Use of miR-30d-5p and cyp24a1 inhibitor in hormone-induced femoral head necrosis

Abstract

The application provides an application of miR-30d-5p and CYP24A1 inhibitor in hormone-induced femoral head necrosis, and belongs to the technical field of biological medicine.The application firstly provides a hormone-induced femoral head necrosis treatment strategy based on miR-30d-5p mimic by determining the molecular mechanism of miR-30d-5p in the regulation of CYP24A1 in the vitamin D metabolic pathway, and the direct effect is to significantly promote osteoblast differentiation and bone matrix mineralization, effectively improve bone microstructure damage and delay the femoral head collapse process; in the application significance, the application provides a new solution to the predicament of the lack of targeted drug treatment in clinic, and lays a conversion foundation for conservative treatment and hip-preserving surgery combined treatment by blocking the disease progression through specific molecular intervention.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological medicine, and particularly relates to application of miR-30d-5p and CYP24A1 inhibitor in hormone-induced osteonecrosis of the femoral head. BACKGROUND

[0002] Osteonecrosis of the femoral head (ONFH) is caused by abnormal bone metabolism, microcirculation disorder and other factors, leading to abnormal subchondral bone structure, bone necrosis and microcirculation abnormalities. Part of the bone cells and bone marrow components in the bone tissue of ONFH are dead, further leading to bone tissue necrosis, eventually causing femoral head structure change and collapse, evolving into secondary hip osteoarthritis, and the clinical symptoms are severe hip pain and dysfunction. ONFH is a common and refractory disease in clinic, and mainly affects young people. According to the latest epidemiological research in the United Kingdom, the average age of onset of the British population is 58.3 years old. According to a domestic epidemiological survey, there are about 8.12 million cases of ONFH in people aged 15 and above, and the high-risk age group is 40-49 years old, and the male prevalence rate is about twice that of females. ONFH can be divided into traumatic and non-traumatic femoral head necrosis, and the main cause of non-traumatic femoral head necrosis is hormone use and alcohol intake. Steroid-induced osteonecrosis of the femoral head (SONFH) is the most common, which is closely related to the use of glucocorticoids, and the incidence accounts for 25% to 50% of non-traumatic femoral head necrosis. As a first-line treatment drug and immune-regulating drug for various infectious diseases (such as severe acute respiratory syndrome) and immune diseases (such as systemic lupus erythematosus and acute lymphoblastic leukemia), long-term or excessive use of hormones such as corticosteroids and dehydrocorticosteroids can cause femoral head avascular necrosis. Due to the increasing incidence of SONFH, the onset age is relatively young, and it seriously affects the hip joint dysfunction and life activities, and is becoming a global health problem that is increasingly concerned.

[0003] Because ONFH typically develops at a young age, the 2019 guidelines for the diagnosis and treatment of ONFH in adults, guidelines developed by the Chinese Medical Association, and guidelines published by the American College of Rheumatology / American Association of Hip and Knee Physicians all recommend prioritizing various hip-preserving treatment techniques. These include conservative treatments such as vasodilators, orthoses, and hyperbaric oxygen therapy, as well as hip-preserving surgeries such as core decompression, bone transport, and osteotomy. However, these treatments are not ideal, and as the disease progresses, patients may require debridement of necrotic areas and hip replacement. According to a North American study, approximately 5% to 18% of ONFH patients undergo total hip replacement surgery. Due to the limited lifespan of prosthesis materials and construction, these patients often face the risk of multiple revision surgeries. Therefore, identifying new treatments and preventing ONFH progression in its early stages may be of great value in the management of ONFH. Summary of the Invention

[0004] The purpose of the present invention is to provide the application of miR-30d-5p in hormone-induced femoral head necrosis, providing an effective means for ONFH intervention.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides the use of miR-30d-5p in preparing a medicine for treating hormone-induced femoral head necrosis. The nucleotide sequence of the miR-30d-5p is shown in SEQ ID NO.1.

