Application of pyruvate dehydrogenase kinase 4 inhibitor
By using a pyruvate dehydrogenase kinase 4 inhibitor (PDK4-in) to block PDK4 activity and promote the entry of pyruvate into the tricarboxylic acid cycle, the therapeutic limitations of metabolic disorders in septic acute lung injury were addressed, effective regulation of lactate metabolism was achieved, and the lung injury condition was significantly improved.
Patent Information
- Application Number
- CN202510950830.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-10
- Publication Date
- 2025-09-16
AI Technical Summary
The existing drug treatment system for acute lung injury caused by sepsis has limitations and fails to effectively intervene in the metabolic disorders in the disease process. In addition, existing drugs have functional limitations and safety issues in regulating lactate metabolism.
Pyruvate dehydrogenase kinase 4 inhibitor (PDK4-in) is used to block PDK4 activity, relieve the inhibition of the pyruvate dehydrogenase complex, promote the entry of pyruvate into the tricarboxylic acid cycle, regulate lactate metabolism and block pathological lactate accumulation.
By targeted regulation of lactate metabolism, lactate production can be significantly reduced, the wet-to-dry ratio of lung tissue and the expression of inflammatory factors can be lowered, mitochondrial oxidative phosphorylation function can be repaired, and the therapeutic effect of acute lung injury caused by sepsis can be improved.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biomedicine technology, and in particular to an application of a pyruvate dehydrogenase kinase 4 inhibitor. Background Art
[0002] Currently, the main drugs used to treat sepsis-induced acute lung injury (SI-ALI) include antibiotics, glucocorticoids (such as dexamethasone and methylprednisolone), anti-inflammatory drugs (such as ulinastatin), antioxidants (such as N-acetylcysteine), anticoagulants (such as low-molecular-weight heparin), pulmonary surfactants, biologics (such as anti-TNF-α or anti-IL-1β monoclonal antibodies), β2-receptor agonists (such as salbutamol), and statins. Antibiotics are central to infection control, while glucocorticoids can alleviate lung injury by inhibiting excessive inflammatory responses, but the timing and dosage of their use remain controversial. Anti-inflammatory and antioxidant drugs aim to reduce inflammation and oxidative stress, while anticoagulants can improve microcirculatory disorders. Although biologics and pulmonary surfactants have shown potential in animal studies, their clinical efficacy remains unclear. Some drugs, such as activated protein C, have been withdrawn from the market due to insufficient safety or efficacy. Currently, evidence-based medical evidence for most drugs is limited, and supportive care, such as mechanical ventilation, remains the primary treatment approach in clinical practice, with drugs often used as adjunctive measures.
[0003] The current drug treatment system for acute lung injury in sepsis has three main limitations: First, existing treatment strategies mostly focus on infection control (such as broad-spectrum antibiotics), inflammation suppression (such as glucocorticoids) or organ support (such as mechanical ventilation), and have not yet systematically intervened in the key metabolic disorders in the disease process; second, commonly used clinical drugs have significant functional limitations. For example, although antibiotics can eliminate pathogens, they cannot reverse the existing lactic acid accumulation; although glucocorticoids can inhibit excessive inflammation, they aggravate metabolic imbalance; anti-inflammatory and antioxidant drugs can only partially alleviate secondary damage and lack specificity for core lactic acid metabolic abnormalities; third, targeted therapies explored in recent years (such as cytokine monoclonal antibodies) are theoretically accurate, but in clinical practice they face practical difficulties such as unstable efficacy, limited applicable populations and high costs. Summary of the Invention
[0004] The problem solved by the present invention is how to solve the problem of limitations of the drug treatment system for sepsis-induced acute lung injury.
[0005] In order to solve the above problems, the present invention provides a use of a pyruvate dehydrogenase kinase 4 inhibitor.
[0006] The present invention provides an application of a pyruvate dehydrogenase kinase 4 inhibitor in the preparation of a medicament for treating sepsis-induced acute lung injury.
[0007] Alternatively, treatment of septic acute lung injury is achieved by blocking PDK4 activity and thereby relieving inhibition of the pyruvate dehydrogenase complex, which can promote the entry of pyruvate into the tricarboxylic acid cycle.
