Barley HvNAC92 gene and application thereof in improving salt tolerance of plants

Abstract

The invention discloses a barley HvNAC92 gene and application of the barley HvNAC92 gene in improvement of plant salt tolerance, and belongs to the technical field of plant genetic engineering. The nucleotide sequence of the HvNAC92 gene is as shown in SEQ ID NO. 1. The HvNAC92 gene is knocked out through a CRISPR (clustered regularly interspaced short palindromic repeats) gene editing technology, and the barley mutant with function deletion is successfully obtained. Researches show that the salt tolerance of barley is remarkably enhanced by knocking out the gene, and the growth vigor and biomass of the mutant under the salt stress condition are remarkably superior to those of wild barley. An ion content determination result shows that knockout of the HvNAC92 gene can reduce the transfer of Na ions from a root system to an overground part and increase the absorption of K ions, so that the salt tolerance of plants is improved. Besides, homologous genes of the HvNAC92 gene can be knocked out from crops such as rice, corn, wheat and the like through a gene editing technology, so that the salt tolerance of the plants is improved.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of plant genetic engineering, in particular to a barley HvNAC92 gene and its application in improving plant salt tolerance. BACKGROUND

[0002] Soil salinization is an important abiotic stress for global agricultural yield increase. According to the statistics of the Food and Agriculture Organization of the United Nations (FAO, 2021), about 4.24 million hectares of topsoil (0-30 cm) and 8.33 million hectares of subsoil (30-100 cm) have been affected by different degrees of salinization, accounting for 4.4% and 8.7% of the total cultivated land area, respectively. Unreasonable irrigation, excessive fertilization and industrial pollution and other human activities have further accelerated the process of cultivated land salinization, seriously threatening food security and sustainable agricultural development (Munns and Tester, 2008). Breeding salt-tolerant crop varieties is one of the most economical and effective ways to utilize saline land and improve crop yield.

[0003] Barley (Hordeum vulgare L.) is the fourth largest cereal crop in the world, not only as a food, feed and beer raw material, but also has strong stress resistance, often used as a pioneer crop in poor, drought and saline-alkali areas. With the growth of beer consumption and the development of animal husbandry in China, the demand for barley will continue to increase. However, the soil salinization phenomenon in the barley planting area of China not only affects the planting and production of barley, but also leads to the decline of beer quality. Therefore, it is urgent to breed new varieties of salt-tolerant beer barley.

[0004] Studies have shown that the difference in salt tolerance between different species or different genotypes of the same species is often closely related to the transcription level and expression pattern of salt-tolerant genes (families). Compared with single functional genes, upstream regulatory factors such as transcription factors can simultaneously regulate multiple downstream target genes, thereby coordinating multiple physiological and biochemical processes to cope with salt stress. These genes have become important candidate genes in plant salt-tolerant genetic engineering and have great application potential (Xiao et al., 2023). Analyzing the expression regulation mechanism of salt-tolerant functional genes has become a core content of plant salt-tolerant molecular mechanism research.

[0005] The NAC family is one of the largest transcription factor families specific to plants, and its name is derived from the initials of the three first discovered members, NAM (No Apical Meristem), ATAF1 / 2 and CUC2 (Cup-Shaped Cotyledon). The family proteins contain a highly conserved N-terminal NAC domain (about 150 amino acids) responsible for binding DNA and forming dimers, and a highly variable C-terminal transcriptional regulatory domain determining the diversity of its functions. NAC transcription factors play a core regulatory role in plant growth and development (such as organ formation and senescence) and response to various biological / non-biological stresses (such as drought, salt damage, and disease and insect pests), and are key "molecular switches" connecting stress signals and downstream gene expression.

[0006] At present, the research on barley NAC family genes in salt tolerance regulation is still very scarce. SUMMARY

[0007] The purpose of the present application is to provide a barley HvNAC92 gene and its application in improving plant salt tolerance, in order to solve the problems existing in the prior art.

[0008] To achieve the above purpose, the present application provides the following solutions: One of the technical solutions of the present application is a HvNAC92 gene, the nucleotide sequence of which is shown in SEQ ID NO. 1.

[0009] The second technical solution of the present application is that the HvNAC92 gene encodes a HvNAC92 protein, and the amino acid sequence of the HvNAC92 protein is shown in SEQ ID NO. 2.

[0010] The third technical solution of the present application is the application of the HvNAC92 gene or the HvNAC92 protein in improving plant salt tolerance, and the plant includes barley, rice, corn and wheat.

[0011] The fourth technical solution of the present application is the application of an editing vector containing the HvNAC92 gene in improving plant salt tolerance, and the plant includes barley, rice, corn and wheat.

[0012] The fifth technical solution of the present application is the application of the HvNAC92 gene, HvNAC92 protein or editing vector containing the HvNAC92 gene in breeding salt-tolerant plants, and the plant includes barley, rice, corn and wheat.