[0007] The present invention also provides the use of agomiR-30d-5p in preparing a drug for treating hormone-induced femoral head necrosis. The nucleotide sequence of agomiR-30d-5p is shown in SEQ ID NO.2.

[0008] The present invention also provides use of a pharmaceutical composition in preparing a drug for treating hormone-induced femoral head necrosis, wherein the pharmaceutical composition comprises miR-30d-5p as shown in SEQ ID NO.1.

[0009] The present invention also provides an application of a pharmaceutical composition in preparing a drug for treating steroid-induced femoral head necrosis, wherein the pharmaceutical composition comprises agomiR-30d-5p as shown in SEQ ID NO.2.

[0010] Preferably, the pharmaceutical composition further comprises a transfection reagent.

[0011] The present invention also provides the use of a CYP24A1 inhibitor in developing, screening or preparing a product for preventing and / or treating hormone-induced femoral head necrosis.

[0012] Preferably, the inhibitor is an siRNA targeting the CYP24A1 gene.

[0013] Preferably, the pharmaceutical composition further comprises a CYP24A1 inhibitor.

[0014] Preferably, the CYP24A1 inhibitor is an siRNA targeting the CYP24A1 gene.

[0015] Preferably, the nucleotide sequence of the siRNA comprises a sense strand as shown in SEQ ID NO. 8 and an antisense strand as shown in SEQ ID NO. 9.

[0016] Advantages of the present application:

[0017] The present application provides a hormone-induced femoral head necrosis treatment strategy based on miR-30d-5p mimics by elucidating the molecular mechanism of miR-30d-5p targeting and inhibiting CYP24A1 to regulate the vitamin D metabolic pathway. The direct effect is to significantly promote osteoblast differentiation and bone matrix mineralization, effectively improve bone microstructure damage and delay the collapse process of the femoral head. In terms of application, the present application provides a new solution to the dilemma of the lack of targeted drug treatment in clinical practice, and lays a transformational foundation for conservative treatment and hip-preserving surgery combined therapy by blocking disease progression through specific molecular intervention. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 is a schematic diagram of the principle of the present application scheme;

[0019] Figure 2 is a vector map used in the examples, wherein A is the vector GV716 and B is GV272;

[0020] Figure 3 is the binding of the target gene CYP24A1 reporter gene to the miR-30d-5p target gene, wherein: (A) predicts the binding site of miR-30d-5p and CYP24A1; (B) the change in relative luciferase activity value proves the binding relationship between miR-30d-5p and CYP24A1. * P<0.05, ** P<0.01, *** P<0.001, **** P<0.0001, ns represents no significant difference;

[0021] Figure 4To promote alkaline phosphatase production and calcium deposition after transfection of the target gene miR-30d-5p, wherein: (A) BCIP / NBT alkaline phosphatase color development and semi-quantitative results after miR-30d-5p transfection, n = 3, scale 500 μm; (B) ARS staining and semi-quantitative results after miR-30d-5p transfection, n = 3, scale 500 μm. Mean ± standard deviation, * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001, ns represents no significant difference, miR-30d-5p group refers to the miR-30d-5p simulation experiment group, miR-NC group refers to the non-functional simulation control group, inh-30d-5p group refers to the miR-30d-5p inhibition experiment group, and inh-NC group refers to the non-functional inhibition control group;

[0022] Figure 5 To promote osteogenic differentiation staining after interfering with the target gene Cyp24a1, wherein: (A) BCIP / NBT alkaline phosphatase color development, ARS staining and semi-quantitative results after Cyp24a1 transfection, scale: 500 μm, n = 3; (B) Cell immunofluorescence results and 3D visualization results of osteogenic differentiation indicators after Cyp24a1 transfection, blue represents cell nucleus, yellow is cell skeleton, and green is target protein, scale: 50 μm; (C) Semi-quantitative results of cell immunofluorescence of osteogenic differentiation indicators after Cyp24a1 transfection, n = 3. Mean ± standard deviation, * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001, siCYP24A1 group represents the Cyp24a1 gene interference experiment group, and si-NC group represents the non-functional siRNA interference control group;

