AAV capsid protein variant, recombinant adeno-associated virus particle and application thereof

Abstract

The invention belongs to the technical field of genetic engineering and viral vectors, and particularly relates to a recombinant adeno-associated virus (AAV) vector capable of specifically infecting mouse sertoli cells, and the virus is characterized in that a polypeptide sequence DGCRPPR is inserted into the 590th amino acid site of AAV8. Compared with a wild-type AAV8 vector, the mutant has higher specificity to the sertoli cells, and after seminiferous tubules are injected, the infection ability to the sertoli cells in the testis is higher, and the specificity is better.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering technology, and specifically relates to AAV capsid protein variants, recombinant adeno-associated virus particles and applications thereof. Background Art

[0002] Sertoli cells (Sertoli cells) are core cells that maintain male reproductive function and participate in the construction and regulation of the testicular blood-testis barrier (BTB). The BTB, formed by tight junctions between Sertoli cells and the testis, not only isolates the spermatogenic microenvironment within the seminiferous tubules, protecting germ cells from immune attack and toxic damage, but also limits immune cell infiltration, preventing autoimmune attacks on sperm. Furthermore, Sertoli cells secrete various nutrients (such as lactate), regulate hormonal signals (such as FSH), and clear apoptotic germ cell remnants, playing a crucial role in supporting and regulating spermatogenesis. However, abnormal Sertoli cell function can lead to male infertility, impaired spermatogenesis, and testicular-related diseases (such as fibrosis). Therefore, the development of gene regulation tools targeting Sertoli cells is crucial for understanding their functional mechanisms and treating related diseases.

[0003] Adeno-associated virus (AAV) is a microscopic virus found in humans and other mammals. It consists of an icosahedral capsid approximately 26 nm in diameter and a 4.7 kb single-stranded DNA genome. Recombinant adeno-associated virus (rAAV), derived from the nonpathogenic wild-type AAV, is considered one of the most promising gene transfer vectors due to its safety profile, infectivity in both dividing and non-dividing cells, low immunogenicity, and prolonged expression of foreign genes in vivo. Over the years, the discovery of diverse AAV serotypes and variants has greatly advanced the research of AAV vectors, providing a wide range of options for targeting diverse tissues and cells. The AAV capsid protein determines AAV's infectious specificity. Therefore, since AAV demonstrated promising clinical applications, the design of novel AAV capsids to achieve novel AAVs with varying tissue or cell specificity has been a persistent goal for researchers. However, despite the widespread use of AAV vectors in gene therapy, no AAV vector currently possesses the ability to specifically and efficiently infect Sertoli cells. Although traditional AAV serotypes (such as AAV8 and AAV9) can infect testicular tissue, they mainly target interstitial cells rather than supporting cells.

[0004] Therefore, there is an urgent need in this field to develop an AAV capsid protein variant and a new AAV vector that can efficiently and specifically infect testicular Sertoli cells. Summary of the Invention

[0005] To address these technical issues, the present invention provides AAV capsid protein variants, recombinant adeno-associated virus particles, and their applications. By combining capsid engineering with promoter-specific design, these vectors achieve efficient and specific infection of mouse Sertoli cells. These vectors have important applications in gene therapy, modeling male reproductive system diseases, and targeted tumor therapy.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions: In a first aspect of the present invention, an AAV capsid protein variant is provided, wherein the amino acid sequence of the AAV capsid protein variant is shown in SEQ ID NO: 1.

[0007] Furthermore, the AAV capsid protein variant is obtained by inserting the polypeptide sequence shown in SEQ ID NO: 2 after the 590th amino acid of the VP1 variable region VIII of the wild-type AAV capsid protein.

[0008] In the second aspect of the present invention, an AAV8 viral vector is provided, wherein the AAV capsid protein of the AAV8 viral vector is the AAV capsid protein variant.

[0009] In a third aspect of the present invention, a method for preparing the AAV virus 8 vector is provided, the method comprising: Using the AAV8-cap plasmid as a template, PCR was performed with the primer pair shown in SEQ ID NO: 4-SEQ ID NO: 5 to obtain a PCR product, which was then digested with DpnI and treated with Exnase II for a recombination reaction. After transformation, an AAV8 viral vector with an inserted specific sequence was obtained.

[0010] In a fourth aspect of the present invention, a recombinant adeno-associated virus particle is provided, comprising the AAV capsid protein variant and the nucleic acid in the AAV capsid.

[0011] In a fifth aspect of the present invention, a method for preparing the recombinant adeno-associated virus particles is provided, the method comprising: The AAV8 viral vector is co-transfected with AAV8-CMV-EGFP and Phelper into cells and then packaged and purified to obtain the vector.

