to the KASP molecular marker, typing is carried out by utilizing specific matching of basic groups at the tail ends of the primers, the KASP molecular marker related to the salt tolerance in the mung bean germination period is developed, genetic typing is carried out, identification is accurate and convenient, the salt tolerance in the mung bean germination period can be predicted at low cost, and the application prospect is wide. The process of salt-tolerant variety breeding in the mung bean germination period is simplified, the breeding efficiency is improved, and the mung bean breeding process is accelerated.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular genetic breeding, and in particular to a KASP molecular marker, a primer set, a kit and applications thereof related to salt tolerance during the germination period of mung beans. Background Art

[0002] Plants face constantly changing environmental conditions throughout their lifecycles, especially during seed germination. Unfavorable conditions can jeopardize species reproduction and crop yields. Soil salinization is a global challenge hindering agricultural production. Currently, arable land in over 100 countries is affected by soil salinization, accounting for approximately one-third of arable land. China's salinized soil area accounts for approximately one-tenth of the world's total, making it the third largest country in terms of land salinization. Furthermore, as global temperatures continue to rise, soil salinization is intensifying.

[0003] Mung bean (Vigna radiata L.) is an important legume crop, rich in nutrients such as protein, folate, and iron. It is widely distributed in Asian countries, particularly India, China, Myanmar, and Indonesia. Mung beans can be processed into various food varieties, such as bean sprouts, flour, noodles, and porridge, providing nutrition and deliciousness. During the germination stage, mung bean seeds are susceptible to growth conditions and various stresses. Salt stress, in particular, can significantly reduce the germination rate of mung bean seeds, leading to uneven seedling emergence and increased harvesting costs, significantly impacting and causing losses to the production quality and economic benefits of mung beans. Summary of the Invention

[0004] In view of the deficiencies of the above-mentioned prior art, the present invention aims to provide a KASP molecular marker, primer set, kit and application related to salt tolerance of mung bean during the germination period, which are applied in the breeding of mung bean varieties, provide a selection tool for the molecular breeding of highly salt-tolerant mung bean varieties, and improve the selection efficiency.

[0005] In order to solve the above problems, the present invention adopts the following technical solutions:

[0006] KASP molecular marker-assisted selection (KASP) breeding technology allows for the selection of target traits by selecting molecular markers closely associated with them. It is simple, rapid, and environmentally unaffected, enabling the identification and selection of crop varieties for traits such as variety, yield, and stress tolerance, saving significant manpower and resources. However, relatively little research has been conducted on stress tolerance during the germination period of mung beans, and no relevant genetic markers have been used for molecular breeding of mung beans. Therefore, a marker associated with salt tolerance during the germination period of mung beans was screened and used to select superior mung bean varieties, laying the foundation for the breeding of high-yield, stable, and high-quality salt-tolerant mung bean varieties.

[0007] In a first aspect, the present invention provides a KASP molecular marker related to salt tolerance during the germination period of mung bean, wherein the KASP molecular marker is Chr1_26769484.

[0008] As an embodiment, the base of the KASP molecule label is T or C.

[0009] In a second aspect, the present invention provides a primer set for identifying the KASP molecular marker related to salt tolerance of mung bean during the germination period, comprising a forward primer F1, a forward primer F2 and a reverse primer R; the nucleotide sequence of the forward primer F1 is shown in SEQ ID NO: 2, the nucleotide sequence of the forward primer F2 is shown in SEQ ID NO: 3, and the nucleotide sequence of the reverse primer R is shown in SEQ ID NO: 4.

[0010] As an implementation method, the 5' end of the forward primer F1 is connected to the FAM fluorescent tag sequence GACCAAGTTCATGCT; the 5' end of the forward primer F2 is connected to the HEX fluorescent tag sequence CGGAGTCAACGGATT.

[0011] In a third aspect, the present invention provides a kit for identifying the KASP molecular marker related to salt tolerance of mung bean during germination, comprising the primer set.

[0012] As an embodiment, it also includes 2×KASP Master mix 5μL and 2.0μL ddH2O; the concentration of the forward primer F1, forward primer F2 and reverse primer R is 10μM, the volume ratio is 1:1:3, and the total volume is 1μL; the concentration of the mung bean sample DNA template detected by the kit is 30-50ng / μL, and the addition amount is 2μL.

[0013] As an embodiment, the kit uses fluorescent PCR for detection, and the reaction procedure of the fluorescent PCR is: pre-denaturation at 94°C for 15 minutes; denaturation at 94°C for 20 seconds, gradient annealing / extension at 61-55°C for 1 minute, decreasing 0.6°C each cycle, 10 cycles; denaturation at 94°C for 20 seconds, annealing / extension at 55°C for 1 minute, 26 cycles; fluorescent quantitative PCR at 30°C for 1 minute, and collecting fluorescent signals.