[0023] Figure 6 To promote bone repair in the ONFH model, wherein: (A) Micro-CT coronal, sagittal, transverse, 3D reconstruction images and femoral head gross observation of each group, scale: 0.1 mm; (B) Bone morphological results of subchondral area of femoral head of each group, n = 5, mean ± standard deviation, * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001, ns no significant difference, ago-30d-5p refers to the miR-30d-5p in vivo simulation group, and ago-NC refers to the non-functional miR-NC in vivo simulation group. DETAILED DESCRIPTION

[0024] The technical solutions provided by the present application are described in detail below in conjunction with the examples, but they should not be understood as limiting the scope of protection of the present application.

[0025] Figure 1 To illustrate the effect of the present application, the miR-30d-5p can inhibit Cyp24a1 after being supplemented, prevent the active 1,25 (OH) 2D3 from being decomposed into the inactive 24,25 (OH) 2D3, and thus promote bone formation.

[0026] Examples

[0027] Plasmid and vector construction: The plasmid and overexpression vector used in the experiment were designed and constructed by Jikai Gene. The rno-miR-30d-5p (UGUAAACAUCCCCGACUGGAAG) was inserted into the insertion site-BamHI / AgeI of the vector GV716, and the vector map is shown in Figure 2 A. The wild type and mutant overexpression vectors are GV272, and the map is shown in Figure 2 B. The insertion site is XbaI / XbaI.

[0028] Cell transfection: The designed target miRNA report plasmid and target gene-3'UTR, target gene-3'UTR-MUT (mutant) were transfected into MC3T3-E1 cells according to the experimental design. A total of 6 groups were divided, respectively: miR-NC+3'UTR-NC, miR-NC+3'UTR, miR-NC+3'UTR-MUT, miR-target+3'UTR-NC, miR-target+3'UTR and miR-target+3'UTR-MUT.

[0029] Detection process: After 48 hours, the luciferase activity was detected according to the content of the Dual-Luciferase reporter kit instruction. Briefly, after discarding the cell culture medium, PBS was washed, and an appropriate amount of lysis solution was added, and lysis was performed on ice for 5 min, and then transferred to an EP tube, centrifuged at 4°C, ×12,000 g for 2 min, and 20 μL of supernatant was sucked into a black bottom light-proof 96-well plate; 50 μL of balanced room temperature firefly luciferase reaction solution was added to the 96-well plate, immediately placed into the enzyme marker, linearly vibrated for 8 s, and the luminescence value was detected; then 50 μL of freshly prepared sea cucumber substrate working solution was immediately added, immediately placed into the enzyme marker, linearly vibrated for 8 s, and the luminescence value was detected. The relative activity was represented by the ratio of firefly luciferase fluorescence value to sea cucumber luciferase fluorescence value.

[0030] The in vitro verification of miRNA was divided into the following groups: target miRNA mimic group (transfected with target miRNA mimic, miR-target group), non-functional mimic control group (transfected with mimic-NC, miR-NC group), target miRNA inhibitor group (transfected with target miRNA inhibitor, inh-target miRNA group), and non-functional inhibitor control group (transfected with inhibitor-NC, inh-NC group).

[0031] The in vitro verification of target gene was divided into the following groups: siRNA interference target gene group (transfected with target gene-siRNA, siCYP24A1 group) and non-functional siRNA interference control group (transfected with siRNA-NC, si-NC group).

[0032] Here, the sequences of miR-30d-5p mimic, miR-30d-5p inhibitor, mimic-NC, inhibitor-NC, Cyp24a1-siRNA and siRNA-NC are listed (Table 1).

