Application of metagen of fermented lactobacillus mucilaginosus in preparation of intestinal barrier injury repair product or prevention product
By fermenting the extracellular polysaccharide (B44-EPS) of Lactobacillus mucilaginosus B44, an intestinal barrier damage repair product is prepared, which solves the unclear structure-activity relationship of probiotic polysaccharides in intestinal barrier repair, realizes the effective repair and prevention of intestinal barrier, and is suitable for food and medicine.
Patent Information
- Application Number
- CN202511049076.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-29
- Publication Date
- 2025-09-16
AI Technical Summary
In the existing technology, the structure-activity relationship of probiotic polysaccharides in the repair of intestinal barrier damage is not clear, and the purification process optimization and safety assessment in large-scale production are insufficient, which limits their clinical application in the field of functional foods and enteral nutrition.
The exopolysaccharide (B44-EPS) of Limosilactobacillus fermentum B44 is used as a postbiotic and is prepared through fermentation, precipitation, protein removal and dialysis. It is used to prepare intestinal barrier damage repair products, increase the resistivity of intestinal barrier cells, reduce permeability and enhance the expression of key genes.
B44-EPS significantly increased the resistivity of cells damaged by the intestinal barrier caused by LPS, reduced permeability, and enhanced the expression of ZO-1 and Muc-2 genes. It has a good intestinal barrier repair effect and is suitable for food and medicine, with food safety and stability.
Smart Images

Figure HDA0005522607060000011 
Figure HDA0005522607060000012 
Figure HDA0005522607060000021
Abstract
Description
Technical Field
[0001] The present invention relates to the field of microorganisms, and in particular to use of postbiotics of fermented Lactobacillus mucilaginosus in the preparation of intestinal barrier damage repair products or prevention products. Background Art
[0002] As the body's "gatekeeper of immunity and metabolism," damage to the intestinal barrier not only triggers local intestinal dysfunction but also ripples throughout the body through the microbiota-immune-metabolism network. From a physiological perspective, tight junction disruption, microbiota translocation, and the entry of endotoxins into the bloodstream are key pathogenic links. Lipopolysaccharide (LPS), the main component of the outermost layer of the Gram-negative bacterial cell wall, is amphiphilic due to its water-soluble sugar portion and fat-soluble lipid portion, making it soluble in both water and lipids. LPS is not released during normal bacterial survival but is typically released when the bacteria die, rupture, are artificially lysed, or actively reproduce. When the intestine is damaged (e.g., due to low levels of secretory immunoglobulin A (sIgA)), LPS in the intestine can (with or without the involvement of lectins) open the intestinal barrier, leading to increased intestinal permeability and promoting inflammatory responses. For example, patients with irritable bowel syndrome (IBS) often experience elevated LPS levels and exacerbated inflammation. Once LPS crosses the intestinal barrier (or other barriers such as the skin and lungs) and enters the blood, it can trigger metabolic endotoxemia. Changes in LPS levels can be important markers of intestinal flora imbalance and / or microbial infection. Increasing the proportion of Gram-negative bacteria can increase intestinal permeability and lead to elevated blood LPS levels.
[0003] From a clinical perspective, the intestinal barrier is closely linked to digestive system diseases, metabolic syndrome, and autoimmune diseases. Understanding these influences will help advance the development of strategies to prevent and treat "intestinal-systemic diseases," such as repairing the intestinal barrier through probiotics, dietary fiber, and anti-inflammatory diets to reduce the risk of related diseases.
