A nucleic acid detection probe, primers, reagent kit and their applications

Abstract

This invention discloses a probe, probe and primer combination, standard, detection kit, and real-time PCR detection method for quantitative detection. This invention establishes a real-time fluorescence PCR quantitative detection system with good specificity, strong repeatability, and high accuracy, with a detection sensitivity of 100 copies / μL. It can rapidly and accurately identify the copy number of target nucleic acids in biological materials and their processed products, providing a method and tool for the monitoring and precise quantitative detection of transgenic products.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to probes, probe and primer combinations, standards, real-time PCR detection kits, and detection methods for quantitative detection. Background Technology

[0002] Exogenous gene detection mainly utilizes conventional PCR methods, but its drawbacks include low sensitivity, low throughput, and the inability to monitor the PCR process in real time, thus preventing quantification. With the development of molecular biology techniques, Real-time PCR (quantitative real-time PCR) has been widely used for transgenic detection. Compared to conventional PCR, it offers advantages such as shorter processing time, simpler operation, higher specificity, and higher sensitivity. The process can be monitored in real time, and the results can be directly observed, enabling high-throughput quantification.

[0003] Real-time PCR methods can be divided into two types: dye-based and probe-based. In dye-based real-time PCR, the fluorescent dye binds to double-stranded DNA and emits fluorescence. However, this binding is non-specific; primer dimers, DNA template, and other components in the system will also bind to it, resulting in low specificity. In contrast, the probe in the probe-based method specifically binds to the template, and its amplification curve reflects the accumulation of specific products, eliminating non-specific amplification components. Its sensitivity is up to 10 times higher than that of the dye-based method. Furthermore, the dye-based method only supports single-channel reactions. For multi-channel experiments or detecting different targets from the same sample, the probe-based real-time PCR method is the most commonly used.

[0004] SEQ ID NO.1 provides an optimized DMO gene that can be used to breed herbicide-tolerant transgenic plant products. Developing a method for quantitative detection of the DMO gene can provide an effective detection tool for the identification and regulation of transgenic organisms, and provide technical support for the safety management of agricultural transgenic organisms. Summary of the Invention

[0005] To address the above problems, the present invention provides a method for detecting substances containing... DMO Gene probes, probe and primer combinations, standards, detection kits, and real-time PCR detection methods. The above products can be used for gene transfer. DMO The biotransformation of the gene can also be a derived strain of the above-mentioned transformant, a hybrid biological material containing the above-mentioned transformant, or various products processed from the above-mentioned sample as raw material. Since the sequence shown in SEQ ID NO. 1 is... DMO Therefore, any sample containing the nucleic acid molecule with the sequence shown in SEQ ID NO. 1 can be qualitatively and quantitatively detected using the method provided by this invention.

[0006] This invention, through the design of highly sensitive and specific probes, upstream primers, and downstream primers, can accurately identify substances containing... DMO Gene products. This detection method has the advantages of high specificity, sensitivity and ease of operation, making up for the shortcomings of conventional PCR methods, such as cumbersome procedures, low detection sensitivity and the inability of dye-based Real-time PCR to accurately quantify.

[0007] This invention provides a detection DMO A probe for a gene, characterized in that the nucleotide sequence of the probe is 5'-AGAGGCCAGCTGCCATTACTTCTTCGGCTCCT-3'.

[0008] In some implementations, the probe is labeled with a fluorescent group at its 5' end and a quencher group at its 3' end. When the probe is in a free state, the fluorescence emitted by the fluorescent group is absorbed by the quencher group. During PCR amplification, the fluorescent group at the 5' end of the probe, which is tightly bound to the template, is cleaved by Taq polymerase, thereby moving away from the quencher group at the 3' end. The fluorescence emitted by the fluorescent group can then be received by the instrument, and the generated fluorescence signal is proportional to the amount of amplified product in the sample.