[0008] Optionally, treatment of septic acute lung injury is achieved by regulating lactate metabolism, which is used to block pathological lactate accumulation in the lungs.
[0009] The beneficial effects of using a pyruvate dehydrogenase kinase 4 (PDK4) inhibitor of this invention include establishing an intervention strategy targeting the regulation of lactate metabolism hubs. This PDK4 inhibitor (PDK4-in) specifically inhibits PDK4 activity, relieving inhibition of the pyruvate dehydrogenase complex (PDC) and promoting the entry of pyruvate into the tricarboxylic acid cycle (TCA cycle), thereby reducing lactate production. This inhibitor can effectively block pathological lactate accumulation in the lungs, alleviate alveolar epithelial cell death, and restore mitochondrial oxidative phosphorylation function. This approach fills a gap in the field of metabolic intervention and, through its targeted mechanism of action, overcomes the clinical dilemma of treating symptoms rather than the root cause in SI-ALI treatment. BRIEF DESCRIPTION OF THE DRAWINGS
[0010] Figure 1 This is a graph showing the survival curves of mice in the Sham group, CLP group, CLP+PDK4-in (10 mg / kg) group, CLP+PDK4-in (20 mg / kg) group, and CLP+PDK4-in (30 mg / kg) group of Example 1;
[0011] Figure 2 Schematic diagram of HE staining of lung tissue damage in the Sham group, CLP group, and 20 mg / kg CLP+PDK4-in group of mice in Example 1;
[0012] Figure 3 This is a bar graph of the lung lactate concentration of mice in the Sham group, CLP group, and 20 mg / kg CLP+PDK4-in group in Example 1;
[0013] Figure 4 This is a bar graph of the expression levels of IL-6 mRNA, an inflammatory factor, in the lung tissues of mice in the Sham group, the CLP group, and the 20 mg / kg CLP+PDK4-in group of Example 1;
[0014] Figure 5 This is a bar graph of the expression levels of TNF-α mRNA, an inflammatory factor, in the lung tissues of mice in the Sham group, the CLP group, and the 20 mg / kg CLP+PDK4-in group of Example 1;
[0015] Figure 6 This is a bar graph of the expression levels of inflammatory factor IL-1β mRNA in the lung tissue of mice in the Sham group, CLP group, and 20 mg / kg CLP+PDK4-in group of Example 1;
[0016] Figure 7 FIG4 is a chemical formula diagram of the pyruvate dehydrogenase kinase 4 inhibitor of this example. DETAILED DESCRIPTION
[0017] To make the above-mentioned objects, features, and advantages of the present invention more clearly understood, specific embodiments of the present invention are described in detail below with reference to the accompanying drawings. Although certain embodiments of the present invention are shown in the accompanying drawings, it should be understood that the present invention can be implemented in various forms and should not be construed as being limited to the embodiments described herein. Instead, these embodiments are provided to provide a more thorough and complete understanding of the present invention. It should be understood that the drawings and embodiments of the present invention are for illustrative purposes only and are not intended to limit the scope of protection of the present invention.
[0018] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meanings as those commonly understood by those skilled in the art to which the present invention belongs. The terms used in the present invention description are only for the purpose of describing specific embodiments and are not intended to limit the present invention;
[0019] As used herein, the term "including" and its variations are open-ended, i.e., "including but not limited to"; the term "based on" means "based at least in part on"; the term "one embodiment" means "at least one embodiment"; the term "another embodiment" means "at least one additional embodiment"; the term "some embodiments" means "at least some embodiments"; and the term "optionally" means "optional embodiments." Definitions of other terms are provided in the following description.
[0020] In related technologies, none of the drug systems involved directly intervening in pathologically elevated lactate concentrations. However, this application, through the establishment of a multi-omics analysis platform and animal model verification, revealed for the first time that a high lactate microenvironment can activate the HIF-1α / PDK4 signaling axis, leading to metabolic reprogramming of alveolar epithelial cells, which in turn induces an oxidative stress cascade and a pro-inflammatory cytokine storm, ultimately forming a vicious cycle of "lactate-energy metabolism disorder-inflammation amplification," leading to more severe acute lung injury in sepsis. Crucially, experimental data showed that specifically inhibiting lactate production significantly reduced the wet-to-dry ratio of lung tissue and inflammatory factors.