[0004] Polysaccharides have multi-dimensional protective significance in repairing lipopolysaccharide (LPS)-induced intestinal barrier damage, and their mechanisms of action encompass anti-inflammation, barrier structure repair, microbiota regulation, and metabolic intervention. Representative polysaccharides include: ① Ganoderma lucidum polysaccharide reduces intestinal permeability (FD-4 fluorescent labeling) and increases tight junction protein expression in the LPS mouse model; ② Inulin increases cell monolayer resistance and Claudin-1 expression in the Caco-2 cell model; ③ Astragalus polysaccharide reduces intestinal mucosal pathology scores and reduces the area of mucosal ulcers in the rat LPS model; and ④ Xylo-oligosaccharides selectively enrich Akkermansia in the mouse intestine and enhance mucus layer integrity. Polysaccharides specifically antagonize the pathological chain of LPS-induced intestinal barrier damage through a multi-dimensional mechanism of "anti-inflammation-barrier repair-microbiota regulation-metabolic optimization." Its core advantages are: high natural safety, most edible polysaccharides are non-cytotoxic and suitable for long-term intervention; they have the synergistic effect of directly repairing the intestinal epithelium and indirectly regulating through microbial metabolism; they have shown clinical transformation potential in the fields of functional foods and enteral nutrition, and are expected to become a new auxiliary treatment strategy for intestinal barrier-related diseases such as inflammatory bowel disease and metabolic syndrome in the future. In-depth analysis of the interaction mechanism between polysaccharides and the intestinal barrier will provide a new approach from basic research to clinical application for the prevention and treatment of "intestinal-systemic diseases", and promote the practice of polysaccharide-based multi-target repair solutions in precision health management. The field of probiotics has long focused on the colonization ability of live bacteria, antibacterial activity and immunomodulatory effects (such as live bacterial intervention studies of Lactobacillus and Bifidobacterium), while the functional exploration of polysaccharides as secondary metabolites of probiotics (such as extracellular polysaccharides EPS) has lagged behind. Although probiotic polysaccharides have shown a clear role in intestinal barrier restoration, their structure-activity relationship (such as polysaccharide molecular structure and molecular weight) and target sites still need in-depth research, and the optimization of purification processes and safety assessments (such as allergic risks) in large-scale production are key to promoting clinical applications. In the future, combined with precision medicine, the development of specific polysaccharide preparations for different types of intestinal barrier damage is expected to become a new direction for intestinal health intervention. According to the 2021 consensus of the International Scientific Association of Probiotics and Synbiotics (ISAPP), postbiotics are "biologically active ingredients produced by probiotics that exert health benefits in the host." The exopolysaccharide EPS, a metabolite of probiotics, is a typical postbiotic. Fermented Lactobacillus mucinus B44 has been shown to have anti-caries effects. It is a probiotic with great potential and research value. Research on its related metabolites is very valuable, and probiotic polysaccharides can be used as functional additives in yogurt and dietary supplements to enhance the intestinal health benefits of the product.
[0005] Therefore, screening probiotic postbiotics that can enhance intestinal barrier function, are stable and have strong applicability has great value and prospects. Summary of the Invention
[0006] In view of the above-mentioned shortcomings of the prior art, the object of the present invention is to provide a use of postbiotics of fermented Lactobacillus mucilaginosus in the preparation of intestinal barrier damage repair products or prevention products, so as to solve the problems in the prior art.
[0007] To achieve the above-mentioned and other related purposes, the present invention provides the use of postbiotics of fermented Lactobacillus mucilaginosus in the preparation of an intestinal barrier damage repair product or an intestinal barrier damage prevention product.
[0008] The fermentative mucus lactobacillus is Limosilactobacillus fermentum B44, and its preservation number is CGMCC No.17321.
[0009] Preferably, the postbiotic is an exopolysaccharide.
[0010] The exopolysaccharide is a substance prepared by the following method:
[0011] 1) obtaining a fermentation supernatant from milk fermented by Limosilactobacillus fermentum B44;
[0012] 2) precipitating the fermentation supernatant and collecting the precipitate;
[0013] 3) Dissolve the precipitate and remove excess protein, collect the supernatant, and obtain extracellular polysaccharide.
[0014] The intestinal barrier damage repair product is a product for treating intestinal diseases. The intestinal barrier damage repair product has any one or more of the following effects:
[0015] 1) Increase the electrical resistivity of damaged cells in the intestinal barrier;
[0016] 2) reduce the permeability of damaged cells in the intestinal barrier;
[0017] 3) Increase the expression of key genes of intestinal barrier.
[0018] The key intestinal barrier genes are selected from Zo-1 and / or Muc2.
[0019] The intestinal barrier damage repair product is a medicine, food or health product.
[0020] The food is selected from fermented dairy products or non-fermented dairy products. The food is, for example, a solid beverage or pasteurized milk.
[0021] The intestinal barrier damage repair product can be used to treat or prevent intestinal barrier damage caused by LPS or pathogenic bacteria.
