Hydrogel containing barnacle mucin as well as preparation method and application thereof

Abstract

The invention discloses hydrogel containing barnacle mucin as well as a preparation method and application of the hydrogel. The hydrogel is prepared from sericin of recombinant expression barnacle mucin fragments. The nucleic acid sequence of the barnacle mucin fragment is as shown in SEQ ID NO. 1; the hydrogel has the function of promoting cell adhesion, and can effectively stop bleeding and promote wound healing. Therefore, the wound dressing can be used as a novel wound dressing to promote skin regeneration and repair.

Description

Technical Field

[0001] The present invention relates to the field of biomaterials, in particular to a hydrogel containing barnacle mucin, and also to a preparation method and application of the hydrogel material. Background Art

[0002] As a semicrystalline natural polymer, silk has long been a research hotspot in materials science. Regenerated silk fibroin aqueous solutions, after silk degumming, can be processed using various techniques to produce a range of regenerated silk fibroin-based materials, including films, nanospheres, hydrogels, synthetic fibers, and sponge-like scaffolds. In recent years, silk fibroin hydrogels with diverse functionalities have been developed, offering promising biomedical applications. These hydrogels possess excellent adhesion, hydrophilicity, biocompatibility, and biodegradability, demonstrating remarkable hemostatic and tissue repair properties, making them suitable as a novel bioadhesive.

[0003] The key to the application of hydrogels in wound repair lies in their stable adhesion properties, specifically: (1) strong adhesive strength to achieve rapid hemostasis; (2) excellent and stable underwater adhesion; and (3) no inflammatory response. However, most hydrogels currently have insufficient wet adhesion, which limits their application and still needs to be improved. Therefore, the development of new hydrogels with safe and stable adhesion properties is a research focus in this field.

[0004] Barnacles are marine organisms that secrete barnacle glue, which maintains excellent adhesion in humid environments. This characteristic makes them a hot topic of research in the fields of biomedicine and biomimetic materials. Several barnacle mucins have been identified, among which CP20K contains a high concentration of cysteine ​​(Cys). Cys residues can be oxidized to form intramolecular disulfide bonds, which in turn cross-link to form a rich β-sheet structure. This structure provides the basis for the protein's interfacial adaptability, and the resulting cross-linked network is stable and persists in marine environments.

[0005] The silkworm silk gland bioreactor exploits the tissue-specificity of the silkworm's silk gland to express exogenous genes. Compared to prokaryotic expression systems such as Escherichia coli and yeast, it offers low-cost expression and convenient purification of exogenous proteins. This study, using transgenic silkworm technology, successfully expressed the barnacle mucin CP20K in the silkworm's posterior silk gland and secreted it into the cocoon. Summary of the Invention

[0006] In view of this, one of the objects of the present invention is to provide a hydrogel containing barnacle mucin; a second object of the present invention is to provide a method for preparing the hydrogel containing barnacle mucin; a third object of the present invention is to provide the use of the hydrogel containing barnacle mucin in the preparation of materials that promote wound healing; a fourth object of the present invention is to provide the use of the hydrogel containing barnacle mucin in the preparation of hemostatic materials; and a fifth object of the present invention is to provide the use of the hydrogel containing barnacle mucin in the preparation of materials that promote cell adhesion.

[0007] In order to achieve the above object, the present invention provides the following technical solutions: 1. A hydrogel containing barnacle mucin, wherein the hydrogel is prepared from sericin recombinantly expressed barnacle mucin fragment; the nucleic acid sequence of the barnacle mucin fragment is shown in SEQ ID NO.1.

[0008] 2. The preparation method of the hydrogel containing barnacle mucin comprises the following steps: degumming silk cocoons by boiling with NaHCO3 solution, collecting the degummed silk and drying it, then dissolving the degummed silk with LiBr, collecting the supernatant by centrifugation and dialyzing it in water, and allowing it to stand after dialysis to form a hydrogel.

[0009] Preferably, the degumming is performed by boiling the cocoons in a 0.5% NaHCO3 solution for 30 min at a mass ratio of silk to solution of 1:200.

[0010] Preferably, the LiBr dissolution is performed by using a 9.3 M LiBr solution at 60° C. for 2 h to dissolve the degummed silk.

[0011] Preferably, the supernatant is collected by centrifugation at 8000 rpm for 10 min.

[0012] 3. Use of the hydrogel containing barnacle mucin in the preparation of materials for promoting wound healing.

[0013] 4. Use of the hydrogel containing barnacle mucin in the preparation of hemostatic materials.

[0014] 5. Application of the hydrogel containing barnacle mucin in the preparation of materials with cell adhesion promoting function.

[0015] The present invention provides a hydrogel containing barnacle mucin that promotes cell adhesion, effectively stops bleeding, and promotes wound healing. Therefore, it can be used as a new wound dressing to promote skin regeneration and repair. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to make the purpose, technical solutions and beneficial effects of the present invention more clear, the present invention provides the following drawings for illustration: Figure 1 For the screening of positive individuals of transgenic silkworms.