[0013] Sixth, the application discloses a method for improving salt tolerance of plants, and the method comprises the following steps: introducing an editing vector of an HvNAC92 gene into the plants, and knocking out the HvNAC92 gene, wherein the nucleotide sequence of the HvNAC92 gene is shown as SEQ ID NO. 1, and the plants include barley, rice, corn and wheat.

[0014] Seventh, the application discloses a breeding method for salt-tolerant plants, and the method comprises the following steps: introducing an editing vector of an HvNAC92 gene into the plants, and knocking out the HvNAC92 gene, wherein the nucleotide sequence of the HvNAC92 gene is shown as SEQ ID NO. 1, and the plants include barley, rice, corn and wheat.

[0015] Based on the above technical scheme, the application has the following technical effects: 1. The application first clones and analyzes a NAC family gene HvNAC92 responding to salt stress in barley, and discloses the nucleotide sequence and the amino acid sequence of the HvNAC92, which is of great significance for elucidating the molecular mechanism of salt tolerance regulation of barley and breeding.

[0016] 2. The application proves that the HvNAC92 gene is involved in regulating the salt tolerance of barley through a transgenic method, wherein knocking out the gene by using a gene editing technology significantly improves the salt tolerance of the barley, and the HvNAC92 is a negative regulation factor.

[0017] 3. In crops such as rice, corn and wheat, knocking out the homologous gene of the HvNAC92 can improve the salt tolerance of the crops. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 It is a schematic diagram of gene cloning and structure of the HvNAC92 gene, wherein (A) is an agarose gel electrophoresis diagram of a CDS (coding sequence) PCR fragment, in the diagram, the first lane M represents a DL2000 DNA marker, and the second lane L1 represents a CDS sequence fragment of the HvNAC92 gene; (B) is a schematic diagram of the gene structure of the HvNAC92.

[0019] Figure 2 It is an expression amount of the HvNAC92 gene in a root and an above-ground part of a barley plant under normal (0 mM NaCl) and salt stress treatment (150 mM and 300 mM NaCl) conditions; in the diagram, the gene expression amount is expressed by an FPKM value, and different lowercase letters represent significant differences (p<0.05).

[0020] Figure 3Figure 1 is a subcellular localization map of HvNAC92 protein; in the figure, GFP: GFP fluorescence; RFP: RFP fluorescence; Bright: bright field image; Merged: superimposed image; HvNAC92-GFP: fusion protein of HvNAC92 and GFP; nRFP: nuclear localization marker.

[0021] Figure 4 Figure 4 is a verification of the transcription activation ability of HvNAC92 protein.

[0022] Figure 5 Figure 5 is the phenotype difference of HvNAC92 gene knockout mutant and wild type under salt stress; in which, (A) is a plant phenotype photo, showing the salt tolerance difference of mutant material and wild type after being treated under 200 mM NaCl for 14 days at the seedling age of 14 days; (B) is the gene editing type of HvNAC92 gene knockout mutant; (C) is a comparison chart of root and aboveground dry weight of wild type and mutant material under control (Control) condition; (D) is a comparison chart of root and aboveground dry weight of wild type and mutant material after salt treatment; in the figure, different lowercase letters represent significant difference (p<0.05).

[0023] Figure 6 Figure 6 is the Na and K ion content difference of HvNAC92 gene knockout mutant and wild type under salt stress; in which, (A) is the root Na ion concentration; (B) is the aboveground Na ion concentration; (C) is the whole plant Na ion content; (D) is the Na ion transport rate from root to aboveground; (E) is the root K ion concentration; (F) is the aboveground K ion concentration; (G) is the root K / Na ratio; (H) is the aboveground K / Na ratio. DETAILED DESCRIPTION

[0024] The technical solutions described in the present application are all conventional solutions in the field if not specifically stated, and the reagents or raw materials used are purchased from commercial channels or are already disclosed if not specifically stated.

[0025] The present application provides a kind of HvNAC92 gene, its nucleotide sequence is as shown in SEQ ID NO.1.

[0026] The present application provides a kind of HvNAC92 gene, its nucleotide sequence is as shown in SEQ ID NO.1.

[0027] The present application provides a kind of HvNAC92 gene, its nucleotide sequence is as shown in SEQ ID NO.1.

[0028] The application also provides application of the editing vector containing the HvNAC92 gene in improving salt tolerance of plants, and the plants include barley, rice, corn and wheat.

[0029] The application also provides application of the HvNAC92 gene, the HvNAC92 protein or the editing vector containing the HvNAC92 gene in breeding salt-tolerant plants, and the plants include barley, rice, corn and wheat.