[0022] As described above, the use of the postbiotics of fermented Lactobacillus mucilaginosus of the present invention in the preparation of intestinal barrier damage repair products or prevention products has the following beneficial effects:
[0023] Limosilactobacillus fermentum strain B44 is an edible strain, ensuring the food safety of the product. From a social perspective, the present invention utilizes B44-EPS to restore LPS-induced intestinal barrier damage and increased permeability, offering promising prospects for preventing intestinal barrier damage and related diseases. From an economic perspective, its stability and excellent processability make it widely applicable to health supplements, foods, and fermented products, enhancing their efficacy. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] Figure 1 The results of resistivity measurements are shown, where "before" and "after" refer to the resistance value measured before the addition of the intervention substance and the resistance value measured again after the intervention substance was removed and PBS was added after the incubation.
[0025] Figure 2 Shown are the results of permeability assays.
[0026] Figure 3 The figure shows the relative mRNA expression of ZO-1, a key gene of intestinal barrier function, induced by LPS.
[0027] Figure 4 The figure shows the relative mRNA expression of Muc-2, a key gene of intestinal barrier function, induced by LPS. DETAILED DESCRIPTION
[0028] The present invention provides use of postbiotics produced by fermenting Lactobacillus mucilaginosus in preparing an intestinal barrier damage repair product or an intestinal barrier damage prevention product.
[0029] In certain embodiments of the present invention, the fermented mucus lactobacillus is Lactobacillus fermentum B44, with a deposit number of CGMCC No. 17321. The strain was deposited on March 8, 2019, at the General Microbiology Center (CGMCC) of the Chinese Academy of Sciences, Institute of Microbiology, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The strain was classified and named Lactobacillus fermentum when it was deposited, and was renamed Limosilactobacillus fermentum in 2020. The fermented mucus lactobacillus is Limosilactobacillus fermentum B44, which is an edible strain and can ensure food safety.
[0030] In certain embodiments of the present invention, the postbiotic is an exopolysaccharide.
[0031] Exopolysaccharides (EPS) refer to high-molecular-weight polysaccharides synthesized by microorganisms and secreted into the extracellular environment. They are composed of monosaccharide units, which can be glucose, fructose, galactose, rhamnose, fucose, mannose, etc. The monosaccharide units are connected by glycosidic bonds to form linear or branched polysaccharide chains. EPS may contain additional chemical modifications, such as acetyl groups, sulfate groups, phosphate groups, etc. These modifications affect their physicochemical properties and functions. The biosynthesis of EPS usually involves multiple steps, including activation, transfer and polymerization processes. The metabolic pathways within microbial cells are responsible for the synthesis of EPS precursors, which are then secreted outside the cell through specific transport mechanisms.
[0032] The exopolysaccharide is derived from fermentation of Lactobacillus mucilaginosus B44, i.e., the exopolysaccharide is a specific product or extract produced by the fermentation process of Lactobacillus mucilaginosus B44. In a specific embodiment of the present application, the exopolysaccharide is produced and extracted by the fermentation process of Lactobacillus mucilaginosus B44.
[0033] The exopolysaccharide is a substance prepared by the following method:
[0034] 1) obtaining a fermentation supernatant from milk fermented by Limosilactobacillus fermentum B44;
[0035] 2) precipitating the fermentation supernatant and collecting the precipitate;
[0036] 3) Dissolve the precipitate and remove excess protein, collect the supernatant, and obtain extracellular polysaccharide.
[0037] In a specific embodiment of the present application, in step 1), the fermented milk obtained by fermenting Lactobacillus fermentum B44 is obtained by inoculating Lactobacillus fermentum B44 into skim milk and fermenting.
[0038] Skim milk refers to a dairy product from which most or all of the milk fat has been removed through processing. The skim milk can be a ready-made skim milk product or self-prepared skim milk. In a specific embodiment of the present application, it includes skim milk powder and water.
[0039] In a specific embodiment of the present application, the mass percentage of the above-mentioned skim milk powder in the skim milk can be 6-12%, for example, 6%, 7%, 8%, 9%, 10%, 11%, or 12%.
[0040] In a specific embodiment of the present application, in step 1), the fermentation time can be 36 to 60 hours, for example, 36 to 40 hours, 40 to 45 hours, 45 to 50 hours, 50 to 55 hours, or 55 to 60 hours. In a preferred embodiment, the fermentation time is 48 hours.