[0033] Table 1 Sequences related to in vitro mechanism verification

[0034] Name Sequence (5'-3') miR-30d-5p mimic Sense: UGUAAACAUCCCCGACUGGAAG, as shown in SEQ ID NO. 1; Antisense: UCCAGUCGGGGAUGUUUACAUU, as shown in SEQ ID NO. 3; mimic-NC Sense: UCACAACCUCCUAGAAAGAGUAGA, as shown in SEQ ID NO. 4; Antisense: UCUACUCUUUCUAGGAGGUUGUGA, as shown in SEQ ID NO. 5; miR-30d-5p inhibitor Sense: CUUCCAGUCGGGGAUGUUUACA, as shown in SEQ ID NO. 6; inhibitor-NC Sense: UCUACUCUUUCUAGGAGGUUGUGA, as shown in SEQ ID NO. 7; Cyp24a1-siRNA Sense: AAAUUUUAAAAUGUUUACA(dT)(dT), as shown in SEQ ID NO. 8; Antisense: UGUAAACAUUUUAAAAUUU(dT)(dT), as shown in SEQ ID NO. 9;

[0035] According to the different groups, the prepared solution containing the corresponding transfection reagent was added to the cell culture system according to the Lipo8000 transfection reagent instruction, and the culture was carried out in α-MEM medium without fetal bovine serum. After 6 h, the culture medium containing 10% fetal bovine serum α-MEM was replaced. For each well to be transfected in a six-well plate, 125 μL of α-MEM culture medium without antibiotics and serum was added, 2.5 μg of miRNA or siRNA was added, and the mixture was gently blown and mixed with a pipette; 4 μL of Lipo8000 transfection reagent was added, and the mixture was also gently blown and mixed with a pipette. Do not vortex or centrifuge.

[0036] In the experiment, only the control group was injected with 0.9% normal saline in the gluteal muscle, and the other groups were injected with MPS (20 mg / kg / d) in the gluteal muscle. The model group, ago-target miRNA group and ago-NC group were injected with PBS, agomiR-target (target miRNA in vivo mimic group, synthesized by Beijing Genecopoeia Inc.) and agomiR-NC (non-functional miR-NC in vivo mimic group) in the tail vein, respectively. The modeling and intervention frequency and duration are shown in Table 2.

[0037] Table 2 Intervention scheme of rats in different groups

[0038] Group Intervention scheme Control group Injection of 0.9% normal saline, 100 μL, once a day, 3 days continuously per week, for 3 weeks Model group Injection of MPS, 20 mg / kg / d, 100 μL, once a day, 3 days continuously per week, for 3 weeks; injection of PBS (100 μL) in the tail vein, for 3 weeks ago-target miRNA group Injection of MPS, the same dose as the model group; injection of target miRNA in vivo mimics (250 nmol / kg / d) in the tail vein, once a day, 3 days continuously per week, for 3 weeks ago-NC group Injection of MPS, the same dose as the model group; injection of non-functional miRNA in vivo mimics, once a day, 3 days continuously per week, for 3 weeks

[0039] miRNA in vivo mimic agomiR-30d-5p sequence:

[0040] UGUAAACAUCCCCGACUGCAAG, as shown in SEQ ID NO. 2;

[0041] 3. Results

[0042] There are four binding sites between miR-30d-5p and the target gene CYP24A1, such as Figure 3 As shown in A, the binding sequence of Cyp24a1-3'UTR (miR-30d-5p) is TGTTTAC, and the same site of cyp24a1-3'UTR (miR-30d-5p)-MUT is designed to be GTGGGCA. In order to verify the binding relationship between the target gene miR-30d-5p and the target gene Cyp24a1, a dual luciferase gene reporter experiment was designed, and the results are shown in Figure 3 As shown in B, after co-transfection of miR-30d-5p mimics with WT-CYP24A1 3'UTR (wild type) vector, the relative luciferase activity of the miR-30d-5p mimics group was significantly different compared with the mimics NC control group, NC-3'UTR, and MUT-CYP24A1 3'UTR (mutant type) ( P <0.0001); however, the relative luciferase activity detected by co-transfection of NC-3'UTR, MUT-CYP24A1 3'UTR and miR-30d-5p mimics was not significantly different from that of the mimics NC control group, indicating that the target gene miR-30d-5p can bind to the target gene Cyp24a1.