[0030] The application also provides a method for improving salt tolerance of plants, and the method comprises the following steps: introducing an editing vector of a HvNAC92 gene into plants, and knocking out the HvNAC92 gene, wherein the nucleotide sequence of the HvNAC92 gene is shown in SEQ ID NO. 1, and the plants include barley, rice, corn and wheat.

[0031] The application also provides a method for breeding salt-tolerant plants, and the method comprises the following steps: introducing an editing vector of a HvNAC92 gene into plants, and knocking out the HvNAC92 gene, wherein the nucleotide sequence of the HvNAC92 gene is shown in SEQ ID NO. 1, and the plants include barley, rice, corn and wheat.

[0032] The application shows that the HvNAC92 gene coding protein is located in the nucleus and has transcription activation ability through subcellular localization and transcription activation ability verification test. The HvNAC92 gene is knocked out by using CRISPR gene editing technology, and a functional deficiency barley mutant is successfully obtained. Research shows that knocking out the gene significantly enhances the salt tolerance of barley, and the growth and biomass of the mutant under salt stress are significantly better than those of the wild-type barley. Ion content determination results show that knocking out the HvNAC92 gene can reduce the transportation of Na ions from the root system to the aboveground part, and increase the absorption of K ions, thereby improving the salt tolerance of plants. In addition, by using gene editing technology, homologous genes of the HvNAC92 gene in crops such as rice, corn and wheat can be knocked out to improve the salt tolerance of these plants.

[0033] If the HvNAC92 gene knockout mutant strain of the application is needed, Dr. Liu Hui Guan of the College of Agriculture, Hunan Agricultural University can be contacted, and the address is: No. 348, Building 3, Yuelushan Laboratory, Furong District, Changsha, Hunan Province, China, and the postcode is 410128.

[0034] Embodiment 1 Cloning of the coding region sequence (CDS) of the barley HvNAC92 gene.

[0035] (I) Extraction of total RNA The total RNA was extracted by using an RNA extraction kit (RC411, Nuoyuan, Nanjing), and the extraction method was according to the kit instructions, and the specific method was as follows: (1) Take about 100 mg root tissue of barley Golden Promise, grind it with liquid nitrogen, and immediately add 600 μL Buffer EL. Vigorously vortex for 30 sec to mix the sample and the lysis solution well. Centrifuge at 12,000 rpm for 5 min, and immediately proceed to the next step; (2) Take about 500 μL supernatant and add it to FastPure gDNA-Filter Columns III. Centrifuge at 12,000 rpm for 30 sec, discard the FastPure gDNA-Filter Columns III, and collect the filtrate; (3) Add 0.5 times the volume of the filtrate (about 250 μL) of anhydrous ethanol to the collection tube, and mix well for 15 sec; (4) Transfer the mixture to FastPure RNA Columns V, and centrifuge at 12,000 rpm for 30 sec to discard the filtrate; (5) Add 700 μL Buffer RWA to FastPure RNA Columns V, and centrifuge at 12,000 rpm for 30 sec to discard the filtrate; (6) Add 500 μL Buffer RWB to FastPure RNA Columns V, and centrifuge at 12,000 rpm for 30 sec to discard the filtrate; (7) Repeat step (6); (8) Place FastPure RNA Columns V back into the collection tube, and centrifuge at 12,000 rpm for 2 min; (9) Transfer FastPure RNA Columns V to a new RNase-free Collection Tubes 1.5 mL centrifuge tube, and add 30-100 μL RNase-free ddH2O preheated at 65℃ to the center of the membrane of the adsorption column. Let it stand at room temperature for 5 min, and centrifuge at 12,000 rpm for 1 min; (10) Determine the concentration of RNA. Use a microspectrophotometer NanoDrop 2000 to determine the concentration, A260 / 280, and A260 / 230 of the RNA; (11) Store at -80℃, or directly use for the following reverse transcription experiment.

[0036] (II) Synthesis of first-strand cDNA Use a reverse transcription kit (R412, Novagen, Nanjing) to synthesize first-strand cDNA. Refer to the instructions of the kit for the synthesis method, and the specific method is as follows: (1) In 0.2 mL RNase-free centrifuge tube, prepare the mixture as shown in Table 1 (in which total RNA is obtained from step (1); if the RNA stored at -80℃ is used, it must be slowly dissolved on ice); Table 1 Mixture

[0037] (2) Gently blow and mix with pipette, heat at 65℃ for 5 min in PCR instrument, quickly cool on ice, and stand on ice for 2 min to complete denaturation and annealing reaction; (3) Remove genomic DNA: add 2 μL 5×gDNA wiper Mix to the above centrifuge tube, gently blow and mix with pipette, and stand at 42℃ for 2 min in PCR instrument; (4) Prepare the first strand cDNA synthesis reaction solution according to Table 2; Table 2 First strand cDNA synthesis reaction solution

[0038] (5) Gently blow and mix with pipette: perform the first strand cDNA synthesis reaction according to the conditions in Table 3 in PCR instrument; Table 3 First strand cDNA synthesis reaction program

[0039] (6) The synthesized reverse transcription product cDNA is used for subsequent PCR reaction, or stored at -20℃ for standby.