[0009] In some embodiments, the fluorescent group includes any one of FAM, TET, HEX, CY3, JOE, VIC, ROX, CY5, TAMRA, or Texas; the quenching group includes any one of BHQ1, BHQ2, BHQ-X, TAMRA, DABCYL, or MGB.

[0010] In some embodiments, the combination of the fluorescent group / quencher group is any one of FAM / BHQ1, FAM / BHQ2, CY3 / BHQ-X, HEX / DABCYL, JOE / TAMRA, or VIC / BHQ2;

[0011] In randomized tests using fluorescent and quencher groups, probes labeled with both fluorescent and quencher groups yielded specific detection results. Furthermore, probes labeled with FAM at the 5' end and BHQ1 at the 3' end had the lowest labeling cost and can be considered the optimal probe labeling scheme.

[0012] The present invention also provides a detection DMO A primer and probe combination for a gene, characterized in that it includes the probe described above and two primers, wherein the nucleotide sequences of the primers are 5'-AGGTCTCCGCCATGCTTAATT-3' and 5'-TCGTCGATGCCGAAGTTCC-3';

[0013] The probes and probe-primer combinations mentioned above were selected through software design and multiple rounds of experimental screening and verification, using all or part of the sequence shown in SEQ ID NO. 1 as templates.

[0014] The present invention also provides detection DMO A gene standard, characterized in that: the standard is one or more nucleic acid samples with a concentration of not less than 100 copies / μL; the nucleic acid sample contains a nucleic acid molecule with the sequence shown in SEQ ID NO. 1;

[0015] In some implementations, the detection standards are six samples with concentrations of 1.0 × 10⁻⁶ each. 7 Copy / μL, 1.0×10 6 Copy / μL, 1.0×10 5 Copy / μL, 1.0×10 4 Copy / μL, 1.0×10 3 Copy / μL, 1.0×10 2 A plasmid sample of copies / μL; the nucleic acid sample contains a nucleic acid molecule with the sequence shown in SEQ ID NO. 1;

[0016] In some embodiments, the preparation method of the standard is as follows: take 10 μL of a plasmid sample containing the full-length 9115 bp nucleic acid molecule shown in SEQ ID NO. 1 at a concentration of 100 ng / μL, add 990 μL of ddH2O, and then dilute 10-fold and 10-fold respectively. 2 times, 10 3 times, 10 4 times, 10 5 times, 10 6 times.

[0017] The present invention also provides detection DMO A gene detection kit, characterized in that: the detection kit includes the above-described probe and primer combination and the above-described standards;

[0018] In some implementations, the test kit includes:

[0019] Primer 1 has the sequence 5'-AGGTCTCCGCCATGCTTAATT-3';

[0020] Primer 2 has the sequence 5'-TCGTCGATGCCGAAGTTCC-3';

[0021] The probe has the sequence 5'-AGAGGCCAGCTGCCATTACTTCTTCGGCTCCT-3';

[0022] The standard samples, specifically the six detection standards, each with a concentration of 1.0 × 10⁻⁶, are provided. 7 Copy / μL, 1.0×10 6 Copy / μL, 1.0×10 5 Copy / μL, 1.0×10 4 Copy / μL, 1.0×10 3 Copy / μL, 1.0×10 2 A plasmid sample of copies / μL; the nucleic acid sample contains a nucleic acid molecule with the sequence shown in SEQ ID NO. 1;

[0023] The probe is labeled with the fluorescent group FAM at its 5' end and the quenching group BHQ1 at its 3' end.

[0024] The present invention also provides detection DMO The Real-time PCR method for gene detection is characterized by using the above-mentioned detection kit for Real-time PCR detection, wherein the final concentrations of primer 1 and primer 2 in the PCR reaction system are both 0.4 μM, and the final concentration of the probe is 0.2 μM.

[0025] The present invention also provides the application of the above-mentioned probes, probe and primer combinations, detection standards, detection kits, and detection methods in the qualitative or quantitative detection of nucleic acid samples; wherein the nucleic acid sample contains a nucleic acid molecule with the sequence shown in SEQ ID NO. 1.