[0041] In a specific embodiment of the present application, in step 1), the fermentation temperature can be 25-42° C., for example, 25-30° C., 30-37° C., or 37-42° C. In a preferred embodiment, the fermentation temperature is 37° C. Fermenting Lactobacillus mucilaginosus B44 at the above inoculum size, fermentation time, and fermentation temperature can increase the yield of exopolysaccharides produced by Lactobacillus mucilaginosus B44.
[0042] In a specific embodiment of the present application, in step 1), Lactobacillus mucilaginosus B44 is inoculated into skim milk and fermented until the pH of the fermentation liquid reaches 5.6, which indicates that the fermentation is complete.
[0043] In a specific embodiment of the present application, step 1) also includes inactivating the fermented milk, specifically by inactivating the fermented Lactobacillus mucilaginosus B44 at high temperature, so as to reduce the risk of live microorganisms in the product, ensure the safety of the product, maintain the stability of EPS, and improve its purity.
[0044] In a specific embodiment of the present application, in step 1), the inactivation temperature can be 80-100°C, for example, 80-85°C, 85-90°C, 90-95°C, 95-100°C. In a certain embodiment of the present application, boiling water can be used.
[0045] In a specific embodiment of the present application, in step 1), the inactivation time can be 20 to 40 minutes; for example, it can be 20 to 25 minutes, 25 to 30 minutes, 30 to 35 minutes, or 35 to 40 minutes.
[0046] Obtaining the fermentation supernatant refers to separating the liquid portion (supernatant) from the solid portion in the mixture during the solid-liquid separation process, and can be carried out by sedimentation, centrifugation, filtration, vacuum filtration, ultrafiltration, dialysis, evaporation, reverse osmosis, electrophoresis, and chromatography. In a specific embodiment of the present application, in step 1), the method for obtaining the fermentation supernatant is centrifugation.
[0047] In a specific embodiment of the present application, in step 2), the method for precipitating the fermentation supernatant is alcohol precipitation.
[0048] Alcohol precipitation can be performed using anhydrous ethanol, ethanol aqueous solutions of different concentrations, isopropyl alcohol, or polyethylene glycol. In a specific embodiment of the present application, in step 2), the alcohol precipitation is performed by adding anhydrous ethanol.
[0049] In a specific embodiment of the present application, in step 2), the volume ratio of the added anhydrous ethanol and the supernatant can be 2.5-4:1, for example, it can be 2.5-2.7:1, 2.7-3.0:1, 3.0-3.2:1, 3.2-3.4:1, 3.4-3.6:1, 3.6:-3.8:1, 3.8-4.0:1. At this ratio, the extracellular polysaccharides in the supernatant can be efficiently precipitated.
[0050] The precipitate can be collected by centrifugation, filtration, vacuum filtration, sedimentation, decantation, use of a pipette, ultrafiltration, freeze drying, electrophoresis, chromatography, evaporation to dryness, back extraction, etc. In a specific embodiment of the present application, in step 2), the method for collecting the precipitate is centrifugation.
[0051] In a specific embodiment of the present application, in step 3), dissolving the precipitate is dissolving the precipitate in water.
[0052] In a specific embodiment of the present application, in step 3), the precipitate is dissolved and mixed with trichloroacetic acid to remove excess protein. The final concentration of trichloroacetic acid in the mixed system can be 6% to 9% by mass, for example, 6% to 7%, 7% to 8%, or 8% to 9%. The mixed system refers to a mixture of a solution obtained by dissolving the precipitate in water and trichloroacetic acid. The final concentration refers to the final concentration of a specific solute or component in a solution or mixture. In the present application, it refers to the final concentration of trichloroacetic acid in the mixture after the trichloroacetic acid and the solution obtained by dissolving the precipitate in water are mixed. At this concentration, the removal of excess protein in the precipitate is facilitated.
[0053] In a specific embodiment of the present application, in step 3), after collecting the supernatant, dialysis may also be included to remove small molecule impurities in the EPS sample, such as salts, monosaccharides, unreacted monomers, buffers, etc., which helps to improve the purity of the EPS. The dialysis is performed by placing the supernatant into a dialysis bag with a molecular weight cutoff of 14,000 Daltons and dialyzing it for 72 hours, changing the water every 8 hours. Finally, the dialyzed solution is freeze-dried to obtain exopolysaccharides.
