Cordyceps sobolifera strain GXU-7872 and application of fermentation product of cordyceps sobolifera strain GXU-7872 in preparation of aquatic feed

By using the fermentation product of the Cordyceps sinensis strain GXU-7872 as an aquatic feed additive, the problems of disease and environmental pollution in aquaculture have been solved, the growth performance and liver antioxidant capacity of tilapia have been improved, and intestinal health and immunity have been improved.

CN120648568APending Publication Date: 2025-09-16KUNMING INST OF BOTANY CHINESE ACAD OF SCI +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510797474.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-16
Publication Date
2025-09-16

AI Technical Summary

Technical Problem

Disease outbreaks, environmental pollution and food safety issues in aquaculture are mainly caused by pathogens. The use of existing antibiotics leads to drug resistance and drug residues, endangering the environment and human health.

Method used

The fermentation product of Cordyceps sinensis strain GXU-7872 is used as a feed additive to promote the growth of tilapia, improve its liver antioxidant capacity and intestinal health, and regulate intestinal microbial diversity.

Benefits of technology

The fermentation products of the Cordyceps sinensis strain GXU-7872 significantly improve the growth performance, liver antioxidant capacity and intestinal health of tilapia, improve immunity and regulate intestinal microbial diversity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120648568A_ABST
    Figure CN120648568A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of microorganisms. The invention provides a cordyceps sobolifera strain GXU-7872, the classification name of the cordyceps sobolifera strain GXU-7872 is Cordyceps cicadae GXU-7872, the cordyceps sobolifera strain GXU-7872 is preserved in China Center for Type Culture Collection, the preservation date is May 7, 2025, the preservation address is Wuhan University, Wuhan, China, and the preservation number is CCTCC NO: M 2025988. A fermentation product obtained by utilizing the cordyceps sobolifera strain GXU-7872 can be used as a feed additive, and has the effects of promoting the growth performance of tilapia mossambica, improving the liver oxidation resistance of the tilapia mossambica, regulating the diversity of intestinal microorganisms, improving the health state of intestinal tracts and improving the immunity of the tilapia mossambica.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of microorganisms, and in particular to application of a Cordyceps militaris strain GXU-7872 and a fermentation product thereof in preparing aquatic feed. Background Art

[0002] The aquaculture industry faces numerous challenges during its development, including disease outbreaks, environmental pollution, and food safety issues. These challenges are primarily caused by pathogens such as viruses, bacteria, and fungi. Currently, the primary approach to addressing these issues is antibiotics. However, numerous studies have confirmed that long-term antibiotic use not only leads to drug resistance in pathogens but also accumulates drug residues in aquaculture, causing severe damage to the environment and soil, and even posing significant risks to human health.

[0003] Cordyceps sinensis, a broad-based Cordyceps fungus with a long history of medicinal use, is widely distributed in China, South Korea, Japan and other places. Its bioactive ingredients are second only to Cordyceps sinensis, and it can be used to treat pediatric epilepsy, night crying, palpitations and other related diseases. Its main effects include dispersing wind-heat, calming the nerves and relieving spasms, improving eyesight and clearing rashes, and nourishing and strengthening the body. Modern pharmacological studies have confirmed that it has significant effects in regulating immunity, fighting tumors, and improving renal function. In addition, Cordyceps sinensis contains a variety of active substances such as myriocin, nucleosides, sterols, cyclic peptides, and polysaccharides. In addition to having immunosuppressive effects, these ingredients also have certain therapeutic effects on diseases such as kidney disease, atherosclerosis, and anemia. In 2020, the National Health Commission issued the "Announcement on 15 "Three New Foods" Including Cordyceps sinensis Fruiting Bodies (Artificially Cultivated)", emphasizing that artificially cultivated Cordyceps sinensis fruiting bodies can be used as new food ingredients and their safety has passed review. Currently, Cordyceps sinensis has been approved for production and sale as a food and health supplement, and significant progress has been made in artificial cultivation research. Therefore, as a edible and medicinal probiotic, Cordyceps sinensis has broad research prospects for exploring whether its fermentation products or mycelial extracts can be used as antibiotic alternatives in aquaculture. Summary of the Invention

[0004] The present invention aims to provide a Cordyceps sinensis strain GXU-7872. The fermentation product obtained by using the Cordyceps sinensis strain GXU-7872 can be used as a feed additive, and has the functions of promoting the growth performance of tilapia, improving the antioxidant capacity of its liver, regulating the diversity of intestinal microorganisms, improving the health of the intestine, and improving the immunity of tilapia.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides a Cordyceps cicadae strain GXU-7872, which is classified as Cordyceps cicadae GXU-7872 and deposited in the China Center for Type Culture Collection on May 7, 2025, at Wuhan University in Wuhan, China, with a deposit number of CCTCC NO: M 2025988.

[0007] The present invention provides a fermentation product of the Cordyceps sinensis strain GXU-7872, which is obtained by fermenting the Cordyceps sinensis strain GXU-7872.