[0012] In the sixth aspect of the present invention, a host cell containing the recombinant adeno-associated virus particles is provided.

[0013] In another preferred embodiment, the host cell is a eukaryotic cell or a prokaryotic cell.

[0014] In another preferred embodiment, the host cell is a plant cell, an insect cell, or an animal cell, preferably a mammalian cell.

[0015] In another preferred embodiment, the host cell is HEK-293T cell.

[0016] In the seventh aspect of the present invention, a pharmaceutical composition is provided, comprising the AAV viral vector and a pharmaceutically acceptable carrier.

[0017] In the eighth aspect of the present invention, provided is the use of the AAV8 viral vector, the viral particle, the host cell, or the pharmaceutical composition in the preparation of a drug for treating diseases related to testicular Sertoli cell dysfunction.

[0018] Furthermore, the disease includes one of non-obstructive azoospermia, spermatogenic dysfunction or testicular fibrosis.

[0019] The beneficial effects of the above technical solution of the present invention are as follows: The present invention provides AAV capsid protein variants, recombinant adeno-associated virus particles, and their applications. The rAAV vector is based on the AAV8 serotype, with its capsid protein modified by inserting the DGCRPPR polypeptide sequence (SEQ ID NO: 2) after amino acid position 590 of the VP1 variable region VIII, forming a variant capsid protein (SEQ ID NO: 1). Animal experiments have shown that, after injection into seminiferous tubules, the modified rAAV vector has a 3-5-fold higher infection efficiency in Sertoli cells than wild-type AAV8, with a specificity exceeding 90%. This vector can be used for Sertoli cell-related gene therapy, establishing male infertility models, and delivering drugs to the reproductive system. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the following non-limiting embodiments are described in detail using the accompanying drawings to make their features, purposes and advantages more apparent: Figure 1 The frozen sections of the mouse testes were stained 7 days after the EGFP gene was delivered to the seminiferous tubules using a new AAV vector (containing a capsid protein variant). The blue light indicates DAPI and the green light indicates EGFP.

[0021] Figure 2 The image shows frozen sections of mouse testes stained 7 days after the EGFP gene was delivered to the seminiferous tubules by WT AAV vector (containing AAV8 wild-type capsid protein). The blue light indicates DAPI and the green light indicates EGFP.

[0022] Figure 3 Frozen sections of mouse testes were stained 7 days after the EGFP gene was delivered to the seminiferous tubules using a novel AAV vector (containing a capsid protein variant). The blue light represents DAPI, the green light represents EGFP, and the red light represents SOX9 / TRA98. DETAILED DESCRIPTION

[0023] The present invention is described in detail below with reference to the accompanying drawings. The present invention and its embodiments are described below. This description is not restrictive, and the actual embodiments are not limited thereto. If a person of ordinary skill in the art is inspired by it and, without departing from the purpose of the invention, designs a structural mode and an embodiment similar to the technical solution without creativity, they should all fall within the scope of protection of the present invention. The specific experimental conditions and methods not specified in the following examples are generally in accordance with conventional conditions such as: J. Sambrook et al., eds., Science Press, 1992, Molecular Cloning Experiment Guide (3rd Edition); DL Spector et al., Science Press, 2001, Cell Experiment Guide, etc., or in accordance with the conditions recommended by the manufacturer.

[0024] Example 1. Acquisition of AAV capsid protein variants and AAV8 viral vectors with specific sequence insertion A specific sequence (amino acid sequence SEQ ID NO: 2) was inserted after position 590 of the AAV8 wild-type capsid protein VP1 amino acid sequence SEQ ID NO: 3. 1. Design a pair of primers containing a specific insertion sequence. The forward primer sequence is SEQ ID NO: 4 (GACGGTTGTCGGCCTCCCCGTACGGCTCCTCAAATTGGAAC), and the rear primer sequence is SEQ ID NO: 5 (ACGGGGAGGCCGACAACCGTCGTTTTGCTGCTGCAAGTTAT).

[0025] 2. Use the Mut Express II Fast Mutagenesis Kit V2 to insert the fragment at a specific position. The reaction system and reaction conditions are as follows: Table 1

[0026] Mix the above components using a pipette and perform the following reaction on a PCR thermal cycler: denaturation at 95°C for 30 seconds, followed by 30 cycles of 95°C for 15 seconds, 60°C for 15 seconds, and 72°C for 200 seconds. 72°C for 5 minutes; 3. Add 1 μL of DpnI enzyme to the PCR product to digest the original PCR template with methylation sites, and place it at 37°C for 2 hours; 4. Carry out the recombination reaction. The reaction system and reaction conditions are as follows: Table 2

[0027] The above components were mixed using a pipette and the following reactions were performed on a PCR thermal cycler: 37°C for 30 min; 5. Take 5 μL of the recombination reaction product for transformation, pick the colonies and shake them to obtain the AAV8 viral vector with the specific sequence inserted. The obtained DNA sequence is SEQ ID NO: 6.