[0040] (Three) Acquisition of CDS sequence According to the Ensemble Plant database query, the full-length reference sequence of barley HvNAC92 gene (HORVU.MOREX.r3.2HG0173400) is obtained. The gene-specific primers pMD19-T-F (SEQ ID NO. 3: ATGGAGCACGGCGAGCAGGA) and pMD19-T-R (SEQ ID NO. 4: TTAGTAGCCCCACGGCGCGG) are designed, and the synthesized cDNA of Hordeum jubatum in step (2) is used as a template to perform PCR amplification by using high-fidelity enzyme (P510, Novozyme, Nanjing).

[0041] The PCR amplification system is shown in Table 4 (the following double primer PCR reaction uses this system).

[0042] Table 4 PCR amplification system

[0043] In addition, the PCR reaction procedure was as follows: pre-denaturation at 98℃ for 30 sec, 35 cycles of denaturation at 98℃ for 10 sec, annealing at 58℃ for 5 sec, extension at 72℃ for 20 sec, and complete extension at 72℃ for 1 min.

[0044] After the PCR reaction, 1% agarose gel electrophoresis was performed to detect whether there was a band of appropriate size, and the results were as shown in Fig. 2B. Figure 1 As shown in Fig. 2B, the results showed that the CDS band size of the sea-buckthorn was about 1.0 kb, which was consistent with the expected size. HmSTG2

[0045] Subsequently, the product was subjected to gel recovery (the recovery was according to the operation of "MiniBEST Agarose Gel DNA Extraction Kit" of Takara Company), vector ligation (4 μL of the gel recovery product was connected with pMD19-T vector, and the operation steps were performed according to the instruction of "pMD19-T Vector Cloning Kit"), transformation (the ligation product was transformed into E. coli competent cells DH5α, and cultured on LB plate medium containing ampicillin at 37℃ for 14 h; a single colony was picked and cultured in LB liquid medium for 3 h), plasmid DNA was extracted by alkaline lysis method, enzyme digestion identification (BamH I and Xma I double enzyme digestion identification), and sequence determination (the plasmid with correct enzyme digestion identification was sent to Shanghai Shengong Bioengineering Co., Ltd. for sequencing).

[0046] After sequencing, sequence alignment was performed by using SnapGene software, and the CDS sequence of the gene HvNAC92 was obtained, as shown in SEQ ID NO. 1. The plasmid DNA of the single clone pMD19-T-HvNAC92 with correct sequencing was stored at -20℃, and was used for subsequent functional verification experiments.

[0047] ​

[0048] Example 2 Nucleotide sequence annotation and protein amino acid sequence analysis of the barley HvNAC92 gene.

[0049] The cloned HvNAC92 gene CDS is 1053 bp in length. According to annotation information from the Ensembl Plant database, it contains 3 exons and 2 introns, as shown below. Figure 1 As shown in Figure B. The CDS sequence was translated using SnapGene software, revealing that the gene encodes 350 amino acids, with the amino acid sequence shown in SEQ ID NO.2, and a predicted molecular weight of approximately 37.85 kDa. Analysis of the functional and conserved domains of the HvNAC92 protein using the InterProScan database and analysis software revealed that the HvNAC92 protein contains a NAM domain (pfam02365) at positions 14-138 aa, labeled as Noapical meristem (NAM) protein.

[0050] SEQ ID NO.2: MEHGEQEQHAMELPPGFRFHPTDEELITHYLAKKVADARFAALAVSVADLNKCEPWDLPALARMGEKEWYFFCLKDRKYPTGLRTNRATESGYWKATGKDKDILRGKALVGMKKTLVFYTGRAPKGEKSGWVMHEYRLNAKLHAASTSRGSLPGSRAASSSSSKNEWVLCRVF KKSLVGVVSPAPASSAARKSGVGMIEEIGSTVAAVTPLPPLLDMSGSGASFDQAAHVTCFSNNALEAGQFFNPTATDQDQHGLATYSPLASFAQYGGQLHHGVSLSLVQLLESSGYHRGLADDMAPCGNQQQPAACRGEREKLSASQDTGLTSDVNPEISSSLGQKSFDHEPAPWGY*.

[0051] Example 3 Expression level of barley HvNAC92 gene under salt stress.