[0008] The present invention provides application of the fermentation product in preparing aquatic feed.

[0009] The present invention provides an aquatic feed containing the fermentation product, wherein the addition amount of the fermentation product is 1-3 wt%.

[0010] The present invention provides application of the fermentation product or the aquatic feed in promoting the growth and development of aquatic animals.

[0011] The present invention provides application of the fermentation product or the aquatic feed in improving the antioxidant capacity of the liver of aquatic animals.

[0012] The present invention provides application of the fermentation product or the aquatic feed in improving the intestinal state of aquatic animals.

[0013] By adopting the above technical solution, the present invention has the following beneficial effects:

[0014] 1. The present invention conducted morphological observation, physiological and biochemical studies, and molecular identification on the screened entomogenous fungus strains to determine the taxonomic status of strain GXU-7872, which was identified as Cordyceps cicadae.

[0015] 2. The fermentation product obtained by fermenting strain GXU-7872 in the present invention has a positive impact on fish growth performance, liver antioxidant capacity, and intestinal microbial diversity, and has important reference value for the growth and health of fish. The examples also show that the fermentation product of strain GXU-7872 is rich in amino acids and derivatives, which are beneficial for intestinal absorption in tilapia and promote the healthy growth of tilapia. The fermentation product can also enhance the liver antioxidant capacity of tilapia, improve its antioxidant capacity, regulate intestinal microbial diversity, improve intestinal health, and enhance the immunity of tilapia.

[0016] Biological Deposit Description

[0017] The present invention relates to a Cordyceps cicadae strain GXU-7872, which is classified as Cordyceps cicadae GXU-7872 and is deposited in the China Center for Type Culture Collection on May 7, 2025. The deposit address is Wuhan University, Wuhan, China, and the deposit number is CCTCCNO: M 2025988. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Observation results of the asexual morphology of strain GXU-7872 ( Figure 1 A represents wild specimen, B represents the front side of PDA colony, C represents the back side of PDA colony, D represents conidiophore, E represents phialodes, and F represents conidia);

[0019] Figure 2 This is the phylogenetic tree of strain GXU-7872 constructed based on the ITS gene;

[0020] Figure 3 Effects of adding Cordyceps fermentation products to feed on serum parameters of tilapia ( Figure 3 A represents ALT activity, B represents AST activity, C represents GLU activity, D represents TG activity, E represents CHO activity, and F represents HDL activity; different lowercase letters indicate significant differences (P < 0.05);

[0021] Figure 4 Effects of adding Cordyceps fermentation products to feed on the antioxidant capacity of tilapia liver ( Figure 4 A represents SOD, B represents CAT, C represents GSH-PX, D represents NO, E represents MDA, and F represents T-AOC; different lowercase letters indicate significant differences, P < 0.05);

[0022] Figure 5 Effects of adding Cordyceps fermentation products to feed on the intestinal structure of tilapia ( Figure 5 A in the figure indicates the CK group, B indicates the N1 group, C indicates the N3 group, D indicates the CSJ1 group, E indicates the CSJ3 group, and F indicates the CS3 group; the scale bar is 200 μm);

[0023] Figure 6 The effect of adding Cordyceps fermentation products to feed on the length of villi and thickness of muscle layer of tilapia (different lowercase letters indicate significant differences, P < 0.05);

[0024] Figure 7 Effects of adding Cordyceps fermentation products to feed on the liver structure of tilapia ( Figure 7A in the figure indicates the CK group, B indicates the N1 group, C indicates the N3 group, D indicates the CSJ1 group, E indicates the CSJ3 group, and F indicates the CS3 group; the scale bar is 100 μm);

[0025] Figure 8 To study the effect of adding Cordyceps fermentation products to feed on the Beta diversity of intestinal flora of tilapia;

[0026] Figure 9 This is an analysis of the structural composition of tilapia intestinal flora at the phylum level;

[0027] Figure 10 This is an analysis of the structural composition of the intestinal flora of tilapia at the family level;

[0028] Figure 11 This is the structural composition analysis of the intestinal flora of tilapia at the genus level;

[0029] Figure 12 Heat map analysis for predicting gut microbial function in tilapia;

[0030] Figure 13 Correlation analysis between fermentation products and microbial communities;

[0031] Figure 14 Heat map analysis of fermentation products and microbial abundance;

[0032] Figure 15 Heat map analysis of the content of fermentation products, fatty acids and amino acid metabolites ( Figure 15 Where A represents a fatty acid compound, and B represents an amino acid compound);

[0033] Figure 16 Correlation analysis between liver fatty acid metabolites and microbial flora ( Figure 16 A in the figure represents the correlation analysis between fatty acid metabolites and microbial genus levels, and B represents the correlation heat map). DETAILED DESCRIPTION

[0034] The present invention provides a Cordyceps cicadae strain GXU-7872, which is classified as Cordyceps cicadae GXU-7872 and deposited in the China Center for Type Culture Collection on May 7, 2025, at Wuhan University in Wuhan, China, with a deposit number of CCTCC NO: M 2025988.