[0028] Example 2: AAV8-CMV-EGFP virus packaging HEK293T cells were triple-transfected with PEI at a cell density of 70%-80% with AA8-cap variants, AAV8-CMV-EGFP (Addgene #193022), and Phelper (Addgene #230933). The medium was changed after 12 hours, and the cells and culture medium were collected two days later for purification.

[0029] When cell confluency reaches 70-80%, transfect the plasmids per 10 cm dish. Add 12 µg of DNA mixture (pAAV-CMV-EGFP: pAAV2 / 8-RC: pHelper at a 1:1:1 molar ratio) to each dish. Add 1 mL of pre-warmed serum-free DMEM to each dish. Then, add 36 µL of PEI (PEI:DNA mass ratio 3:1) and vortex for 1 minute. Incubate at room temperature for 15 minutes, then add the mixture dropwise to each dish. 12 hours after transfection, wash the cells once with PBS and incubate with 10 mL of complete DMEM. 2. Harvest cells 72 hours after transfection. Using a serological pipette, remove approximately 20 mL of culture medium from the culture dish and place it in a 50 mL centrifuge tube. 3-5 mL of culture medium should remain in the culture dish along with the cells. Use a cell scraper to scrape the transfected HEK293T cells from each 15 cm plate, collect the cell suspension, and transfer it to a 50 mL centrifuge tube. Spin the culture medium and cell suspension at 3900 rpm for 15 minutes at 4°C to pellet the cells.

[0030] 3. Process the supernatant as follows: Filter through a 0.22 µm PES membrane; concentrate the virus in the supernatant using a Centricon Plus-70 (100 kDa) at 3900 rpm at 4°C. Transfer the concentrated virus to a new centrifuge tube.

[0031] 4. Process the cell pellets as follows: Resuspend each cell pellet in AAV lysis buffer (add 500 µL AAV lysis buffer per plate) and combine into a 50 mL centrifuge tube. Lyse the cells by four freeze-thaw cycles (-80°C / 37°C), then return the cells to 37°C to obtain a crude viral extract.

[0032] Example 3: Purification of AAV8-CMV-EGFP Virus Crude Extract 1. Prepare iodixanol solutions of different concentrations, including 15% iodixanol solution; 25% iodixanol solution; 40% iodixanol solution; and 60% iodixanol solution. 2. Add the crude AAV8-CMV-EGFP virus extract to a 10 ml ultracentrifuge tube and add 0.001% PF68; 3. Layer the tubes in the following order: 3 mL of 15% iodixanol solution; 2 mL of 25% iodixanol solution; 2 mL of 40% iodixanol solution; 1 mL of 60% iodixanol solution, then add 1X PBS-MK to the top of the tube. 4. Ultracentrifugation at 60,000 rpm at 18°C ​​for 2 h; 5. Carefully remove the ultracentrifuge tube and carefully aspirate the colorless 40% iodixanol layer with a syringe. Collect the mixture into a clean EP tube or a 15 mL centrifuge tube to obtain the purified AAV8-CMV-EGFP virus. The presence of a fluorescent signal after injection in subsequent examples confirms that the virus has been successfully prepared. Example 4: AAV8-CMV-EGFP virus injection into mice 6-week-old WT C57 mice were injected into the seminiferous tubules, and the infection status was detected 2 months later.

[0033] 1. Seminiferous tubule injection method Prepare high-pressure surgical instruments in advance; anesthetize the mouse with an intraperitoneal injection of 50-100 μL of 2% sodium pentobarbital solution (the volume of anesthetic can be adjusted according to the size of the mouse); place the anesthetized mouse on the operating table and disinfect the abdomen with alcohol; cut the fur layer approximately 1 cm above the genitals, then cut the muscle layer, and then use clean forceps to pinch the fat tissue to expose the testicles; draw about 15 μL of virus into the pre-drawn injection needle, install the injection needle, and insert the needle into the seminiferous tubule at the junction of the testicle and the epididymal head. Press the injection button of the injection pump to inject the virus, and the total amount of virus injected reaches 1×10 11 molecules; EGFP virus was injected into one testicle, and PBS was injected into the other testicle as a control; the injection needle was removed, and the position of the mouse testicle and epididymis was adjusted before being placed into the abdominal cavity and then pushed into the scrotum to reposition; the mouse wound was sutured with a suture needle, first the muscle layer and then the skin layer; the mouse was removed, placed on a warm blanket, and returned to the cage after waking up.