[0021] In light of the above-mentioned related technologies, and breaking through the traditional treatment framework, this embodiment provides an application of a pyruvate dehydrogenase kinase 4 inhibitor.
[0022] The pyruvate dehydrogenase kinase 4 inhibitor (PDK4-in) of the present invention, comprising (N-(4-fluorophenyl)-5-[(4-fluorophenyl)amino]-1,3,4-thiadiazole-2-carboxamide), is an anthraquinone derivative and a potent, orally active pyruvate dehydrogenase kinase 4 (PDK4) inhibitor with an IC50 value of 84 nM. Its CAS No. in the CAS Common Chemistry database is 2310262-10-1, and its chemical formula is as follows: Figure 7 shown.
[0023] An embodiment of the present invention provides a use of the above-mentioned pyruvate dehydrogenase kinase 4 inhibitor in the preparation of a drug for treating sepsis-induced acute lung injury.
[0024] In this example, an animal model was constructed to reveal that a high lactate microenvironment can activate the HIF-1α / PDK4 signaling axis, leading to metabolic reprogramming in alveolar epithelial cells. This in turn triggers an oxidative stress cascade and a pro-inflammatory cytokine storm, ultimately forming a vicious cycle of lactate-energy metabolism impairment-inflammation amplification, which exacerbates acute lung injury in sepsis. This example establishes an intervention strategy targeting the regulation of the lactate metabolic hub. A pyruvate dehydrogenase kinase 4 (PDK4) inhibitor (PDK4-in) was developed that specifically inhibits PDK4. Blocking PDK4 activity relieves inhibition of the pyruvate dehydrogenase complex (PDC), promoting the entry of pyruvate into the tricarboxylic acid cycle (TCA cycle), and thereby reducing lactate production. This approach can effectively block pathological lactate accumulation in the lungs, mitigate alveolar epithelial cell death, and restore mitochondrial oxidative phosphorylation function, significantly reducing the wet-to-dry ratio and inflammatory factors in lung tissue. It fills the gap in the field of metabolic intervention and, through the target mechanism of action, breaks through the clinical dilemma of "treating the symptoms but not the root cause" in the treatment of SI-ALI.
[0025] Alternatively, treatment of septic acute lung injury is achieved by blocking PDK4 activity and thereby relieving inhibition of the pyruvate dehydrogenase complex, which can promote the entry of pyruvate into the tricarboxylic acid cycle.
[0026] Optionally, treatment of septic acute lung injury is achieved by regulating lactate metabolism, which is used to block pathological lactate accumulation in the lungs.
[0027] The present invention is further described below with reference to specific embodiments.
[0028] Example 1
[0029] 1. Prepare the control drug.
[0030] Dimethyl sulfoxide (DMSO) and sterile corn oil were mixed at a ratio of 1 to 9 to obtain the control drug.
[0031] 2. Prepare PDK4-in drugs.
[0032] PDK4-in-1 (same as PDK4-1) was purchased from MedChemExpress, catalog number: HY-135954, purity: 98.82%. 10 mg, 20 mg, and 30 mg of PDK4-in were dissolved in 0.01 mL of DMSO, and then 0.9 mL of sterile corn oil was added. The mixture was vortexed and mixed using a blender to prepare PDK4-in drugs with concentrations of 10 mg / ml, 20 mg / ml, and 30 mg / ml, respectively.
[0033] Eight-week-old male C57BL / 6 mice weighing 20 ± 2 g were selected and fasted for 12 hours before surgery with free access to water. The mice were divided into five groups, each containing five mice. Group 1 received no drug injection; Group 2 received a control drug intraperitoneally 3 hours before surgery; Group 3 received a 10 mg / ml PDK4-in drug intraperitoneally 3 hours before surgery; Group 4 received a 20 mg / ml PDK4-in drug intraperitoneally 3 hours before surgery; and Group 5 received a 30 mg / ml PDK4-in drug intraperitoneally 3 hours before surgery.
[0034] 3. The cecal ligation and puncture method was used to establish a septic acute lung injury model.