[0035] The present invention provides a fermentation product of the Cordyceps sinensis strain GXU-7872, which is obtained by fermenting the Cordyceps sinensis strain GXU-7872.

[0036] The present invention provides application of the fermentation product in preparing aquatic feed.

[0037] The present invention provides an aquatic feed containing the fermentation product, wherein the addition amount of the fermentation product is 1-3 wt%.

[0038] The present invention provides application of the fermentation product or the aquatic feed in promoting the growth and development of aquatic animals.

[0039] The present invention provides application of the fermentation product or the aquatic feed in improving the antioxidant capacity of the liver of aquatic animals.

[0040] The present invention provides application of the fermentation product or the aquatic feed in improving the intestinal state of aquatic animals.

[0041] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0042] Example 1 Isolation and identification of strains

[0043] (1) Isolation, purification and preservation of strains

[0044] Materials were collected from the wild in Maoer Mountain, Guangxi (altitude 1500m). A small amount of spores was directly picked with tweezers and streaked onto PDA culture medium. The culture dish was sealed with parafilm and incubated at 25°C for seven days. A single colony was selected for further purification. After purification, a small amount of hyphae from the upper edge of the colony was inoculated onto a PDA slant. Once the colony on the slant matured, it was transferred to a refrigerator at 4°C for storage.

[0045] PDA medium: 2% potato starch, 2% glucose, 1% peptone, 1.5% agar powder, pH = 7.0, add deionized water to 1 L, and sterilize at 121°C for 20 min.

[0046] PDA slant medium: 2% potato starch, 2% glucose, 1% peptone, 1.5% agar powder, pH = 7.0, add deionized water to 1 L, and sterilize at 121°C for 20 min.

[0047] Seed culture medium: 2% potato flour, 2% glucose, 1% peptone, 0.2% KH2PO4, 0.0005% MgSO4·7H2O, pH = 7.0, add deionized water to 1 L, and sterilize at 121℃ for 20 min.

[0048] (2) Colony morphology observation and identification

[0049] When observing the morphology of asexual colonies, use a 3-5mm sterilized puncher to punch out circular colonies on completely purified and clean colonies and transfer them to the center of a new PDA culture medium. Culture at 25°C for 3-7 days and then take pictures. The macroscopic morphology of the colonies mainly includes the color, size, and texture of the front and back sides. Cut the mycelium into a piece of white transparent tape of appropriate size (note that there should be no creases or impurities when cutting the tape), and gently dip it in the mycelium on the purified colony. Be careful not to dip too much. Drop a drop of lactic acid carbolic acid cotton blue dye in the center of the slide, then place the tape with the mycelium dipped back up into the dye solution, cover with a coverslip, stain, and use sterile absorbent paper to absorb the excess dye on one side of the coverslip. Place it under a microscope for observation and take pictures. The macroscopic morphology mainly includes characteristics such as mycelium, conidia, and phialodes.

[0050] The results showed that (such as Figure 1 ): The host of this strain is the Hemiptera cicada nymph, and the conidiophores grow from the head of the host in large numbers. The conidiophores are oblong or oblate, light brown, curved, with many branches, and are 2.5-3 cm long. The spore masses are rod-shaped, white or milky white. After about 7 days of culture on PDA medium, the hyphae are dense, soft, white, cylindrical, and the back is white with a yellowish and smooth surface. The hyphae grow rapidly, and the colony diameter is 5-6 cm. Conidiophores grow from the hyphae, are 10-15 μm long, the spores are 2.5-3 μm in diameter, and the base is elliptical or nearly spherical. The conidia are single-celled, transparent and smooth, oblong, cylindrical or kidney-shaped. It was preliminarily identified as Cordyceps sinensis in the genus Cordyceps.

[0051] (III) Molecular phylogenetic analysis

[0052] The strain DNA was extracted using a fungal DNA kit (purchased from Sangon Biotech (Shanghai) Co., Ltd.), and the gene fragment was then PCR amplified using the ITS universal primers ITS4 and ITS5. A 1% agarose gel was prepared, and 4 μl of the PCR product sample was aspirated and placed into the electrophoresis tank. 1× TAE buffer was added for electrophoresis detection. The agarose gel after electrophoresis was then placed into a gel imaging system for observation to check for the appearance of a bright main band. The presence of a main band indicates successful PCR amplification and the presence of the target DNA fragment. The amplified product was sent to Shanghai Sangon Biotech Co., Ltd. or other relevant institutions for sequencing to determine the sequence information of the amplified gene fragment.

[0053] The subsequent sequencing results were spliced ​​using Seqman software, and high-quality FASTA files were generated after removing unwanted peaks. The FASTA files were then loaded into NCBI for BLAST comparison. Homologous sequences were analyzed to identify sequences from closely related species, and the sequences were downloaded. A phylogenetic tree was constructed using MEGAX software.