[0034] 2. Immunofluorescence detection After 2 M, the mouse testicles were collected and fixed with 4% PFA / PBS (mass / volume) at 4°C for 2 hours, and then dehydrated with 30% Sucrose / PBS (mass / volume) at 4°C overnight.

[0035] The dehydrated tissue was embedded in NEG-50 (Thermo Fisher Scientific) at -80°C and then frozen and sectioned.

[0036] 3. Immunofluorescence of frozen sections Blocking: Use a water-blocking pen to draw a circle around the tissue on the slice, completely cover the sample with 10% goat serum / TBS Buffer (volume / volume), place the slice in a humidified box, and incubate at room temperature for 1 hour.

[0037] Primary antibody incubation: Remove the blocking solution and add the primary antibody working solution prepared in 10% goat serum / TBS buffer (volume / volume) directly to the sample. The sample should be completely covered. The section should be placed in a humidified chamber and incubated at room temperature overnight.

[0038] Wash once with TBST buffer for 5 minutes and three times with TBS buffer for 5 minutes each.

[0039] Secondary antibody incubation: Add fluorescent secondary antibody prepared in 10% goat serum / TBS Buffer (volume / volume) to the sample. Working solution: Alexa Fluor 488-conjugated Goat anti-Rabbit IgG (H+L) (Brand: Abclonal, Catalog No.: AS053). The sample must be completely covered, protected from light, and incubated at room temperature for 1 hour.

[0040] Wash once with TBST buffer for 5 minutes; wash three times with TBS buffer for 5 minutes each; Nuclear staining: Add DAPI-containing fluorescence attenuation mounting medium on the sample, then cover with a coverslip and observe and collect images under a fluorescence microscope.

[0041] Depend on Figure 1 It can be seen that the new AAV vector (containing capsid protein variants) successfully delivered the EGFP gene to the seminiferous tubules with high infection efficiency.

[0042] Depend on Figure 2 It can be seen that the wild-type AAV vector successfully delivered the EGFP gene to the seminiferous tubules, but the efficiency was low.

[0043] Depend on Figure 3 It can be seen that the new AAV vector (containing capsid protein variants) for delivering genes to seminiferous tubules only infects Sertoli cells (SOX9 positive) and is specific to Sertoli cells.

[0044] The above is a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. An AAV capsid protein variant, characterized in that The amino acid sequence of the AAV capsid protein variant is shown in SEQ ID NO:

1.

2. The AAV capsid protein variant according to claim 1, characterized in that The AAV capsid protein variant is obtained by inserting the polypeptide sequence shown in SEQ ID NO: 2 after the 590th amino acid of the VP1 variable region VIII of the wild-type AAV capsid protein.

3. An AAV8 viral vector, characterized in that The AAV capsid protein of the AAV8 viral vector is the AAV capsid protein variant described in any one of claims 1-2.

4. A method for preparing the AAV virus 8 vector according to claim 3, characterized in that: The method comprises: Using the AAV8-cap plasmid as a template, PCR was performed with the primer pair shown in SEQ ID NO: 4-SEQ ID NO: 5 to obtain a PCR product, which was then digested with DpnI and treated with Exnase II for a recombination reaction. After transformation, an AAV8 viral vector with an inserted specific sequence was obtained.

5. A recombinant adeno-associated virus particle, characterized in that: The invention comprises the AAV capsid protein variant according to any one of claims 1 to 2 and the nucleic acid in the AAV capsid.

6. A method for preparing the recombinant adeno-associated virus particles according to claim 5, characterized in that: The method comprises: The AAV8 viral vector according to claim 3 is co-transfected into cells with AAV8-CMV-EGFP and Phelper, and then packaged and purified to obtain the vector.

7. A host cell containing the recombinant adeno-associated virus particle according to claim 5.

8. A pharmaceutical composition, characterized in that Comprising the AAV viral vector according to any one of claims 1-2 and a pharmaceutically acceptable carrier.

9. Use of the AAV8 viral vector according to claim 3, the viral particle according to claim 5, the host cell according to claim 7, or the pharmaceutical composition according to claim 8 in the preparation of a medicament for treating diseases related to testicular Sertoli cell dysfunction.

10. The use according to claim 9, characterized in that The disease includes one of non-obstructive azoospermia, spermatogenic dysfunction or testicular fibrosis.

Images