[0026] The beneficial effects of this invention are as follows: After two rounds of software design and three levels of experimental screening, a combination of one probe and two primers was obtained from hundreds of probe and primer combinations. Based on this, a Real-time PCR detection method was established and optimized using standards with appropriate concentration gradients. Using the above-mentioned probe, probe and primer combination, standards, detection kit, and Real-time PCR detection method, samples containing nucleic acid molecules with the sequence shown in SEQ ID NO. 1 at a concentration of not less than 100 copies / μL can be specifically detected, exhibiting extremely high sensitivity and specificity. Attached Figure Description

[0027] Other features, objects, and advantages of this application will become more apparent from the following detailed description of non-limiting embodiments with reference to the accompanying drawings:

[0028] Figure 1 Sensitivity test curve. Where 1: 1.0 × 10⁻⁶ 6 Copy / μL; 2: 1.0 × 10 5 Copy / μL; 3: 1.0 × 10 4 Copy / μL; 4: 1.0 × 10 3Copy / μL; 5: 1.0 × 10 2 6: 1.0 × 10 copies / μL;

[0029] Figure 2 Plot the standard curve and the linear equation. Detailed Implementation

[0030] The following definitions and methods are provided to better define this application and to guide those skilled in the art in its practice. Unless otherwise stated, the terms are to be understood in accordance with their conventional usage by those skilled in the art. All patent literature, academic papers, industry standards, and other publicly available publications cited herein are incorporated herein by reference in their entirety.

[0031] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and essence of the invention are within the scope of this application. Unless otherwise specified, the examples are conducted under conventional experimental conditions or according to the conditions recommended in the manufacturer's instructions. Unless otherwise specified, the chemical reagents used in the examples are all commercially available conventional reagents, and the technical means used in the examples are conventional means well known to those skilled in the art.

[0032] Example 1 DMO Design and screening of gene-specific primers and probes

[0033] 1. Design primer and probe combinations

[0034] by DMO The full-length sequence (1023 bp) or partial sequence (>300 bp) of the gene (sequence as shown in SEQ ID NO. 1) was input as a template into the software (such as ABI Primer Express 3.0); after setting the relevant parameters in the software according to the following requirements, a large number of primer and probe combinations were obtained. Each combination contained 2 primers and 1 probe.

[0035] The probe and primers must meet all of the following requirements:

[0036] ① The primer length is between 18 and 25 bp, and the probe length is between 18 and 30 bp;

[0037] ② The Tm value of the primers is 58~60℃, and the Tm value of the probe is 8-10℃ higher than that of the primers;

[0038] ③ Avoid generating complementary sequences of more than 3 bases inside the probe, inside the primer, or between the probe and primer;

[0039] ④ The first base at the 5' end of the probe should not be G;

[0040] ⑤ The probes and primers are specific to the target sample;

[0041] ⑥ The length of the PCR product between the two primers is between 70-150 bp.

[0042] Finally, five primer and probe combinations with the highest software scores were selected as candidate combinations for further screening. Candidate combinations A1 to A5 are shown in Table 1.

[0043]

[0044] 2. Primer synthesis and screening

[0045] The five primer sets shown in Table 1 were synthesized, and their specificity was screened. The screening process is as follows:

[0046] (1) Primers 1 and 2 of the five candidate combinations were detected by conventional PCR amplification reaction. The electrophoresis results are shown in Table 2. The results showed that all combinations A1 to A5 amplified a single band, and the size was as expected. Therefore, primers 1 and 2 of combinations A1 to A5 met the requirements and were further tested.