[0035] A mouse model of septic renal injury was established using the cecal ligation and puncture (CLP) method, simulating polymicrobial sepsis caused by intestinal perforation through surgical intervention without the need for additional drug induction. C57BL / 6 mice in groups 2, 3, 4, and 5 underwent surgery. Anesthesia was achieved with an intraperitoneal injection of 1% sodium pentobarbital at 50 mg / kg. A 2 cm midline incision was made in the lower abdomen, and subcutaneous and muscle tissue were bluntly dissected. The cecum was located with a cotton swab and carefully removed from the peritoneal cavity. Using the ileocecal valve as a guide, one-half of the cecum was ligated with a No. 3 silk suture. An 18G needle was then used to penetrate the cecum once, avoiding blood vessels and expressing a small amount of intestinal contents. The cecum was then carefully returned to the peritoneal cavity, and the muscle and skin were sutured layer by layer. The first group was anesthetized with an intraperitoneal injection of 1% sodium pentobarbital at 50 mg / kg. A 2 cm midline incision was performed in the lower abdomen, and the subcutaneous and muscle tissues were bluntly dissected. The cecum was located with a cotton swab and carefully removed from the peritoneal cavity before being returned to the abdominal cavity. This served as the sham control group (Sham group). The second group received postoperative CLP, the third group received CLP + PDK4-in (10 mg / kg), the fourth group received CLP + PDK4-in (20 mg / kg), and the fifth group received CLP + PDK4-in (30 mg / kg).
[0036] 4. Resuscitate mice.
[0037] Each mouse was subcutaneously injected with 1 ml of 0.9% NaCl in the back for fluid resuscitation.
[0038] 5. Observe the survival time of each group of mice and make a survival curve as shown below Figure 1 As shown, the survival rates of mice in the CLP group and the third postoperative group (CLP + PDK4-in (10 mg / kg)) were low, while the survival rates of mice in the CLP + PDK4-in (20 mg / kg) and CLP + PDK4-in (30 mg / kg) groups were high, exceeding 80%. This indicates that PDK4-in at concentrations of 20 mg / kg and 30 mg / kg can improve the survival rate of mice with septic renal injury. $p <0.05, Фp <0.05, $: CLP vs. CLP + 20 mg / kg, Ф: CLP vs. CLP + 30 mg / kg.
[0039] 6. After sampling, follow-up experiments are conducted to evaluate the degree of lung tissue damage.
[0040] The right lower lobe of the lung of each group of mice was removed and fixed with 4% paraformaldehyde for 24 h. The right lower lobe of the lung was dehydrated, embedded in paraffin, and sliced for HE staining. The tissue morphological changes, tissue structure, interstitial thickening, and perivascular inflammatory cell infiltration in each group were observed under a light microscope. Figure 2As shown, Figure 2 The CLP+PDK4-in group was treated with PDK4-in at a concentration of 20 mg / kg. HE lung tissue staining showed that the lung injury of mice in the 20 mg / kg PDK4-in group was significantly lower than that in the CLP group. PDK4-in was used to treat acute lung injury in sepsis.
[0041] VII. Detect lactate concentration in the left lung of mice using a lactate assay kit (Solarbio, Beijing, China, BC2235). Remove the left lungs of mice from each group, rinse thoroughly in pre-chilled PBS, grind the tissue homogenate on ice, transfer the tissue homogenate into a 1.5 mL EP tube, and centrifuge. Retain the supernatant. The supernatant was used for lactate detection. Add the supernatant, enzyme working solution, and color developer according to the manufacturer's instructions. Incubate at 37°C in the dark for 10-30 minutes. Measure the OD value (around 530 nm) with a microplate reader. Calculate the concentration using the standard curve. See the standard curve for concentration results. Figure 3 Add 1 ml of trizol to the lower layer of the EP tube, pipette repeatedly to lyse the cells, and freeze the sample in a -80℃ refrigerator for later use.
[0042] Figure 3 As shown in the results, in the mouse model, the 10 mg / kg PDK4-in group showed a slight decrease in lactate concentration compared to the CLP group. However, the 10 mg / kg PDK4-in group did not significantly reduce lung lactate concentrations in CLP mice, whereas the 20 mg / kg and 30 mg / kg PDK4-in groups significantly reduced lung lactate concentrations. *p < 0.05, **p < 0.01, and ****p < 0.0001, respectively. This suggests that PDK4-in at concentrations of 20 mg / kg and 30 mg / kg can reduce lactate production and prevent pathological lactate accumulation in the lungs.