[0017] Figure 2 Western blot detection of CP20K.

[0018] Figure 3 It is SF-CP20K hydrogel.

[0019] Figure 4 This is the cell adhesion promoting effect of SF-CP20K hydrogel.

[0020] Figure 5 This is the hemostatic effect of SF-CP20K hydrogel.

[0021] Figure 6 Wound healing status of mice.

[0022] Figure 7 For histological observation of mouse skin. DETAILED DESCRIPTION

[0023] The present invention will be further described below with reference to the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it. However, the embodiments are not intended to limit the present invention.

[0024] Example 1 To select a barnacle mucin fragment, we obtained the CP20K protein sequence from NCBI. The full-length protein contains 202 amino acids, of which amino acids 1-19 are a signal peptide, which we replaced with the Bombyx mori signal peptide. BamH I and Not I restriction sites were added to both ends of the sequence, respectively, and the sequence was optimized based on Bombyx mori codon preference. The designed sequence is shown in SEQ ID NO. 1.

[0025] GGATCCATGAGAGTGAAAACGTTCGTGATTTTGTGCTGCGCCCTGCAATACGTGGCTTACACAAACGCCCACGAAGAAGATGGTGTTTGCAACAGCAACGTCGTGCTACCACTGCGACGCTAACGGAGAGAACTGCTCATGTAACTGCGAACTGTTCGACTG CGAAGCTAAGAAGCCAGACGGTTCATACGCTCACCCTTGTAGGAGATGCGACGCTAATAACATCTGCAAATGCAGTTGCACAGCTATCCCTTGCAACGAGGACCATCCTTGTCACCACTGCCACGAAGAAGATGATGGTGACACACACTGCCACTGCTCATGCGA ACACTCACACGACCACCACGACGACGACACACACGGAGAATGCACAAAGAAGGCTCCATGCTGGAGATGCGAATACAACGCTGACTTAAAACACGACGTCTGCGGTTGCGAATGCTCAAAACTCCCATGCAACGACGAACAACCCTTGCTACAGAAAAGAGGGAGG AGTGGTGTCATGCGACTGCAAAACAATCACATGTAACGAGGACCATCCTTGCTACCACTCATACGAAGAAGATGGTGTTACTAAATCAGACTGCGACTGTGAACACTCACCTGGTCCTTCTGAAGAACAAAAACTGATCTCAGAAGAAGACCTGTAAGCGGCCGC Example 2 The specific steps for obtaining transgenic silkworm strains are as follows: the synthesized sequence is connected to the HFRS by enzyme digestion and enzyme ligation. EXP The Fib H promoter was connected to Ser A in the vector, and DsRed was replaced by Mrcp20k. The resulting vector was abbreviated as pBac[Fib HP-Mrcp20k-Ser A-dsRed], in which HFRS EXPFor more information about the vector, see Feng Wang, 2025, An Efficient Biosynthetic System for Developing Functional Silk Fibroin-Based Biomaterials, Advanced Materials. After extracting the ultrapure plasmid, the transgenic silkworm eggs were microinjected into D9L silkworm eggs, and positive individuals were screened by fluorescence. Silk protein from the transgenic silkworms was extracted, and successful expression of CP20K was detected by Western blot.

[0026] Example 3 The specific steps for screening positive individuals are as follows: the extracted piggyBac overexpression plasmid and the auxiliary vector plasmid pHA3PIG (plasmid concentrations must be greater than 500 ng / µL) are mixed in a molar ratio of 1:1; freshly laid silkworm eggs (within 2 hours) are fixed on a glass slide; the mixed plasmids are injected into the silkworm eggs using an insect embryo microinjector, and the injection hole is sealed with a small amount of non-toxic glue; after the injected silkworm eggs (G0 generation) are accelerated to hatch, they are reared on fresh mulberry leaves until they are placed on the cocoon; G0 generation moths are mated with ordinary moths to lay eggs, obtaining G1 generation silkworm eggs; on the 6th-7th day, the G1 generation silkworm eggs are placed under a fluorescence microscope for screening, and those with red fluorescence in the eyes are positive individuals. Positive silkworm eggs are reared together on the cocoon, and their moths also maintain this characteristic. The screening results are as follows Figure 1 shown.

[0027] Example 4 The expression and identification of exogenous proteins were carried out as follows: a small amount of silk cocoons were fully chopped and then added to 9 M LiBr solution to be soaked in the solution; after the silk was fully dissolved, the solution was centrifuged at 12000 g for 10 min at 4 °C, and the supernatant was aspirated for Western Blot experiment. The WT silk cocoon solution was used as a control and Myc antibody was used for incubation. The results are shown in Figure 2. Figure 2 The results showed that CP20K had obvious specific bands, while WT had no bands, indicating that the recombinant CP20K protein was successfully expressed and secreted.