[0047]

[0048] (2) Primers 1 and 2 of combinations A1 to A5 were detected by Real-time PCR using the SYBR Green dye method. The results of the Real-time PCR are shown in Table 3. The results showed that: combination A2 had no amplification curve; combination A1 had an amplification curve with a Ct value less than 35, but the melting curve was bimodal; combinations A3 to A5 had amplification curves, with the Ct value of A5 greater than 35, and the Ct values ​​of A3 and A4 less than 35. Therefore, primers 1 and 2 in combinations A3 and A4 met the requirements and were further tested. Combinations A1, A2, and A5 were eliminated.

[0049]

[0050] 3. Probe synthesis and screening

[0051] The probes in the synthetic combinations A3 and A4 were modified with the fluorescent labeling group FAM at the 5' end and the fluorescent quenching group BHQ1 at the 3' end.

[0052] The primers and probes in combinations A3 and A4 were detected using real-time PCR, and the results are shown in Table 4. The results indicate that combination A3 failed to amplify, and no amplification curve was obtained; combination A4 had an amplification curve, but the Ct value was too high (close to 35), indicating unsatisfactory amplification efficiency, which may affect the final detection results.

[0053]

[0054] 4. Redesign new primer and probe combinations

[0055] Adjust the requirements for probes and primers in step 1: limit the length of the probe to between 25 and 35 bp, and the length of the PCR product between the two primers to between 150 and 300 bp; keep the other conditions unchanged.

[0056] Based on the above criteria, five primer and probe combinations with the highest software scores were selected as candidate combinations for further screening. Candidate combinations B1 to B5 are shown in Table 5.

[0057]

[0058] 5. Synthesis and screening of new primers

[0059] The five primer sets shown in Table 5 were synthesized, and their specificity was screened. The screening process is as follows:

[0060] (1) Primers 1 and 2 of the five candidate combinations were tested using conventional PCR amplification. The electrophoresis results are shown in Table 6. The results showed that combinations B1, B2, B4, and B5 all amplified a single band, and the size was as expected; combination B3 amplified two bands, indicating non-specific amplification. Therefore, primers 1 and 2 of combinations B1, B2, B4, and B5 met the requirements and were further tested.

[0061]

[0062] (2) Primers 1 and 2 of combinations B1-B5 were detected by Real-time PCR using the SYBR Green dye method. The results of the Real-time PCR reaction are shown in Table 7. The results showed that the amplification curves of combinations B1, B2, B4, and B5 were all normal, and the melting curves were all single peaks with Ct values ​​less than 35. Therefore, primers 1 and 2 in combinations B1, B2, B4, and B5 met the requirements and were further tested.

[0063]

[0064] 6. Synthesis and screening of new probes

[0065] The probes in the synthetic combinations B1, B2, B4 and B5 were modified with the fluorescent labeling group FAM at the 5' end and the fluorescent quenching group BHQ1 at the 3' end.

[0066] The primers and probes in combinations B1, B2, B4, and B5 were detected using real-time PCR. The results are shown in Table 8. The results indicate that the amplification curves of combinations B1, B2, B4, and B5 were all normal, and the Ct values ​​were all less than 30. Finally, combination B5, with the lowest Ct value and the highest amplification efficiency, was selected as the detection method. DMO The probe and primer combination.

[0067]

[0068] The probe (bold part) and primer (underlined part) of combination B5 are in DMO The location in the clip is shown below:

[0069] AGGTCTCCGCCATGCTTAATT TCATTGCTGTGGCGCCAGAGGGTACCCCGAAGGAGCAGTCAATCCATAGCCGCGGCACTCACATCCTCACCCCCGAGACAGAGGCCAGCTGCCATTACTTCTTCGGCTCCTCAA GGAACTTCGGC ATCGACGA

[0070] Primer and probe sequences

[0071] Primer 1: 5'-AGGTCTCCGCCATGCTTAATT-3'

[0072] Primer 2: 5'-TCGTCGATGCCGAAGTTCC-3'