[0054] The sequence of the primer ITS4 is shown in SEQ ID NO.1, and the specific sequence is TCCTCCGCTTATTGATATGC; the sequence of the primer ITS5 is shown in SEQ ID NO.2, and the specific sequence is GGAAGTAAAAGTCGTAACAAGG.

[0055] Table 1 PCR amplification system

[0056] Element Dosage Buffer 10 μl dNTP 5.0 μl <![CDATA[mgcl2]]> 5.0 μl ITS4F 4.0 μl ITS5R 4.0 μl Taq 0.5 μl DMSO 2.5 μl DNA 4.0 μl <![CDATA[ddH2O]]> 15.0μl

[0057] Table 2 PCR amplification program

[0058]

[0059] The ITS gene sequence of GXU-7872 obtained by sequencing is 546 bp in length, as shown in SEQ ID NO.3. The specific sequence is: Figure 2 As shown, strain GXU-7872 and Cordyceps cicadae OP764012 clustered together.

[0060] Therefore, combined with morphological observation and ITS gene phylogenetic analysis, strain GXU-7872 was identified as Cordyceps cicadae.

[0061] Example 2

[0062] The optimal culture conditions of strain GXU-7872 were further optimized, and based on the culture medium components of this strain's high polysaccharide production, the effects of fermentation products on tilapia growth, liver metabolism and intestinal flora were evaluated.

[0063] Tilapia fry for this experiment were purchased from the Mowujiao Fish Fry Market in Tingzi, Jiangnan District, Nanning, Guangxi. The experimental aquariums (50 cm × 30 cm × 40 cm) were disinfected prior to the experiment. Twenty-five fish were housed in each treatment group, with three replicates per group. Each treatment group was fed a basal diet for two weeks to allow the fish to acclimate to the aquarium environment. Following the two-week period, the fish were fed the experimental diet for an additional eight weeks. The water temperature was maintained at 28 ± 2°C throughout the experiment.

[0064] After 8 weeks of feeding, five fish were randomly selected from each replicate group and anesthetized with eugenol. Sampling was performed after complete anesthesia. Blood samples were drawn from the tail vein using a 1ml sterile syringe and placed in a 2ml centrifuge tube. The samples were allowed to stand at 4°C and then centrifuged at 4°C, 2500 rpm, and stored at -80°C for further use. Sterilized forceps and scissors were disinfected by soaking in 75% alcohol. The experimental fish were placed on ice for dissection, and the organs were weighed and separated. The liver and midgut were obtained. Part of the liver and midgut were fixed in paraformaldehyde solution for sectioning. The remaining liver and intestinal lysate were placed in a 2ml centrifuge tube, snap-frozen in liquid nitrogen, and stored at -80°C for determination of liver tissue enzyme activity and metabolites and intestinal microbial flora analysis.

[0065] The feed was prepared according to the principle of equal lipid and nitrogen content. A conventional feed control group (CK), a fermentation substrate negative control group (added with 1% fermentation substrate (N1) and 3% fermentation substrate (N3)), a pure mycelium positive control group (added with 3% GXU-7872 mycelium cultured on seed culture medium (IC3)), and a treatment group with added GXU-7872 fermentation product (ICJ1 (1%) and ICJ3 (3%)) were set up. Each sample was accurately weighed and thoroughly mixed with the feed raw materials. Deionized water was added and the mixture was thoroughly stirred. The mixture was then formed into uniformly sized granules using a feed machine. The granules were dried in a dryer at 60°C and sealed and stored in a refrigerator at 4°C for later use.

[0066] The strain GXU-7872 is inoculated into a seed culture medium and cultured for a period of time, and then the selected cells are inoculated into a fermentation culture medium for fermentation culture. The fermentation culture is performed for 15 days to obtain a fermentation product of the strain GXU-7872. The fermentation culture medium comprises 2g / L KH2PO4, 0.5g / LMgSO4·7H2O, 10g / L peptone, 20g / L soybean meal, 60g / L molasses, 20g / L shrimp shell powder, 10g / L oil tea shell, 60g / L pyrenoid chlorella powder and 80g / L wheat bran. The fermentation substrate comprises 20g / L soybean meal, 60g / L molasses, 20g / L shrimp shell powder, 10g / L oil tea shell, 60g / L pyrenoid chlorella powder and 80g / L wheat bran.