[0028] Example 5 The preparation of SF-CP20K hydrogel is as follows: degumming of dried silkworm cocoons was performed by boiling them in a 0.5% NaHCO3 solution for 30 minutes (bath ratio 1:200), and this was repeated once; the degummed silk was rinsed and squeezed dry, and then dried in an oven; the degummed silk was dissolved in a 9.3 M LiBr solution and dried in a 60°C oven for 2 hours; the dissolved solution was transferred to a centrifuge and centrifuged at 8000 rpm for 10 minutes; the supernatant was dialyzed in ddH2O, with the ddH2O frequently replaced; after dialysis, the hydrogel was left to form naturally. The prepared hydrogel was relatively uniform in color and colorless and transparent, as shown in Figure 2. Figure 3 As shown, after the tube was inverted, the hydrogel was at the bottom.

[0029] Example 6 The cell adhesion promoting effect of SF-CP20K hydrogel was investigated as follows: the hydrogel prepared above was freeze-dried, re-dissolved in 1640 culture medium (dissolved at a concentration of 10 mg / mL), and filtered through a 0.22 μm filter membrane. HaCat cells were cultured in the hydrogel culture medium, and the cell status was observed for 1 h, 2 h, and 4 h, respectively. The cell adhesion rate was detected and analyzed using a fluorescent staining working solution. The results are shown in Figure 2. Figure 4 As shown in the figure, the adhesion rate of the SF-CP20K group was significantly higher than that of the WT group, indicating that the SF-CP20K hydrogel exhibited better cell adhesion promoting ability.

[0030] Example 7 The hemostatic effect of SF-CP20K hydrogel was investigated as follows: After anesthetizing mice, the tails were cut 1 cm from the tail using surgical scissors. Filter paper was placed on the bottom of the mice and treated with 20 μL of hydrogel. A blank group was set up without treatment. The filter paper was weighed before and after blood absorption, and the amount of bleeding was calculated. The results showed that SF-CP20K hydrogel significantly reduced the amount of bleeding and had a more pronounced hemostatic effect. Figure 5 shown.

[0031] Example 8 SF-CP20K hydrogel promoted wound healing in mice. The specific steps were as follows: On day 0, a wound approximately 1 cm long was created on the back of mice. The mice were divided into three groups, each with three mice. The blank group received no treatment. The SF and SF-CP20K groups received the same amount of hydrogel applied to the wound daily starting on day 1. Wound healing was observed by photographing on days 4, 8, and 13. Skin tissue from the wounds was removed for histological observation and analysis.

[0032] like Figure 6As shown, compared with the other two groups, the wound area of ​​the SF-CP20K group gradually decreased, and the wound was almost closed on the 8th day, indicating that SF-CP20K hydrogel can accelerate the healing speed of mouse wounds. HE staining results showed that the thickness of the epidermal regeneration tissue in the SF-CP20K group was greater than that in the other groups; on the 8th day, the fibroblasts in the SF-CP20K group proliferated and migrated significantly; on the 13th day, the SF-CP20K group developed a large number of hair follicles and sweat gland ducts ( Figure 7 , A). Masson staining results showed that the content of new collagen in the wound of the SF-CP20K group was significantly higher than that of the other two groups, and the arrangement was more compact and orderly ( Figure 7 , B). The above results indicate that SF-CP20K hydrogel exhibits the property of accelerating wound healing.

[0033] The above embodiments are merely preferred embodiments for the purpose of fully illustrating the present invention, and the scope of protection of the present invention is not limited thereto. Equivalent substitutions or modifications made by those skilled in the art based on the present invention are within the scope of protection of the present invention. The scope of protection of the present invention shall be subject to the claims.

Claims

1. A hydrogel containing barnacle mucin, characterized in that: The hydrogel is prepared from sericin recombinantly expressed barnacle mucin fragment; the nucleic acid sequence of the barnacle mucin fragment is shown in SEQ ID NO.

1.

2. The method for preparing the hydrogel containing barnacle mucin according to claim 1, characterized in that: The method comprises the following steps: boiling silk cocoons with a NaHCO3 solution to degumming, collecting the degummed silk and drying it, then dissolving the degummed silk with LiBr, collecting the supernatant by centrifugation and dialyzing it in water, and allowing it to stand after dialysis to form a hydrogel.

3. The method for preparing the hydrogel containing barnacle mucin according to claim 2, characterized in that: The degumming step is to boil the cocoons in a 0.5% NaHCO3 solution for 30 min at a mass ratio of silk to solution of 1:

200.

4. The method for preparing the hydrogel containing barnacle mucin according to claim 2, characterized in that: The LiBr dissolution is performed by using a 9.3 M LiBr solution at 60° C. for 2 h to dissolve the degummed silk.

5. The method for preparing the hydrogel containing barnacle mucin according to claim 2, characterized in that: The supernatant was collected by centrifugation at 8000 rpm for 10 min.

6. Use of the hydrogel containing barnacle mucin according to claim 1 in preparing a material for promoting wound healing.

7. Use of the hydrogel containing barnacle mucin according to claim 1 in the preparation of hemostatic materials.

8. Use of the hydrogel containing barnacle mucin according to claim 1 in preparing materials with cell adhesion promoting function.

Images