[0073] Probe: FAM-AGAGGCCAGCTGCCATTACTTCTTCGGCTCCT-BHQ1

[0074] Example 2 Preparation of Standards

[0075] To quantify the initial template amount in a sample using real-time PCR, a standard curve needs to be constructed using standards with known copy numbers. Then, the Ct value of the sample to be tested is obtained through PCR, and finally, the copy number of the sample is calculated from the standard curve. Therefore, suitable standards must first be prepared, and the preparation method is as follows:

[0076] 1. Using the plant expression vector pBWA(V)HS-bar-dmo containing the sequence shown in SEQ ID NO. 1 as a positive plasmid (9115 bp in length), a standard was prepared;

[0077] 2. Measure the absorbance A of plasmid DNA using a UV spectrophotometer. 260 and A 280 Calculate the concentration and purity of the plasmid respectively;

[0078] 3. When performing Real-time PCR, the concentration of the standard template should be expressed in "copies / μL".

[0079] Calculation formula: Template copy number / μL = Avogadro's constant × Template moles, where Avogadro's constant = 6.02 × 10 23 Copy / mol, template molecular weight = template DNA length (number of bases) × 660 (average molecular weight of bases).

[0080] 4. The plasmid concentration was measured to be 100 ng / μL. According to the above formula, the plasmid copy number / μL = 6.02 × 10⁻⁶. 23 copies / mol × (100 × 10) -9 (g / μL) / (9115×660 g / mol), which is 1.0×10 10 Copy / μL.

[0081] 5. Take 10 μL of the above plasmid solution and add 990 μL of ddH2O to obtain a concentration of 1.0 × 10⁻⁶. 8 A plasmid solution of 1 copy / μL was then serially diluted 10-fold to obtain plasmid concentrations of 1.0 × 10⁶. 7 ~1.0×10 0 Standard sample per copy / μL. Store at -20℃ for later use.

[0082] Example 3: Establishment and optimization of probe-based real-time PCR reaction system

[0083] The present invention obtained usable probes and primers through the operation of Example 1, and obtained a series of concentration gradient standards through Example 2. However, whether the specific Real-time PCR reaction system can achieve better results is also affected by factors such as primer and probe concentrations. Therefore, in order to obtain efficient and accurate quantitative results, further optimization of the PCR reaction system is needed.

[0084] I. Establishing a preliminary Real-time PCR reaction system

[0085] The primer and probe combination B5 selected in Example 1 was diluted, and deionized water was added to dilute it to a working solution of 10 μM. Real-time PCR amplification using the probe method was then performed to establish the reaction system.

[0086] The PCR reaction system consisted of: 10 μL of 2×qPCR Mix, 0.5 μL of 10 μM upstream primer, 0.5 μL of 10 μM downstream primer, 0.25 μL of 10 μM probe, 1 μL of template DNA, and ddH2O to a total volume of 20 μL. A positive control (concentration of 1.0×10⁻⁶) was also included. 6 Used plasmid DNA (copies / μL) as a template, and ddH2O as a blank control.

[0087] The real-time PCR reaction program was as follows: 95℃ for 10 min; 95℃ for 10 s, 60℃ for 20 s, 72℃ for 40 s (collecting fluorescence signals), for a total of 40 cycles.

[0088] II. Optimize the Real-time PCR Reaction System

[0089] The primer final concentrations were set at five gradients: 0.1, 0.2, 0.3, 0.4, and 0.5 μM, corresponding to probe concentrations that were half the primer concentrations. The Real-time PCR results for each treatment are shown in Table 9.

[0090]

[0091] The results showed that the PCR reaction system with a primer concentration of 0.4 μM and a probe concentration of 0.2 μM had the lowest Ct value and the highest fluorescence signal value. Therefore, the final primer concentration for subsequent experiments was determined to be 0.4 µM and the probe concentration to be 0.2 µM.

[0092] The optimized reaction system is as follows:

[0093] 10 μL of 2×qPCR Mix, 0.8 μL of 10 μM upstream primer, 0.8 μL of 10 μM downstream primer, 0.4 μL of 10 μM probe, 1 μL of template DNA, and ddH2O to a total volume of 20 μL. Positive control (concentration 1.0×10⁻⁶). 6 Used plasmid DNA (copies / μL) as a template, and ddH2O as a blank control.