[0043] The EP tube substratum was treated with 1 ml of trizol and assayed for mRNA transcript levels of inflammatory factors using a laboratory-established qPCR method. Total RNA was extracted from the tissues in the EP tube substratum using TRIzol reagent (Beyotime, Shanghai, China, R0016). cDNA was synthesized using reverse transcriptase and subjected to quantitative real-time polymerase chain reaction (qRT-PCR). Amplification was performed on a real-time qRT-PCR system, and the threshold cycle (Ct) value was recorded. The Ct values of the target genes were normalized to the β-actin internal reference gene. The change in gene expression in each experimental group relative to the control group was calculated using the 2^(-ΔΔCt) formula. All experiments were performed in triplicate. The target gene expression levels in each sample group were analyzed using the internal reference gene correction calculation results. The primer sequences used for each inflammatory factor are shown in Table 1 below.
[0044] Table 1 Primer sequences used for various inflammatory factors
[0045] Gene Forward primer Reverse primer IL-6 CTGCAAGAGACTTCCATCCAG (SEQ ID NO.1) AGTGGTATAGACAGGTCTGTTGG (SEQ ID NO.2) TNF-α CAGGCGGTGCCTATGTCTC (SEQ ID NO.3) CGATCACCCCGAAGTTCAGTAG (SEQ ID NO.4) IL-1β GAAATGCCACCTTTTGACAGTG (SEQ ID NO.5) TGGATGCTCTCATCAGGACAG (SEQ ID NO.6) β-actin AGCCATGTACGTAGCCATCC (SEQ ID NO.7) CTCTCAGCTGTGGTGGTGAA (SEQ ID NO.8)
[0046] Statistical analyses were performed using SPSS software. Data are expressed as mean ± standard deviation (SD). Data between two groups were compared using the t-test. Data between multiple groups were compared using one-way analysis of variance (ANOVA) with Bonferroni correction for multiple comparisons. P values < 0.05 were considered statistically significant.
[0047] Lung tissues of mice in the Sham group, CLP group, and CLP+PDK4-in (20 mg / kg) group (with a PDK4-in concentration of 20 mg / kg) were collected for qPCR. The results are as follows: Figures 4 to 6 As shown in the results, the mRNA expression levels of inflammatory factors (IL-6, IL-1β and TNF-α) in the CLP group were the highest, and the mRNA expression levels of inflammatory factors (IL-6, IL-1β and TNF-α) in the Sham group were the lowest. The mRNA expression levels of inflammatory factors (IL-6, IL-1β and TNF-α) in the CLP+PDK4-in group with a PDK4-in concentration of 20 mg / kg were significantly lower than those in the CLP group. It can be seen that the PDK4-in drug at a concentration of 20 mg / kg can significantly reduce the inflammatory factors IL-6, IL-1β and TNF-α in mice with acute lung injury caused by sepsis.
[0048] Although the present invention is disclosed as above, the protection scope of the present invention is not limited thereto. Those skilled in the art may make various changes and modifications without departing from the spirit and scope of the present invention, and these changes and modifications will fall within the protection scope of the present invention.
Claims
1. Application of a pyruvate dehydrogenase kinase 4 inhibitor in the preparation of drugs for treating sepsis-induced acute lung injury.
2. The use of the pyruvate dehydrogenase kinase 4 inhibitor according to claim 1 in the preparation of a drug for treating sepsis-induced acute lung injury, characterized in that: The treatment of sepsis-induced acute lung injury is achieved by blocking PDK4 activity and thereby relieving the inhibition of the pyruvate dehydrogenase complex. The relieving the inhibition of the pyruvate dehydrogenase complex can promote the entry of pyruvate into the tricarboxylic acid cycle.
3. The use of the pyruvate dehydrogenase kinase 4 inhibitor according to claim 1 in the preparation of a drug for treating sepsis-induced acute lung injury, characterized in that: The treatment of sepsis-induced acute lung injury is achieved by regulating lactate metabolism, and the regulation of lactate metabolism is used to block pathological lactate accumulation in the lungs.