[0052] (1) The data used here is downloaded from NCBI, the retrieval number is PRJNA639318. The experimental process is as follows: the barley Morex seedlings are cultured in 1 / 5 Hoagland nutrient solution (NS10205, Coolai, Beijing) to the three-leaf-one-heart stage, and then NaCl is added to the nutrient solution at a concentration of 50 mM and 100 mM per day to a final concentration of 150 mM and 300 mM NaCl, respectively. The control group (Control) does not add NaCl; after 4 days of treatment, the root and aboveground tissues are extracted according to the method of extracting total RNA in Example 1 to extract RNA, and after quality inspection, the library is constructed and sequenced.

[0053] (2) The Reads obtained by sequencing are processed by RNA-seq data analysis software HTSeq (https: / / htseq.readthedocs.io / en / ) to obtain the expression of each gene (expressed as FPKM value, that is, the number of fragments from a certain gene per kilobase length in every million fragments); the expression of HvNAC92 is extracted and a column chart is drawn. The results show that HvNAC92 gene is mainly expressed in the root (Root) and is significantly down-regulated by salt stress induction (see Figure 2 ).

[0054] Example 4 In order to clarify the subcellular localization of HvNAC92 protein, the ZL035-HvNAC92-GFP transient expression vector is constructed, and it is transformed into Nicotiana benthamiana for expression, and the results show that HvNAC92 is located in the nucleus (see Figure 3 ). The specific experimental steps are as follows: (I) Expression vector construction and Agrobacterium transformation (1) Design specific primers HvNAC92-ZL035-F (SEQ ID NO. 5: ctatttacaattacagtcgacATGGAGCACGGCGAGCAG) and HvNAC92-ZL035-R (SEQ ID NO. 6: catggatcctctagagtcgacGTAGCCCCACGGCGCGGG) to pMD19-T-HvNAC92 plasmid as template, PCR amplification by Novozyme P510 high fidelity enzyme, electrophoresis, and gel recovery to obtain HvNAC92 full-length CDS (remove stop codon) PCR purification product.

[0055] (2) The ZL035-GFP empty plasmid is digested with Sal I endonuclease, and the linearized vector is obtained by electrophoresis and gel recovery.

[0056] (3) Homologous recombination reaction is carried out by using seamless cloning kit (C116, Novozyme, Nanjing); the reaction solution is prepared according to Table 5.

[0057] Table 5 Homologous recombination reaction solution

[0058] (4) Gently blow the mixture with a pipette, place it in a PCR instrument at 50°C for 5 min; reduce to 4°C or immediately place it on ice to cool.

[0059] (5) Recombination product transforms E. coli DH5a, and is cultured on LB plates containing ampicillin for 12-16 h, and the single colony plasmid with correct sequencing is transformed into Agrobacterium strain EHA105.

[0060] (B) Agrobacterium culture and tobacco injection The transformed Agrobacterium monoclonal is cultured in 5 ml LB medium overnight, and the culture is incubated until OD600 reaches 1.0. After collecting the bacterial cells, resuspend them in tobacco transformation buffer to OD600 = 0.8, and stand at room temperature for 3 hours. Mix with the same volume of Agrobacterium strain of tobacco cell nucleus localization Marker (nRFP), and inject into Nicotiana benthamiana leaves. Prepare the tobacco transformation buffer according to Table 6: Table 6 Tobacco transformation buffer formula

[0061] (Three) Fluorescence microscopic observation After injection, the tobacco is cultured in an incubator for 48 hours, and then the fluorescence signal is photographed using a laser confocal microscope (Zeiss LSM 980) to obtain GFP fluorescence (GFP), RFP fluorescence (RFP), bright field image (Bright filed) and merged image (Merged). The results show that the HvNAC92 signal completely overlaps with the cell nucleus Marker signal, indicating that the protein is located in the nucleus (see Figure 3 ).

[0062] Example 5 Confirm the transcription activation ability of HvNAC92 protein by auxotrophic yeast strains.

[0063] The specific steps are as follows: (A) Expression vector construction and yeast transformation (1) Using pMD19-T-HvNAC92 plasmid as template, PCR amplification was performed with Novagen P510 high-fidelity enzyme, and the primers used were HvNAC92-BD-F (SEQ ID NO. 7: atggccatggaggccgaattcATGGAGCACGGCGAGCAG) and HvNAC92-BD-R (SEQ ID NO. 8: tcgacggatccccgggaattcTTAGTAGCCCCACGGCGC). After electrophoresis, the PCR purified product was obtained by gel recovery.

[0064] (2) Linearized vector was obtained by gel recovery after single enzyme digestion of pGBKT7 empty plasmid with EcoR I endonuclease.

[0065] (3) Homologous recombination reaction was performed using a seamless cloning kit (C116, Novagen, Nanjing). The reaction solution was prepared according to Table 5 in Example 4.

[0066] (4) The mixture was mixed gently by pipetting and placed in a PCR instrument at 50 °C for 5 min; then reduced to 4 °C or immediately placed on ice for cooling.