[0067] (1) Effects on the growth performance of tilapia

[0068] After 2 weeks of feeding with the basic diet and 8 weeks of feeding, the initial average weight (IBW), final average weight (FBW), weight gain rate (WGR), specific growth rate (SGR), feed conversion ratio (FCR), feed intake (FI), body mass index (VSI), and survival rate (SR) of the fish were weighed. The specific calculation formulas are as follows:

[0069] Weight gain rate (WGR%) = 100 × (final mean – initial mean) / initial body weight

[0070] Specific growth rate (SGR) = 100 × (Ln (mean final body weight) – Ln (mean initial body weight)) / number of days of culture

[0071] Feed conversion ratio (FCR) = feed consumption / (final fish weight – initial fish weight)

[0072] Feed intake (FI) = 100 × total feed intake / [(final fish weight + initial fish weight) / 2 × number of days of culture]

[0073] Survival rate (SR%) = 100 × number of fish remaining at the end of the experiment / number of fish at the beginning of the experiment

[0074] Table 4 Effects of adding Cordyceps fermentation products to feed on the growth performance of tilapia

[0075] Group IBW(g) FBW(g) WGR (%) SGR (%) FCR F(% / d) SR (%) CK 7.80±0.19 41.73±0.16c 435.2±11.56c 3.00±0.04c 1.75 1.57 90.00±2.00ab N1 7.67±0.13 47.62±1.01bc 520.66±6.41b 3.26±0.02ab 1.54 3.65 94.00±2.00a N3 7.50±0.24 47.34±2.13bc 531.2±32.61b 3.29±0.09ab 1.14 2.85 93.00±1.00ab ICJ1 7.48±0.3 49.28±2.75a 558.82±51.88a 3.36±0.16a 1.54 2.51 86.00±2.00b ICJ3 7.49±0.12 48.93±2.94ab 553.27±40.55a 3.35±0.11a 1.33 2.55 96.00±4.00a IC3 7.73±0.1 28.61±0.41d 270.11±9.49d 2.33±0.05d 1.16 1.24 90.00±2.00ab

[0076] Note: Different lowercase letters indicate significant differences (P<0.05).

[0077] The results of the effects of adding Cordyceps fermentation products to the feed on the growth performance of tilapia are shown in Table 4. After 8 weeks of feeding, the initial average weight was around 7 grams, with no significant difference. The final average weight of the ICJ1 group was significantly higher than that of the CK group and the negative control group (P < 0.05); the positive control group was significantly lower than the other groups (P < 0.05). The WGR and SGR of the ICJ group were significantly higher than those of the CK group, the negative control group, and the positive control group (P < 0.05), with the ICJ1 group having the highest SGR. The FCR of each group was lower than that of the CK group. There was no significant difference in SR among the treatment groups, indicating that the addition of the GXU-7872 fermentation product promoted the growth of tilapia.

[0078] (2) Effects on tilapia serum indicators

[0079] After thawing, serum samples were assayed for biochemical parameters, including alanine aminotransferase (ALT) activity, aspartate aminotransferase (AST) activity, triglyceride (TG) content, cholesterol (CHO) content, high-density lipoprotein cholesterol (HDL-C) content, and glucose (GLU) content. The assays were performed according to the kit instructions, and the assays were performed using a spectrophotometer. All kits were purchased from Nanjing Jiancheng Bioengineering Institute.

[0080] Effects of adding fermentation products of strain GXU-7872 to feed on serum parameters of tilapia Figure 3 As shown in the results, compared with the CK group and the negative control group, the AST, ALT activities and GLU and TG contents in the serum of tilapia in the ICJ3 group were significantly reduced (P < 0.05), and there was no significant difference compared with the positive control group; in terms of CHO content, there was no significant difference among the treatment groups; in terms of HDL content, there was no significant difference among the groups.

[0081] (3) Effects on the antioxidant capacity of tilapia liver

[0082] After the liver tissue was thawed, physiological saline was added at a ratio of 1:9 (w / v) and ground using a grinder to prepare a 10% tissue homogenate. The tissue was centrifuged at 3500 rpm for 10 min at 4°C, and the supernatant was used to determine antioxidant enzyme activity. Superoxide dismutase (SOD) activity, malondialdehyde (MDA) content, glutathione peroxidase (GSH-Px) activity, catalase (CAT) activity, nitric oxide (NO) concentration, and total antioxidant capacity (T-AOC) activity were measured. All assay methods and procedures were strictly in accordance with the instructions of the corresponding kits (all purchased from Nanjing Jiancheng Bioengineering Institute).

[0083] Effects of adding fermentation products of strain GXU-7872 to feed on the antioxidant capacity of tilapia liver Figure 4 The results showed that compared with the CK group and the negative control group, SOD activity increased in all treatment groups, with the ICJ1 group showing a significant increase (P < 0.05), which was not significantly different from the positive control group. GSH-PX activity and NO content in the IC3 group were significantly increased (P < 0.05), indicating that the addition of pure mycelium was beneficial for increasing GSH-PX activity and NO content. MDA content increased in the ICJ1 group, but there was no significant difference. T-AOC activity showed no significant difference among the groups. Therefore, the addition of GXU-7872 fermentation products improved the antioxidant capacity of tilapia liver to a certain extent.