[0054] In certain embodiments of the present invention, the intestinal barrier damage repair product is a product for treating intestinal diseases, or the intestinal barrier damage prevention product is a product for preventing intestinal diseases. The intestinal barrier damage repair product has any one or more of the following effects:
[0055] 1) Increase the electrical resistivity of damaged cells in the intestinal barrier;
[0056] 2) reduce the permeability of damaged cells in the intestinal barrier;
[0057] 3) Increase the expression of key genes of intestinal barrier.
[0058] “Increase” refers to the intestinal barrier damaged cells relative to those not using the intestinal barrier damage repair product.
[0059] The key intestinal barrier genes are selected from Zo-1 and / or Muc2.
[0060] The intestinal barrier damage repair product is a medicine or a dietary supplement.
[0061] The dietary supplement can be used in dairy products, including fermented dairy products or non-fermented dairy products, such as yogurt.
[0062] The intestinal barrier damage repair product can be suitable for daily intake by healthy, sub-healthy or diseased people. The dosage of the intestinal barrier damage repair product is not specifically limited and can be adjusted according to actual needs.
[0063] The intestinal barrier damage repair product can reduce intestinal barrier damage or increased permeability caused by LPS, reduce the severity of the disease, and has excellent applicability for the prevention or treatment of intestinal barrier damage and related diseases caused by LPS or pathogenic bacteria containing LPS or other pathogenic bacteria.
[0064] The following describes the embodiments of the present invention through specific examples. Those skilled in the art will readily understand the other advantages and benefits of the present invention from the disclosure herein. The present invention may also be implemented or applied through various other specific embodiments, and the details in this specification may be modified or altered based on different viewpoints and applications without departing from the spirit of the present invention.
[0065] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are for describing specific specific embodiments rather than for limiting the scope of protection of the present invention; in the present specification and claims, unless otherwise expressly stated herein, the singular forms "a", "an" and "the" include plural forms.
[0066] When the embodiments provide numerical ranges, it should be understood that, unless otherwise specified in the present invention, both endpoints of each numerical range and any numerical value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those generally understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the embodiments, according to the understanding of the prior art by those skilled in the art and the description of the present invention, any methods, equipment, and materials of the prior art similar or equivalent to the methods, equipment, and materials described in the embodiments of the present invention may also be used to implement the present invention.
[0067] Example 1B44 - Extraction of EPS
[0068] The newly activated B44 strain was cultured in MRS liquid medium at a constant temperature of 37°C for 15 hours, and then transferred to 10% (w / w) skim milk medium at a 5% inoculum size. Fermented milk with a pH of 5.6 was obtained by anaerobically fermenting at 37°C for 48 hours. After treatment in a boiling water bath, the supernatant was obtained by centrifugation at 9000 rpm, and polysaccharides were precipitated by adding 3 times the volume of pre-cooled ethanol. After standing overnight, the precipitate was collected by centrifugation, dissolved in water, and deproteinized with 1:7 trichloroacetic acid. The supernatant was obtained by centrifugation again, dialyzed, and freeze-dried to obtain crude polysaccharides.
[0069] The crude polysaccharide was loaded at a concentration of 10 mg / mL and separated by DEAE-Sepharose Fast Flow anion exchange chromatography (mobile phase 0.05M Tris-HCl, 1M NaCl gradient elution, flow rate 1mL / min, injection 2mL, column temperature 28°C), and freeze-dried to obtain the salt-containing refined polysaccharide. It was prepared into a 100 mg / mL solution and dialyzed and desalted at 4°C for 5 days using a 14Kda dialysis bag (the water was changed 3 times a day for the first 3 days and once a day for the next 2 days). After freeze-drying, the purity was tested by high-performance gel filtration chromatography, and finally the B44 refined polysaccharide was obtained. (For the specific polysaccharide extraction steps, please refer to the patent application number 202411574018.2)
[0070] Example 2 Determination of resistivity
[0071] B44-EPS was weighed and added to DMEM cell culture medium containing 10% FBS and 1% penicillin-streptomycin at a concentration of 200 μg / mL.