[0067] (5) The recombination product was transformed into E. coli DH5a, which was cultured on LB plates containing kanamycin for 12-16 h, and single colonies were picked for plasmid extraction by alkaline lysis method. The single colony plasmid with correct sequencing was used to transform yeast.

[0068] (6) The above recombinant plasmid and empty plasmid were respectively transformed into histidine (His) -deficient expression yeast strain competent AH109 (CC317, CoolAid, Beijing) using PEG / LiAc method, and the operation steps were performed according to the instructions provided by the kit.

[0069] (B) Growth of recombinant yeast strains on nutrient-deficient medium The recombinant yeast and empty yeast strains were cultured in SD liquid medium (without tryptophan Trp) to OD600=0.4, and then plated on SD solid medium (CoolAid, Beijing) lacking tryptophan (-Trp), tryptophan and histidine (-Trp / -His), and tryptophan, histidine and adenine (-Trp / -His / -Ade), and then placed in a 30 °C incubator for 3 d for photography. The results showed that there was no difference in the growth of HvNAC92 recombinant yeast and empty vector on tryptophan-deficient plates, while only HvNAC92 recombinant yeast could grow normally on double- and triple-deficient medium, indicating that HvNAC92 protein has transcription activation ability (see Figure 4 ).

[0070] Example 6 The embodiment of the application takes barley variety Golden Promise as background, and constructs a functional loss mutant of HvNAC92 gene through CRISPR / Cas9 gene editing technology.

[0071] The specific steps are as follows: (I) gene editing vector construction (1) pUB-Cas9-TaU6-sgRNA empty plasmid is subjected to enzyme cutting by using BsaⅠ-HF®v2 endonuclease, and linearized vector is obtained by recovering gel after electrophoresis.

[0072] (2) HvNAC92 gene target site specific primers HvNAC92-sgF (SEQ ID NO. 9: cttgCAAGTACCCGACGGGGTTG) and HvNAC92-sgR (SEQ ID NO. 10: aaacCAACCCCGTCGGGTACTTG) are designed, and the two single-stranded primers are dissolved in 0.5×TE buffer to carry out annealing operation, to obtain double-stranded product with a concentration of 10 pmol / μl. T4PNK (M0201V, NEB) is added to carry out phosphorylation treatment according to the instruction system.

[0073] (3) T4 DNA ligase is used to carry out ligation reaction of linearized vector and phosphorylated product of double-stranded primers; the reaction solution is prepared according to Table 7.

[0074] Table 7 Homologous recombination reaction solution

[0075] (4) The mixture is mixed by gently blowing with a pipette, and is placed in a PCR instrument at 16 ℃ for overnight reaction.

[0076] (5) The ligation product is transformed into E. coli DH5α, and is cultured on a LB plate containing kanamycin for 16 h, and a single colony is selected to extract plasmid by alkali lysis method, and the single colony with correct sequencing is introduced into Agrobacterium strain AGL1 by freeze-thaw method, and a positive single colony is selected for subsequent barley genetic transformation.

[0077] (II) Barley genetic transformation (1) Embryo isolation and sterilization: Barley genetic transformation with Golden Promise embryos, 2-3 weeks after flowering, when the embryo diameter is 1.5-2.0 mm, the ear is harvested. Peel off the immature seeds from the ear, remove the awn without damaging the seed coat, and place it in a 50 ml centrifuge tube (not more than 35 ml scale line). Surface sterilize with 70% alcohol for 30 s, shake evenly in the middle, wash with sterilized water for 3 times. Soak with 50% (v / v) sodium hypochlorite solution, stand for 4 min, shake evenly in the middle, sterilize thoroughly, and wash with sterilized water for 4 times. On the sterile filter paper, hold the seed with tweezers, with the ventral groove down, insert the tip of the tweezers into the back of the seed embryo, and fix it. On one side of the immature embryo, use the second pair of curved and hooked tweezers to peel off / tear off the central seed coat from the end with the awn, leaving the two sides of the seed coat, and you can see the immature embryo. Use the hooked tweezers to squeeze along the embryo gap and slide down, remove the embryo bud, embryo axis and radicle, and only keep the scutellum (shape is a concave disc in the middle, even if it is damaged, it will not affect the subsequent differentiation), and take out the small scutellum by squeezing or clamping. After separation, place each embryo scutellum upwards in CI medium, and press lightly to make the scutellum evenly and fully contact the medium. Place 80-100 embryos in each 9 cm culture dish, and pre-culture at 24°C in the dark for 1-2 d (according to the differentiation of the embryo, the dark culture time can be appropriately increased, but preferably not more than 1 week).