[0043] BCIP / NBT and ARS staining results showed that miR-30d-5p promoted alkaline phosphatase production and calcium deposition in MC3T3-E1 cells: osteogenic induction was performed 3 days after transfection, and the BCIP / NBT alkaline phosphatase color development results and semi-quantitative decomposition results were as follows 7 days later. Figure 4 As shown in A. Compared with the other groups, the color reaction of the miR-30d-5p group was significantly enhanced ( P <0.001), indicating that miR-30d-5p promotes the production of alkaline phosphate in MC3T3-E1 cells. ARS staining was performed on day 21, and the results were as follows Figure 4 As shown in B, compared with the other groups, the ARS staining reaction in the miR-30d-5p group was significantly enhanced ( P <0.001), and the difference was statistically significant, indicating that miR-30d-5p promoted calcium deposition in MC3T3-E1 cells.

[0044] Osteogenic staining and differentiation-related index cell immunofluorescence results prove that CYP24A1 inhibition promotes MC3T3-E1 cell alkaline phosphatase production and calcium deposition: osteogenic induction was performed 3 days after transfection, and BCIP / NBT alkaline phosphatase color development results and semi-quantitative analysis results at 7 days are shown in Figure 5 A, compared with the si-NC group, the color development of the siCYP24A1 group was significantly enhanced P <0.001). ARS staining was performed at 21 days, and compared with the si-NC group, the color development of the siCYP24A1 group was significantly enhanced P <0.001). Cell immunofluorescence results and semi-quantitative analysis results after transfection are shown in Figure 5 B and Figure 5 C, compared with the si-NC group, the expression of BMP2, RUNX2, COL I A1 and OCN in the siCYP24A1 group was increased P <0.01), which was statistically significant, indicating that CYP24A1 has an inhibitory effect on the osteogenic differentiation of MC3T3-E1 cells and the expression of osteogenic differentiation-related proteins in a hormone environment.

[0045] The femoral head gross observation and micro-CT imaging are shown in Figure 6 A, the femoral head gross observation of the model group and the ago-NC group is redder than that of the control group and the ago-30d-5p group; the subchondral bone structure of the femoral head of the model group and the ago-NC group appears to be damaged to varying degrees, and the subchondral area of the femoral head is formed, the bone trabecula structure is disordered, the arrangement is irregular, and the density is uneven; the subchondral bone trabecula of the rats in the ago-30d-5p group is very slightly damaged, the bone trabecula is relatively complete and evenly distributed, and the cartilage surface is relatively uniform, indicating that after injection of miR-30d-5p mimic, the subchondral bone structure of the femoral head is close to normal. The bone morphometric parameter quantitative analysis of the femoral head of each group is shown in Figure 6 B, compared with the model group and the ago-NC group, the BV / TV, Tb.Th, Tb.Sp, Tb.N and BMD in the ago-30d-5p group were significantly increased (P<0.01), and the BS / BV was significantly decreased (P<0.01). The micro-CT image and the subchondral bone morphometric and bone trabecula quantitative analysis results of the femoral head confirmed the positive effect of miR-30d-5p injection on promoting bone repair in ONFH rats.

[0046] The above only describes the preferred embodiments of the present application, and it should be noted that for those skilled in the art, without departing from the principles of the present application, a number of improvements and refinements can be made, which should also be considered as the protection scope of the present application.

Claims

1. Application of miR-30d-5p in the preparation of a drug for treating hormone-induced femoral head necrosis, characterized in that, The nucleotide sequence of the miR-30d-5p is shown as SEQ ID NO.

1.

2. Use of a pharmaceutical composition for the manufacture of a medicament for the treatment of hormone-induced osteonecrosis of the femoral head, characterized in that, The pharmaceutical composition comprises the miR-30d-5p shown as SEQ ID NO.

1.

3. Use according to claim 2, characterized in that, The pharmaceutical composition further comprises a transfection reagent.

4. Use of a CYP24A1 inhibitor in the preparation of a product for preventing and / or treating hormone-induced femoral head necrosis; The inhibitor is an siRNA targeting the CYP24A1 gene; The nucleotide sequence of the siRNA comprises a sense strand shown as SEQ ID NO. 8 and an antisense strand shown as SEQ ID NO. 9.

Images