[0084] (IV) Effects on the intestinal and liver structure of tilapia

[0085] Liver and intestinal tissue samples were removed from paraformaldehyde fixative and dehydrated in 30%-70% ethanol to obtain transparent tissue. The tissue was then fixed in paraffin and cut into 5-μm sections using a microtome. The sections were stained with hematoxylin-eosin, observed under a microscope, and photographed for documentation. Five randomly selected tissue images were used to measure intestinal villus length and muscle thickness using ImageJ, and the average values ​​were used for statistical analysis.

[0086] Intestinal sections of each treatment group Figure 5 As shown in the figure, no obvious pathological changes were found after 8 weeks of feeding. The length of small intestinal villi in the CK group was significantly shorter, while the length of small intestinal villi in the ICJ group was longer and thinner than that in the CK group, with obvious braid and cup shapes, high and thick, and no top melting phenomenon. The muscle layer was thicker, and the animals were in a more obvious health state. Figure 6 As shown, villus length in each treatment group was significantly different compared to the CK group and negative control group (P < 0.05). Muscle thickness in the ICJ group was also significantly different compared to the CK group, negative control group, and positive control group (P < 0.05). This suggests that supplementing with Cordyceps fermentation products can promote intestinal nutrient absorption and improve intestinal health in tilapia.

[0087] Liver tissue sections Figure 7 As shown, the CK group showed significant pathological changes, with severe fat vacuoles and significant fat accumulation, which predisposes to the development of fatty liver. The remaining treatment groups showed significantly fewer fat vacuoles compared to the CK group, particularly the ICJ3 group, which also maintained better health than the other groups. This suggests that supplementing the Cordyceps fungus fermentation product improved the health of the tilapia, reduced liver damage, and prevented the development of fatty liver.

[0088] Example 3

[0089] Tilapia intestinal microbial DNA was extracted according to the instructions of the DNA extraction kit. The 16rDNA V3-V4 region of the intestinal contents was amplified using primers 341F and 806R. The sequence of primer 341F is shown in SEQ ID NO. 4, and the specific sequence is 5'-CCTACGGGNGGCWGCAG-3'; the sequence of primer 806R is shown in SEQ ID NO. 5, and the specific sequence is 5'-GGACTACHVGGGTATCTAAT-3'. Subsequently, high-throughput sequencing analysis was performed, and the obtained sequences were filtered, double-end spliced, and optimized sequences (Tags) were obtained. OTU cluster analysis was performed to obtain species classification results. Based on the classification results, the samples were classified and bioinformatics analyzed to explore the structure and composition of the intestinal biological community of tilapia.

[0090] (1) Alpha diversity of tilapia intestinal flora

[0091] After eight weeks of rearing, the tilapia gut microbiota was sequenced using high-throughput sequencing, and the results were analyzed for alpha diversity. Key metrics include Sobs, Chao1, Ace, Shannon, and Simpson. Sobs represents the number of OTUs in the gut microbiota, Chao1 represents the number of predicted OTUs, and Shannon and Simpson primarily reflect the richness of the gut microbiome. Higher values ​​indicate a higher diversity of the microbiota.

[0092] Table 5 Effects of adding Cordyceps fermentation products to feed on the Alpha diversity of intestinal flora of tilapia

[0093] Group Sobs Chao1 Ace Shannon Simpson CK 140 154.53 163.28 1.61 0.47 N1 127 170.16 183.54 1.16 0.29 N3 126 175.04 183.85 1.31 0.51 ICJ1 144 181.43 190.05 2.67 0.62 ICJ3 138 175.28 195.98 2.69 0.72 IC3 119 162.04 172.77 1.29 0.53

[0094] The results for each group are shown in Table 5. The number of OTUs in the ICJ1 group was higher than in the CK group, while the remaining treatment groups showed lower numbers. According to the Shannon and Simpson results, the species diversity and richness in the ICJ group were significantly higher than those in the CK, negative, and positive control groups. This indicates that supplementing the diet with GXU-7872 fermentation products can enhance the diversity of the tilapia gut microbiota. The species diversity in the remaining treatment groups was lower than in the CK group, indicating minimal impact on tilapia species diversity.

[0095] (2) Beta diversity of tilapia intestinal flora

[0096] Beta diversity refers to the differences in diversity between samples. It assesses the similarities and differences in species composition between samples, based on the overall microbial community structure. Beta diversity calculations between communities are primarily based on species presence and abundance. Grouping characteristics are displayed in a scatter plot using principal coordinate analysis (PCoA).

[0097] The results are as follows Figure 8 As shown, the ICJ group and the CK group were located in the same quadrant on the first principal coordinate (PCo1).