[0094] Example 4 Real-time PCR system detection DMO Sensitivity test

[0095] Sensitivity refers to the lowest copy number of a sample that a PCR amplification reaction can detect, i.e., the limit of detection. When using real-time PCR to detect standards of different concentrations, if a standard of a certain concentration can form an amplification curve but the Ct value is >35, then the standard concentration is considered to have exceeded the limit of detection of the PCR system.

[0096] Using the probe and primer combination B5 described in Example 1, the reaction system optimized in Example 3, and the standard from Example 2 (concentration 1.0 × 10⁻⁶), the reaction was carried out. 6 Using ~1.0×10⁶ copies / μL as template (three parallel experiments per concentration), and ddH₂O as a blank control, real-time PCR amplification was performed to determine the limit of detection of the detection method of this invention. Amplification curves were obtained based on the fluorescence signals detected by the instrument, and the results are shown below. Figure 1 See Table 10. The results show that when the standard concentration is <100 copies / μL, the amplification curve Ct > 35. Therefore, the detection limit for Real-time PCR is 100 copies / μL.

[0097] The above sensitivity test results indicate that when a sample does not show a typical amplification curve or the Ct value is greater than 35, it means that the nucleic acid molecules in the sample are... DMO If the concentration is below 100 copies / μL, it is considered undetectable in the sample. DMO The gene test result was negative.

[0098]

[0099] Example 5: Plotting a Standard Curve

[0100] Real-time PCR was performed using multiple standards at gradient concentrations as templates, and Ct values ​​were recorded. A standard curve was plotted based on the initial template amount (logarithm of copy number) and Ct values ​​to obtain the standard equation. When it is necessary to quantify the initial template of the test sample, only the amplification curve and Ct value need to be obtained, and the initial template amount of the test sample can be calculated by substituting them into the standard equation.

[0101] Using the standard from Example 2 (concentration 1.0 × 10⁻⁶) 6 ~1.0×10 2 Using copies / μL as template (three parallel experiments for each concentration), ddH2O as blank control, Real-time PCR amplification was performed using the probe and primer combination B5 from Example 1 and the reaction system from Example 2.

[0102] Plot a standard curve with the logarithm of the standard concentration on the x-axis and the Ct value on the y-axis, see [reference]. Figure 2 The standard curve equation of this invention is y = -2.457x + 36.426 (y represents the Ct value, x is the logarithm of the copy number). The standard curve exhibits a good linear relationship, R... 2 =0.9845, a high correlation coefficient, meeting the requirements for Real-time PCR quantitative detection.

[0103] Example 6 Detection DMO Real-time PCR kit

[0104] Prepare the following components for testing. DMO The kit included: 2×qPCR Mix, 10 μM upstream primer, 10 μM downstream primer, 10 μM probe, and the standard from Example 2 (concentration 1.0×10⁻⁶). 6 ~1.0×10 2 (Copy / μL) and ddH2O.

[0105] The primers and probes are the combination B5 described in Example 1.

[0106] The reaction system for this kit can be: 10 μL of 2×qPCR Mix, 0.8 μL of 10 μM upstream primer, 0.8 μL of 10 μM downstream primer, 0.4 μL of 10 μM probe, 1 μL of template DNA, and ddH2O to bring the total reaction volume to 20 μL.

[0107] The reaction program for Real-time PCR using this kit is as follows: 95℃ for 10 min; 95℃ for 10 s, 60℃ for 20 s, 72℃ for 40 s (collect fluorescence signal), for a total of 40 cycles.

[0108] When using this kit to detect samples, the amplification curve is obtained from the fluorescence signal detected by the instrument, and the sample copy number is calculated based on the standard equation established by the standard and the Ct value of the sample to be tested.