[0072] The human colorectal cancer cells Caco-2 from mice at passages 5 to 8 were cultured at 6×10 4 The cells were inoculated into 12-well cell culture chambers and cultured for 14 days until the resistance reached 650 ± 50 Ω / cm. 2To form a cell monolayer, in the 200 μg / mL B44-EPS+LPS group, 0.5 mL of DMEM complete medium containing B44-EPS and LPS (Ecoli 0111: B4) was added to the cell chamber and incubated for 12 hours, resulting in a final concentration of 200 μg / mL B44-EPS and 1 μg / mL LPS. 1.5 mL of DMEM complete medium without intervention was added to the lower chamber. For the control group, DMEM complete medium was added to both the upper and lower chambers. The positive control (LPS group) was incubated with DMEM complete medium containing 1 μg / mL LPS (Ecoli 0111: B4) at a final concentration of 1 μg / mL. The cells were incubated at 37°C with 5% CO2 for 12 hours. PBS was then replaced in both the upper and lower chambers, and resistance was measured using a resistance meter.
[0073] The results are as follows Figure 1 As shown in the resistivity measurements, LPS alone causes a decrease in electrical resistance, damaging the cells. However, co-incubation of LPS and B44-EPS does not cause a decrease in electrical resistance, with no difference between this group and the control. Therefore, B44-EPS, as a postbiotic, is highly effective in improving the electrical resistance reduction caused by LPS-induced Caco-2 barrier damage, demonstrating the protective properties of B44-EPS on monolayer cells.
[0074] Example 3 Determination of permeability
[0075] B44-EPS was weighed and added to DMEM cell culture medium containing 10% FBS and 1% penicillin-streptomycin at a concentration of 200 μg / mL.
[0076] Human colorectal adenocarcinoma cells Caco-2 at passages 5 to 8 were cultured at 6×10 4 The cells were inoculated into 12-well cell culture chambers and cultured for 14 days until the resistance reached 650 ± 50 Ω·cm. 2After forming a cell monolayer, 0.5 mL of DMEM complete medium containing B44-EPS and LPSDMEM was added to the cell chamber. The final concentration of B44-EPS in the culture system was 200 μg / mL, and the final concentration of LPS in the culture system was 1 μg / mL. 1.5 mL of DMEM complete medium without intervention was added to the lower chamber (200 μg / mL B44-EPS+LPS group). For the blank control, DMEM complete medium was added to both the upper and lower chambers (Control group). For the positive control, 0.5 mL of DMEM complete medium containing LPS (Ecoli 0111: B4) was added to the upper chamber. The final concentration of LPS in the culture system was 1 μg / mL, and 1.5 mL of DMEM complete medium was added to the lower chamber (LPS group). The cells were cultured at 37°C with 5% CO2 for 12 h. Replace the upper chamber with DMEM complete medium containing 0.2 mg / mL FITC-dextran. After 3.5 hours of quiescence, aspirate 100 μL of the lower chamber culture medium into a black 96-well plate for FITC-dextran content measurement (Ex = 485 nm, Em = 538 nm). Calculate the FITC-dextran concentration in the lower chamber culture medium based on the FITC-dextran standard curve to assess permeability. The FITC-dextran standard curve was prepared as follows: FITC-dextran was serially diluted with DMEM (concentrations were 500, 250, 125, 62.5, 31.25, 15.625, 7.8, 3.9, 1.95, and 0 μg / mL), 100 μL of the diluted standard curve was pipetted into a black 96-well plate, and the fluorescence value was measured using a fluorescence microplate reader under the conditions of Ex = 485 nm and Em = 538 nm. The standard curve was drawn based on the measured fluorescence values, and the fitting equation was y = 52.48x + 74.95, r 2 = 0.995. The concentration of FITC-dextran infiltrated into the lower chamber was calculated based on the standard curve values.
[0077] The results are as follows Figure 2 As shown in the figure, the results of FITC-dextran permeability assay clearly show that B44-EPS as a postbiotic can effectively reduce the increased permeability caused by LPS damage to the cell monolayer barrier.
[0078] Example 4 RT-qPCR determination
[0079] B44-EPS was weighed and added to DMEM cell culture medium containing 10% FBS and 1% penicillin-streptomycin at a concentration of 200 μg / mL.