[0098] (3) Composition of tilapia intestinal microbial communities

[0099] From the door level (such as Figure 9 ), the dominant bacterial phylum in CK was Proteobacteria; the dominant bacterial phylum in N1 was Fusobacteriota, followed by Proteobacteria; the dominant bacterial phylum in N3, ICJ1, ICJ3, and IC3 groups was Proteobacteria, followed by Fusobacteria. Compared with the CK group, the abundance of Proteobacteria in each treatment group was significantly reduced, while Fusobacteria increased significantly. In the negative control group, the abundance of Fusobacteria decreased and that of Proteobacteria increased with the increase of the supplementation amount; in the ICJ group, the abundance of Fusobacteria increased and that of Proteobacteria decreased with the increase of the supplementation amount.

[0100] From the perspective of science level (such as Figure 10 ). In the CK group, the dominant family was Pseudomonadaceae, followed by Burkholderiaceae. In the N1 group, the dominant family was Fusobacteriaceae, followed by Burkholderiaceae. In the N3 and IC3 groups, the dominant family was Enterobacteriaceae, followed by Fusobacteriaceae. In the ICJ1 and ICJ3 groups, the dominant family was Burkholderiaceae, followed by Fusobacteriaceae. In the ICJ group, Burkholderiaceae began to decrease, while Fusobacteriaceae increased significantly.

[0101] From the subordinate level (such as Figure 11). The dominant bacterial genera in the CK group were Pseudomonas and Ralstonia, while the dominant bacterial genera in the N1 group were Cetobacterium and Ralstonia. The dominant bacterial genera in the N3 and IC3 groups were Cetobacterium and Plesiomonas. The dominant bacterial genera in the ICJ1 and ICJ3 groups were Ralstonia and Cetobacterium. In the negative control group, Cetobacterium significantly decreased, while Plesiomonas significantly increased, with increasing dosage. In the ICJ group, Cetobacterium significantly increased with increasing dosage.

[0102] (IV) Prediction of intestinal microbial function in tilapia

[0103] Based on PICRUSt analysis, KEGG prediction of tilapia intestinal microbial genus level was performed. Figure 12 As shown in the figure, heat map analysis of the top 20 metabolic pathways. Overall, the expression levels of metabolic pathways in the tilapia intestinal flora in all treatment groups were significantly higher than those in the CK group. These pathways mainly included ansamycin biosynthesis, lipopolysaccharide biosynthesis, pentose phosphate pathway, peptidoglycan biosynthesis, and D-alanine metabolism. Notably, the ICJ1 and ICJ3 groups showed a greater number of highly expressed metabolic pathways compared to the CK and negative control groups. These pathways were primarily concentrated in amino acid synthesis (Valine leucine and isoleucine biosynthesis), fatty acid biosynthesis (Fatty acid biosynthesis), C5-branched dibasic acid synthesis (C5-branched dibasic acid), pantothenate and acetyl-CoA synthesis (Pantothenate and CoA), pyruvate metabolism, and ketone body synthesis and degradation (Synthesis and degradation of ketone bodies). This suggests that Cordyceps fermentation products, as a feed additive, can increase the expression of metabolic pathways in the tilapia gut, contribute to the accumulation of beneficial metabolites, and promote the growth and development of tilapia.

[0104] (V) Correlation analysis between fermentation products and microbial flora

[0105] At the genus level, a correlation network diagram was created based on the abundance of intestinal microorganisms and fermentation products. Figure 13As shown in the figure, dashed and solid lines represent negative and positive correlations, respectively, and thick lines represent the strength of the correlation. The main positive correlation with the negative control group was with Aeromonas, a common pathogenic and antibiotic-resistant bacteria in aquatic life that affects the health of tilapia. Negative correlations were mainly with Clostridium_sensu_stricto_1 and Lactobacillus. Lactobacillus is a lactobacillus species known as a probiotic intestinal bacteria that can enhance the immunity of aquatic animals. It is speculated that the negative control group, as a feed additive, did not significantly improve the intestinal function of tilapia. The positive correlations with the ICJ group were mainly Lactobacillus, Capnocytophaga, Alloprevotella, Sungkyunkwania, Hydrogenophage, Dialister, Anoxybacillus, Paracoccus, Serratia, Mesorhizobium, Enhydrobacter, and Ralstonia. Among them, Lactobacillus is a Gram-positive bacterium under the family Lactobacillus of the phylum Firmicutes and has the strongest correlation with the ICJ group. It can digest and metabolize protein, regulate the balance of intestinal flora, promote food digestion and nutrient absorption, relieve intestinal inflammation and infection, and enhance immunity. Ralstonia can improve the diversity of intestinal microorganisms, produce short-chain fatty acids, especially butyrate, and can serve as an anti-inflammatory factor with anti-inflammatory properties. The negative correlation was primarily with Acidovorax (Acidovorax), indicating that the addition of GXU-7872 fermentation products can promote the growth of intestinal probiotics and improve the intestinal flora. Combined analysis of the negative control group and the ICJ group showed that the substrate fermented by entomogenous fungi was more effective in promoting the growth of probiotics, suggesting that Cordyceps sinensis exerts a significant regulatory effect on the bioactive components formed by the conversion of fermentation substrates, improving intestinal microbial diversity and protecting the intestinal health of tilapia.