[0014] In a fourth aspect, the present invention provides a method for determining the salt tolerance of mung bean during the germination period, comprising: extracting DNA from a mung bean sample to be tested; performing PCR amplification using the primer set using the DNA as a template, performing fluorescence detection based on the obtained PCR amplification product, and determining the genotype of the KASP molecular marker and the salt tolerance of the mung bean during the germination period; if the genotype of the KASP molecular marker of the mung bean sample is TT, the mung bean sample is sensitive to salt stress during the germination period; if the genotype of the KASP molecular marker of the mung bean sample is CC, the mung bean sample is highly salt tolerant during the germination period; and if the genotype of the KASP molecular marker of the mung bean sample is CT, the mung bean sample is moderately salt tolerant during the germination period.

[0015] In a fifth aspect, the present invention provides applications of the KASP molecular marker related to salt tolerance during the germination period of mung beans, including any one of the following applications:

[0016] Application in detecting salt stress tolerance of mung bean during germination period;

[0017] Application in identifying salt-tolerant varieties or strains of mung bean during the germination period;

[0018] Application in predicting germination characteristics of mung bean seeds under salt stress;

[0019] Application in improving salt-tolerant mung bean germplasm resources;

[0020] Application in molecular marker-assisted selection breeding of mung bean.

[0021] In a sixth aspect, the present invention provides applications of the primer set or kit, including any one of the following applications:

[0022] Application in the preparation of reagents for detecting salt stress tolerance during the germination period of mung beans;

[0023] Application in the preparation of reagents for identifying salt-tolerant varieties or strains of mung bean during the germination period;

[0024] Application in the preparation of reagents for predicting germination characteristics of mung bean seeds under salt stress;

[0025] Application in the preparation of reagents for improving salt-tolerant mung bean germplasm resources;

[0026] Application in the preparation of mung bean molecular marker-assisted selection breeding reagents.

[0027] The beneficial effects of the present invention are as follows: the present invention uses whole genome analysis technology to identify a SNP site Chr1_26769484 that is significantly associated with the salt tolerance of mung bean during the germination period, designs primers based on the target SNP site, utilizes specific matching of the primer terminal bases to type the corresponding SNP, develops KASP markers related to the salt tolerance of mung bean during the germination period and performs genotyping, the identification is accurate and convenient, the salt tolerance of mung bean during the germination period can be predicted at low cost, the process of breeding salt-tolerant mung bean varieties during the germination period is simplified, the breeding efficiency is improved, and the mung bean breeding process is accelerated. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is a diagram showing the results of genome-wide association analysis of traits related to salt stress tolerance during the germination period of mung beans according to the present invention.

[0029] Figure 2 This is a graph showing the detection results of the KASP molecular marker of the present invention on the allele type of traits related to salt stress tolerance in mung bean materials of different genotypes during the germination period.

[0030] Figure 3 This is a comparison chart of the salt tolerance differences during the germination period of mung bean materials with different genotypes of the present invention. DETAILED DESCRIPTION

[0031] The present invention will be further described in detail below with reference to specific embodiments.

[0032] It should be noted that these embodiments are only used to illustrate the present invention, rather than to limit the present invention. Simple improvements to the method based on the concept of the present invention fall within the scope of protection claimed by the present invention.

[0033] Example 1

[0034] Discovering loci significantly associated with salt tolerance during germination in mung bean through genome-wide association analysis

[0035] The 413 representative mung bean germplasm resources and high-quality genome-wide SNP molecular markers used were provided by the mung bean research group at the Institute of Economic Crops, Jiangsu Academy of Agricultural Sciences. These 413 mung bean accessions were planted in 2023 at the Jiangsu Academy of Agricultural Sciences Experimental Base (E1) and the Jiangsu Academy of Agricultural Sciences Hainan Experimental Base (E2). A randomized block design was used, and conventional field management practices were followed, including appropriate fertilization and watering, and regular weeding and insecticide control. Seeds were harvested at maturity.

[0036] Mung bean seeds harvested in Nanjing and Hainan (E1 and E2) were subjected to germination experiments under normal treatment and salt stress, and the germination status on the second day (germination potential GP) and the fifth day (germination rate GR) of germination was statistically analyzed.