[0078] (2) Agrobacterium infection and co-culture: Take 10 μL of Agrobacterium liquid in 10 ml of sterile MG liquid medium, and culture at 28°C in the dark at 200 r / min for 24 h until the OD 600 is 1.8-2.0; use a 100 μl pipette to suck the bacterial liquid and drop it on each embryo, and immediately suck back the excess bacterial liquid after the bacterial liquid completely covers the embryo. Each time, about 30-40 embryos can be infected, and the excess residual bacterial liquid on the embryo is sucked back as much as possible. After one dish of embryos is treated, place the plate obliquely to allow the bacterial liquid to completely cover the embryo and dry the embryo. After at most three plates are treated, gently move the embryos from the old plate to the new CI plate. Be careful not to take out the excess medium, and try to gently drag the embryo to remove the old medium. Seal the plate with sealing film, and co-culture at 24°C for 2-3 d (depending on the quality of the embryo and the growth of Agrobacterium).

[0079] (3) Selection culture: after 3 days of co-culture, the immature embryos are transferred to fresh CI selection medium CIS and cultured in the dark at 23-24°C. The fresh CIS plates are replaced every 2 weeks and the immature embryos and calli are transferred together. After 5-6 weeks (depending on the development of the immature embryos) of selection culture on CIS, the calli are transferred to transfer medium T with the corresponding antibiotics (50 mg / L hygromycin and 160 mg / L phosphinotricin). The culture is carried out at 24°C under weak light for 2-4 weeks. A piece of thin paper (A4 printing paper) can be used to cover the medium. At this time, green spots will be generated.

[0080] (4) Regeneration and rooting culture of the transgenic plants: then, the culture is subcultured in B13M medium for 2-6 weeks (the B13M medium is replaced once when the culture is about 4 weeks old, at which time the seedlings are relatively large, and the surface of the medium is punctured and broken with a pair of tweezers in advance, the seedlings are kept vertical, and the leaves are kept from contacting the medium as much as possible to prevent the seedlings from growing vigorously and causing the root-anchoring part to dry out and die, and generally 1-2 replacements are enough to obtain sufficient seedlings), when the leaves on the aboveground part reach 2-3 cm, the seedlings are transferred to rooting medium R, and each 10 ml culture tube contains 2-3 ml R medium. When the root system begins to form and becomes strong, the T0 generation of transgenic seedlings is obtained.

[0081] (5) The medium formula for barley tissue culture and transformation is shown in Table 8.

[0082] Table 8 Medium formula for barley tissue culture and genetic transformation

[0083] (Three) Identification of mutant plants (1) DNA extraction and PCR amplification In a 2 mL centrifuge tube, 2 3 mm small grinding beads are placed, and about 50 mg of young leaves of the T0 generation seedlings are taken, cut and placed in the tube, and the sample is ground with a grinder, parameters: 40 Hz, 60 s, 2 times. After grinding, 400 μL Edwards buffer (200 mM Tris-HCl pH 7.5, 250 mM NaCl, 25 mM EDTA and 0.5% SDS) is added; 65 ℃ metal bath for 10 min (or oven at 65 ℃ for 15 min), interval 5 min, mix well by inverting; 13,000 rpm, centrifuge for 5 min. 200 μL of supernatant is taken into a new 1.5 mL centrifuge tube, avoiding absorption of the precipitate; add an equal amount of 200 μL isopropanol, mix well by inverting, and stand in the refrigerator at -20 ℃ for 10 min; 13,000 rpm, centrifuge for 5 min. Discard the supernatant and dry it on a clean bench; add 60-100 μL ddH2O, vortex to dissolve the DNA, and store at 4°C for later use.

[0084] The extracted T0 generation seedling DNA was used as a template, and primers HvNAC92sg-seq-F (SEQ ID NO. 11: TTCTCTGAATCTCCTGCCTAGC) and HvNAC92sg-seq-R (SEQ ID NO. 12: GATCGATCACAAGCAAGATGCC) were used for PCR amplification of the target region sequence, and the PCR product was recovered with gel for subsequent sequencing analysis.

[0085] (2) Mutant sequencing identification Among the constructed mutants, two homozygous mutant lines, Hvnac92-1 and Hvnac92-2, were selected by the present application. Through sequencing analysis, Hvnac92-1 inserted 2 T bases at the target position in the HvNAC92 gene, while Hvnac92-2 inserted 1 T base (Table 1) Figure 5 Table 1. Sequencing analysis of HvNAC92 gene in T0 generation mutants

[0086] Example 7 In order to identify the salt tolerance of the HvNAC92 gene knockout mutant plants, the identified T0 generation mutants were first continuously bred for two generations in the growth chamber, and the daily light cycle and culture temperature were set to 14 h light (23°C), followed by 10 h darkness (19°C), and then the salt tolerance of the barley mutant lines was evaluated in the T2 generation.