[0106] Furthermore, the abundance of highly correlated strains of all bacterial genera in each treatment group was analyzed. Figure 14 As shown; the results showed that the beneficial bacteria genera Lactobacillus and Ralstonia were positively correlated with the ICJ group and were mainly concentrated in the ICJ3 group, and the remaining genera were evenly distributed in the ICJ1 group and ICJ3 group, indicating that the addition of high concentrations of GXU-7872 fermentation products was more conducive to the reproduction of beneficial bacteria.

[0107] Example 4 Effects on Tilapia Liver Metabolites

[0108] Metabolite Extraction: A sample of cryopreserved liver material was removed and freeze-dried under vacuum. The dried sample was ground using a grinder at 30 Hz for 1.5 minutes. 100 mg of the powder was weighed and extracted with 1.0 mL of 70% methanol containing 0.1 mg / L lidocaine as an internal standard at 4°C overnight, vortexing three times to ensure complete extraction. The sample was centrifuged for 10 minutes, and the supernatant was aspirated and filtered through a microporous filter (0.22 μm pore size). The sample was stored in an injection vial for subsequent LC-MS analysis.

[0109] Sample determination: Samples were separated using an Agilent 1290 Infinity LC ultra-high performance liquid chromatography system (UHPLC) HILIC column; column temperature 25°C; flow rate 0.5 mL / min; injection volume 2 μL; mobile phase composition A: water + 25 mM ammonium acetate + 25 mM ammonia, B: acetonitrile; samples were placed in an autosampler at 4°C throughout the analysis process.

[0110] (1) Effects on fatty acid and amino acid metabolites in tilapia liver

[0111] Through data analysis, a total of 2214 liver metabolites were obtained, including 91 fatty acid compounds and 385 amino acid compounds. Figure 15 Heat map analysis of the contents of the top 20 fatty acid and amino acid metabolites and fermentation products showed that compared with the CK group, in the ICJ1 group, Cis, cis-muconic acid, Octadecanoic acid, Cis-vaccenic acid, Dodecanoic acid, and Pentadecanoic acid had higher abundances than those in the other groups, while in the IC3 group, the abundance of fatty acid metabolites was significantly lower than that in the other groups, indicating that the addition of 3% GXU-7872 pure mycelium and 3% fermentation products can help reduce the accumulation of fatty acids and prevent the formation of fatty liver in tilapia.

[0112] (II) Correlation analysis between tilapia liver metabolites and microbial flora

[0113] Furthermore, Speraman analysis was used to conduct correlation analysis between the first 20 fatty acid metabolites in tilapia liver and the intestinal microbial genus level, such as Figure 16As shown in the data, the genera with strong positive correlations mainly include Alloprevotella, Hydrogenophaga, Staphylococcus, and Bradyrhizobium; the genera with strong negative correlations mainly include Acidovorax, Escherichia-Shigella, Bifidobacterium, and Cetobacterium. Escherichia-Shigella, Bifidobacterium, and Cetobacterium are beneficial intestinal bacteria that promote the metabolism of fatty acid compounds, alleviate fat accumulation in tilapia, and are not conducive to the formation of fatty liver. Correlation analysis between these bacterial genera and fermentation products was performed as shown in the figure. The positive correlation was mainly enriched in the ICJ1 group, indicating that the addition of fermentation products of strain GXU-7872 was beneficial to the reproduction of these bacterial genera and had a significant improvement on the decomposition of fatty acids. This was also consistent with the previous liver section results, which reduced fat vacuoles.

[0114] In summary, it can be seen that the fermentation product obtained by fermenting strain GXU-7872 using the technical solution of the present invention has a positive effect on the growth performance, liver antioxidant capacity and intestinal microbial diversity of fish, and has important reference value for the growth and health of fish.

[0115] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. A Cordyceps militaris strain GXU-7872, characterized in that: The taxonomic name is Cordyceps cicadae GXU-7872, deposited in the China Center for Type Culture Collection, the deposit date is May 7, 2025, the deposit address is Wuhan University, Wuhan, China, and the deposit number is CCTCC NO: M 2025988.

2. A fermentation product of the Cordyceps militaris strain GXU-7872 according to claim 1, characterized in that: The method is obtained by fermenting the Cordyceps militaris strain GXU-7872 according to claim 1.

3. Use of the fermentation product according to claim 2 in preparing aquatic feed.

4. An aquatic feed containing the fermentation product according to claim 2, characterized in that: The added amount of the fermentation product is 1-3 wt%.

5. Use of the fermentation product according to claim 2 or the aquatic feed according to claim 4 in promoting the growth and development of aquatic animals.

6. Use of the fermentation product according to claim 2 or the aquatic feed according to claim 4 for improving the antioxidant capacity of the liver of aquatic animals.

7. Use of the fermentation product according to claim 2 or the aquatic feed according to claim 4 in improving the intestinal state of aquatic animals.