[0037] Relative germination potential (RGP) = seed germination potential under salt stress / seed germination potential under normal conditions × 100%

[0038] Relative germination rate (RGR) = seed germination rate under salt stress / seed germination rate under normal conditions × 100%

[0039] The present invention conducted a descriptive statistical analysis on relative germination potential (RGP) and relative germination rate (RGR). As shown in Table 1, the relative germination potential of mung bean seeds harvested under the growth conditions of E1 and E2 varied from 0% to 99.38% and 0% to 100.00%, respectively, and the relative germination rate varied from 0% to 100.00% and 0% to 100.00%, respectively. The coefficients of variation were both greater than 30%, indicating that there was a large variation in the relative germination potential (RGP) and relative germination rate (RGR) under the two environments (E1 and E2).

[0040] Table 1 Descriptive statistical analysis of relative germination traits of mung bean seeds under salt stress

[0041]

[0042] In the present invention, 413 mung bean populations were resequenced using Su Lu No. 1 as the reference genome, and SNPs with a deletion rate of more than 50% and a minor allele frequency (MAF) of less than 5% were removed using Vcftools v0.1.16. The significance threshold was finally determined to be 5.28E-06, i.e. -log(P) = 6.27. The R package rMVP was used to conduct genome-wide association analysis on relative germination potential and relative germination rate of mung bean under salt stress during the germination period under multiple environments. The general linear model (GLM) and mixed linear model (MLM) were used for analysis. The SNP significantly associated with salt tolerance during the germination period of mung bean was detected to be Chr1_26769484, and the polymorphism of this site was T / C( Figure 1 ).

[0043] Example 2

[0044] Development of KASP molecular markers related to salt tolerance during the germination period of mung bean

[0045] According to the sequence of the SNP variation site on the genome (SEQ ID NO: 1), primers for the SNP variation site were designed using Primer Premier 5.0, including forward primer F1, forward primer F2 and reverse primer R, wherein F1 and F2 contained FAM (GAAGGTGACCAAGTTCATGCT) and HEX (GAAGGTCGGAGTCAACGGATT) fluorescent linker sequences, respectively.

[0046] The nucleotide sequence of the SNP site is SEQ ID NO: 1:

[0047] GGTAGTTTTGAAGATTTGACAAAGAT (or C)

[0048] AACAAATGAAGAGAAGGATAATGGCAATCCTCAAGATGAAGATCTCAACAAATTATCATTATGAAATTGGAGACATTTCTAAAGGGG;

[0049] The sequence of the KASP marker forward primer F1 is shown in SEQ ID NO: 2, which is:

[0050] 5'-GGGTAGTTTTGAAGATTTGACAAAGAT-3'.

[0051] The sequence of the KASP marker forward primer F2 is shown in SEQ ID NO: 3, which is:

[0052] 5'-GGTAGTTTTGAAGATTTGACAAAGAC-3'.

[0053] The sequence of the KASP marker reverse primer R is shown in SEQ ID NO: 4, which is:

[0054] 5'-CCCCTTTAGAAATGTCTCCAAT-3'.

[0055] Example 3

[0056] Detection of SNP genotypes in different mung bean materials and its application

[0057] The genomic DNA of 36 mung bean leaf tissues was extracted by CTAB method. The extracted DNA was used as template for PCR amplification, fluorescence signal collection and genotyping on the Thermo Fisher Scientific real-time fluorescence quantitative instrument QuantStudio 5.

[0058] Preparation of KASP molecular marker primer working solution: Take 10 μL (10 μM) of upstream primer and 30 μL (10 μM) of downstream primer, mix them evenly, and use them as KASP molecular marker primer working solution.

[0059] The amplification system consisted of a 10.0 μL reaction system containing 2 μL (30-50 ng / μL) mung bean sample DNA template; 5 μL KASP 2× Master Mix (LGC Biotechnology, UK); 1 μL primer set working solution; and 2.0 μL ddH2O. Reaction conditions included one cycle of pre-denaturation at 94°C for 15 min, followed by 10 cycles of denaturation at 94°C for 20 s and annealing at 61–55°C for 60 s, with the temperature decreasing by 0.6°C between cycles; and 26 cycles of denaturation at 94°C for 20 s and annealing at 55°C for 60 s. Following each cycle, the product was extended at 30°C for 60 s. After amplification, the products were directly analyzed using a Thermo Fisher Scientific real-time fluorescence quantitative instrument, QuantStudio 5, for fluorescence signal reading and genotyping.

[0060] In the present invention, upstream primers F1 and F2 contain FAM and HEX fluorescent linker sequences, respectively. KASP labeled primers were used to amplify 36 mung bean materials and perform fluorescence detection. The results showed that FAM fluorescence signals were detected in 10 mung bean test materials, and the genotype was TT; HEX fluorescence signals were detected in 20 mung bean test materials, and the genotype was CC; FAM / HEX mixed fluorescence signals were detected in 6 mung bean test materials, and the genotype was TC (Table 2, Figure 2 GraphPad software was used to evaluate the relative germination potential (RGP) and relative germination rate (RGR) of 36 mung bean genotypes. Figure 3 As shown in the data, the relative germination potential (RGP) and relative germination rate (RGR) of the CC genotype material were significantly higher than those of the TT genotype material, indicating that the KASP molecular marker can accurately identify the salt tolerance phenotype and genotype of mung bean seeds during the germination period.