[0087] (1) Germination and pre-culture of barley seeds Seeds of the same size and fullness were selected from the mutant lines and wild type, and were disinfected with 3% hydrogen peroxide for 30 min and soaked at room temperature for 2 h at 25°C, then transferred to moistened filter paper, cultured in the dark at 25°C until the bud length was 3-4 cm, and then transferred to 1 / 5 Hoagland nutrient solution (NS10205, Coolai, Beijing) for light culture. The daily light cycle and culture temperature in the incubator were set to 14 h light (23°C), followed by 10 h darkness (19°C), and the nutrient solution was replaced every three days.

[0088] (2) Growth of mutant and wild type barley seedlings under normal conditions and salt stress treatment After the seedlings were cultured to the three-leaf stage, NaCl was added to the nutrient solution at a concentration of 100 mM per day until the final concentration was 200 mM NaCl. The control group (Control) was not added with NaCl. After 14 days of treatment, the plants were photographed and sampled to determine the root and shoot dry weights. The results showed that there was no significant difference in growth and dry weight between the HvNAC92 knockout mutant and the wild type under normal conditions. Under 200 mM salt treatment, the growth of the two mutant strains was significantly stronger than that of the wild type, and the root and shoot dry weights were significantly higher than those of the wild type (see Figure 5 ).

[0089] (3) Na and K element contents in the tissues of mutant and wild type barley seedlings under salt stress treatment The root and shoot dried samples were digested with concentrated nitric acid. The operation steps were as follows: the sample was placed at the bottom of a 20 mL digestion tube, 3 mL of concentrated HNO3 was added, and then the tube was placed in a constant temperature metal bath (DTU-2CN, TAITEC, Japan). First, the temperature was raised to 80℃, and then the sample was dissolved to a liquid state at 120℃ until the sample was completely dissolved to a liquid state (usually 2-3 h). The acid was discharged to 1-1.5 mL of liquid remaining in the test tube, and then the volume was adjusted to 20 mL with deionized water after cooling. The element content was determined by inductively coupled plasma mass spectrometry (iCAP-RQ, Thermo Fisher Scientific, USA). The results showed that under 200 mM salt treatment, the Na ion concentration in the shoots and the amount of Na ion transported from the roots to the shoots of the HvNAC92 knockout mutant strains were significantly lower than those of the wild type, and the K ion concentration and K / Na ratio in the roots and shoots were significantly higher than those of the wild type (see Figure 6 ).

[0090] The above results show that knocking out the HvNAC92 gene in barley reduces the transport of Na ions from the roots to the shoots and the Na ion content in the shoots, and increases the absorption of K ions, thereby enhancing the salt tolerance of the plants.

[0091] In summary, the present application clones a NAC family gene HvNAC92 from barley that responds to salt stress. It is found for the first time that the gene HvNAC92 is located in the nucleus and has transcription activation ability, and plays an important role in maintaining low Na ion and high K ion concentrations in the plant body to resist external salt stress. Through gene editing technology, the homologous genes of HvNAC92 can be knocked out in crops such as rice, corn and wheat to improve the salt tolerance of these plants, thereby improving their yield and quality, which has great economic value and social benefits.

[0092] Obviously, the above embodiments of the present application are merely exemplary but not intended to limit the embodiments of the present application. Based on the above description, other different forms of changes or variations can be made by those skilled in the art. Here, it is not necessary or possible to exhaust all the embodiments. Any modification, equivalent replacement and improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the claims of the present application.

Claims

1. A HvNAC92 gene, characterized in that, The nucleotide sequence is shown as SEQ ID NO.

1.

2. The HvNAC92 protein encoded by the HvNAC92 gene of claim 1, wherein, The amino acid sequence is shown as SEQ ID NO.

2.

3. Use of the HvNAC92 gene of claim 1 or the HvNAC92 protein of claim 2 for increasing salt tolerance in plants, characterized in that, The plants include barley, rice, corn and wheat.

4. Use of an editing vector comprising the HvNAC92 gene of claim 1 for increasing salt tolerance in plants, characterized in that, The plants include barley, rice, corn and wheat.

5. The use of the HvNAC92 gene, HvNAC92 protein or editing vector containing the HvNAC92 gene in salt-tolerant plant breeding according to claim 1, characterized in that, The plants include barley, rice, corn and wheat.

6. A method for increasing salt tolerance in plants, characterized by, The plants include barley, rice, corn and wheat.

7. A method of breeding a salt tolerant plant, characterized by, An editing vector of the HvNAC92 gene is introduced into plants to knockout the HvNAC92 gene, the nucleotide sequence of the HvNAC92 gene is shown as SEQ ID NO. 1, and the plants include barley, rice, corn and wheat. An editing vector of the HvNAC92 gene is introduced into plants to knockout the HvNAC92 gene, the nucleotide sequence of the HvNAC92 gene is shown as SEQ ID NO. 1, and the plants include barley, rice, corn and wheat.

Images