[0109] Genomic DNA was extracted from the following four samples using the CTAB method. These samples are transgenic. DMO Genetically modified corn, transgenic BT Genetically modified maize, recipient control maize B104, and a mixture of the above three maize materials.

[0110] Using the genomic DNA of these three samples as templates and ddH2O as a blank control, Real-time PCR amplification was performed using the kit described in Example 6 and the reaction system of Example 3, to conduct the above three samples. DMO Positive detection of the gene. Amplification curves were obtained based on the fluorescence signals detected by the instrument, and the copy number of each sample was calculated based on the Ct values ​​in the amplification curves. The results are shown in Table 11.

[0111] change DMO Genetically modified maize and a mixture of three maize species all formed amplification curves, with Ct values ​​all less than 35, indicating positive results. However, the recipient control maize B104 and the transgenic maize... BT None of the genetically modified maize samples formed amplification curves, and all test results were negative. Therefore, it can be seen that the method established in this invention... DMO Gene detection systems have excellent specificity and sensitivity.

[0112]

[0113] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any way. Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make modifications or alterations to the above-disclosed technical content to create equivalent embodiments without departing from the scope of the present invention. Any simple modifications, equivalent changes, and alterations made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the scope of the present invention.

Claims

1. A primer and probe combination, characterized in that: It includes two primers and a probe, the primers having the nucleotide sequence 5'-AGGTCTCCGCCATGCTTAATT-3' and 5'-TCGTCGATGCCGAAGTTCC-3', the nucleotide sequence of the probe is 5'-AGAGGCCAGCTGCCATTACTTCTTCGGCTCCT-3'.

2. The primer and probe combination according to claim 1, characterized in that: The probe is labeled with a fluorescent group at its 5' end and a quenching group at its 3' end; The fluorescent group includes any one of FAM, TET, HEX, CY3, JOE, VIC, ROX, CY5, TAMRA, or Texas; the quenching group includes any one of BHQ1, BHQ2, BHQ-X, TAMRA, DABCYL, or MGB.

3. The primer and probe combination according to claim 2, characterized in that: The combination of the fluorescent group and the quenching group is any one of FAM / BHQ1, FAM / BHQ2, CY3 / BHQ-X, HEX / DABCYL, JOE / TAMRA, or VIC / BHQ2.

4. The primer and probe combination according to claim 3, characterized in that: The fluorescent group is FAM; the quenching group is BHQ1.

5. A standard product, characterized in that: The standard is one or more nucleic acid samples with a concentration of not less than 100 copies / μL; the nucleic acid sample contains nucleic acid molecules with the sequence shown in SEQ ID NO.

1.

6. The standard product according to claim 5, characterized in that: The standard samples had a concentration of 1.0 × 10⁻⁶. 7 Copy / μL, 1.0×10 6 Copy / μL, 1.0×10 5 Copy / μL, 1.0×10 4 Copy / μL, 1.0×10 3 Copy / μL, 1.0×10 2 A plasmid sample of copies / μL; the plasmid sample contains a nucleic acid molecule with the sequence shown in SEQ ID NO.

1.

7. A test kit, characterized in that: The detection kit includes the primer and probe combination as described in any one of claims 1-4 and the standard as described in any one of claims 5-6.

8. The detection method, characterized in that: Real-time PCR detection was performed using the detection kit described in claim 7, wherein the final concentrations of primers 1 and 2 in the PCR reaction system were both 0.4 μM, and the final concentration of the probe was 0.2 μM; the detection method detected nucleic acid samples containing nucleic acid molecules with the sequence shown in SEQ ID NO.

1.

9. The application of the primer and probe combination according to any one of claims 1-4, the standard according to any one of claims 5-6, the detection kit according to claim 7, and the detection method according to claim 8 in the qualitative or quantitative detection of nucleic acid samples; in, The nucleic acid sample contains nucleic acid molecules with the sequence shown in SEQ ID NO.1.

Images