[0061] Table 2 Phenotypes and genotypes of different mung bean materials used for KASP markers

[0062]

[0063]

[0064] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not limiting. Although the present invention has been described with reference to the preferred embodiments of the present invention, it should be understood by those skilled in the art that various changes can be made in form and details without departing from the spirit and scope of the present invention as defined in the appended claims.

Claims

1. A KASP molecular marker related to salt tolerance in mung bean germination period, characterized in that: The KASP molecule is labeled Chr1_26769484.

2. The KASP molecular marker related to salt tolerance during the germination period of mung bean according to claim 1, characterized in that The bases labeled by the KASP molecules are T or C.

3. A primer set for identifying the KASP molecular marker related to salt tolerance during the germination period of mung bean according to claim 1, characterized in that: It includes a forward primer F1, a forward primer F2 and a reverse primer R; the nucleotide sequence of the forward primer F1 is shown in SEQ ID NO: 2, the nucleotide sequence of the forward primer F2 is shown in SEQ ID NO: 3, and the nucleotide sequence of the reverse primer R is shown in SEQ ID NO:

4.

4. The primer set according to claim 3, characterized in that The 5' end of the forward primer F1 is connected to the FAM fluorescent tag sequence GACCAAGTTCATGCT; the 5' end of the forward primer F2 is connected to the HEX fluorescent tag sequence CGGAGTCAACGGATT.

5. A kit for identifying the KASP molecular marker related to salt tolerance during the germination period of mung bean according to claim 1, characterized in that: Comprising the primer set according to claim 3 or 4.

6. The kit according to claim 5, characterized in that It also includes 2×KASP Master mix 5μL and 2.0μLddH2O; the concentrations of the forward primer F1, forward primer F2 and reverse primer R are 10μM, the volume ratio is 1:1:3, and the total volume is 1μL; the concentration of the mung bean sample DNA template detected by the kit is 30-50ng / μL, and the addition amount is 2μL.

7. The kit according to claim 5, characterized in that The kit uses fluorescent PCR for detection, and the reaction procedure of the fluorescent PCR is: pre-denaturation at 94°C for 15 minutes; denaturation at 94°C for 20 seconds, gradient annealing / extension at 61-55°C for 1 minute, decreasing 0.6°C each cycle, 10 cycles; denaturation at 94°C for 20 seconds, annealing / extension at 55°C for 1 minute, 26 cycles; fluorescent quantitative PCR at 30°C for 1 minute, and collecting fluorescent signals.

8. A method for improving salt tolerance of mung beans during germination period, characterized in that: include: Extract DNA from the mung bean sample to be tested; Using DNA as a template, PCR amplification is performed using the primer set according to claim 3 or 4, and fluorescence detection is performed based on the obtained PCR amplification product to determine the genotype of the KASP molecular marker and the salt tolerance of the mung bean during the germination period; if the genotype of the KASP molecular marker of the mung bean sample is TT, the mung bean sample is sensitive to salt stress during the germination period; if the genotype of the KASP molecular marker of the mung bean sample is CC, the mung bean sample is highly salt-tolerant during the germination period; if the genotype of the KASP molecular marker of the mung bean sample is CT, the mung bean sample is moderately salt-tolerant during the germination period.

9. Use of the KASP molecular marker related to salt tolerance during the germination period of mung bean according to claim 1 or 2, characterized in that: This includes any of the following applications: Application in detecting salt stress tolerance of mung bean during germination period; Application in identifying salt-tolerant varieties or strains of mung bean during the germination period; Application in predicting germination characteristics of mung bean seeds under salt stress; Application in improving salt-tolerant mung bean germplasm resources; Application in molecular marker-assisted selection breeding of mung bean.

10. Use of the primer set according to claim 3 or 4 or the kit according to any one of claims 5 to 7, characterized in that: This includes any of the following applications: Application in the preparation of reagents for detecting salt stress tolerance during the germination period of mung beans; Application in the preparation of reagents for identifying salt-tolerant varieties or strains of mung bean during the germination period; Application in the preparation of reagents for predicting germination characteristics of mung bean seeds under salt stress; Application in the preparation of reagents for improving salt-tolerant mung bean germplasm resources; Application in the preparation of mung bean molecular marker-assisted selection breeding reagents.

Images