[0080] 2×10 5RAW264.7 cells were seeded per well in a 12-well plate and cultured at 37°C with 5% CO2 for 24 hours. The cells were then washed twice with PBS. The control group was inoculated with 2 mL of complete DMEM medium without B44-EPS. The positive control group was inoculated with LPS at a final concentration of 1 μg / mL. The co-incubation group (200 μg / mL B44-EPS + LPS group) was inoculated with B44-EPS at a final concentration of 200 μg / mL and LPS at a final concentration of 1 μg / mL per well and incubated at 37°C with 5% CO2 for 12 hours. The cultured cells were washed twice with PBS, and the cells were collected to extract total RNA. After reverse transcription into cDNA, it was used as a template and amplified and measured by qPCR using primers for immune-related genes Zo-1 and Muc2. The primer sequences are as follows:
[0081] GAPDH:
[0082] Forward primer (5'-3'): CACTCACGGCAAATTCAACGGCAC
[0083] Reverse primer (5'-3') GACTCCACGACATACTCAGCAC
[0084] Zo-1:
[0085] Forward primer (5'-3'): GAATGATGGTTGGTATGGTGCG
[0086] Reverse primer (5'-3')TCAGAAGTGTGTCTACTGTCCG
[0087] Muc2:
[0088] Forward primer (5'-3'): CAGCACCGATTGCTGAGTTG
[0089] Reverse primer (5'~3') GCTGGTCATCTCAATGGCAG
[0090] The total system was 20 μL, including 10 μL of 2×SYBR qPCR Mix, 0.4 μL of upstream and downstream primers (10 μM each), 1 μL of template (50-60 ng / μL), and 8.2 μL of ddH2O. GADPH was used as the internal reference, and 2 -△△Ct The relative mRNA expression was calculated by the method.
[0091] The results are as follows Figure 3 and Figure 4 As shown in the results of gene transcription analysis, B44-EPS can effectively improve the expression of key intestinal barrier genes ZO-1 and Muc-2, which are reduced by LPS. In summary, B44-EPS has a very good effect in treating LPS-induced intestinal barrier damage.
[0092] The above examples are intended to illustrate the embodiments disclosed herein and are not to be construed as limiting the present invention. In addition, the various modifications listed herein and variations of the methods in the invention will be apparent to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been specifically described in conjunction with various specific preferred embodiments of the present invention, it should be understood that the present invention should not be limited to these specific embodiments. In fact, various modifications apparent to those skilled in the art as described above to obtain the invention should be included within the scope of the present invention.
Claims
1. Use of postbiotics from fermented Lactobacillus mucilaginosus in the preparation of intestinal barrier damage repair products or intestinal barrier damage prevention products.
2. The use according to claim 1, characterized in that The fermentative mucus lactobacillus is Limosilactobacillusfermentum B44, and its preservation number is CGMCC No.17321.
3. The use according to claim 1, characterized in that The postbiotics are exocellular polysaccharides.
4. The use according to claim 3, characterized in that The exopolysaccharide is a substance prepared by the following method: 1) obtaining a fermentation supernatant from milk fermented by Limosilactobacillus fermentum B44; 2) precipitating the fermentation supernatant and collecting the precipitate; 3) Dissolve the precipitate and remove excess protein, collect the supernatant, and obtain extracellular polysaccharide.
5. The use according to claim 1, characterized in that The intestinal barrier damage repair product is an intestinal disease treatment product, or the intestinal barrier damage prevention product is an intestinal disease prevention product.
6. The use according to claim 1, characterized in that The intestinal barrier damage repair product has any one or more of the following effects: 1) Increase the electrical resistivity of damaged cells in the intestinal barrier; 2) reduce the permeability of damaged cells in the intestinal barrier; 3) Increase the expression of key genes of intestinal barrier.
7. The use according to claim 1, characterized in that The key intestinal barrier genes are selected from Zo-1 and / or Muc2.
8. The use according to claim 1, characterized in that The intestinal barrier damage repair product is a medicine, food or health product.
9. The use according to claim 1, characterized in that The food is selected from fermented dairy products or non-fermented dairy products. Preferably, the food is a solid beverage or pasteurized milk.
10. The use according to claim 1, characterized in that The intestinal barrier damage repair product is used to treat or prevent intestinal barrier damage caused by LPS or pathogenic bacteria.