Organic phosphate solubilizing bacterium and application thereof

Abstract

The invention discloses an organic phosphate solubilizing bacterium, which is Burkholderia sp. PF27, is preserved in the China Center for Type Culture Collection (CCTCC), has the preservation number of CCTCC NO: M 20232574, and is preserved on December 15, 2023. The organic phosphate solubilizing bacteria strain is separated and screened from rhizosphere soil of Ardisia japonica forest in Nanjing, has strong organic phosphorus degradation capability, has a phosphate solubilizing amount of 160.48 mg / L and a phosphate solubilizing rate of 36.36%, and can well grow in an environment with a pH value of 4-8. In addition, the strain has a relatively good growth promoting effect on crops, and has a very good application prospect in the aspects of degrading organic phosphorus and promoting the growth of the crops.

Description

Technical Field

[0001] The invention relates to an organic phosphate-solubilizing bacterium and application thereof, and belongs to the field of agriculture and biotechnology. Background Art

[0002] Phosphorus is an essential material for plant growth and development, and is a key component of ATP, nucleic acids, and various enzymes and coenzymes in plants. The phosphorus needed for crop growth and development primarily comes from fertilizers and soil.

[0003] Phosphorus in soil exists in both inorganic and organic forms. Organic phosphorus accounts for approximately 40%-50% of the total phosphorus in soil, primarily in the form of phytates, phospholipids, and organophosphates. Phytic acid, a major form of organic phosphorus, accounts for approximately 10%-50% of the total, while phospholipids contribute 1%-5%, and nucleotides 0.2%-2.5%. These forms cannot be directly absorbed and utilized by plants and must be converted into usable inorganic forms by microorganisms. Organophosphate-degrading microorganisms typically degrade phosphate enzymatically. Phytase produced by organophosphate bacteria degrades phytic acid in the soil, releasing phosphate, which is then absorbed and utilized by crops. Furthermore, soil phosphate bacteria can hydrolyze nucleotide-based organic phosphorus into phosphate and sugars through their own production of phosphatases. Phosphate provides phosphorus nutrition for crops, while sugars serve as energy sources. Therefore, utilizing phosphate-degrading microorganisms to improve plant phosphorus utilization is a key approach to addressing phosphorus deficiency. Although researchers at home and abroad have isolated a large number of phosphate-solubilizing microorganisms, providing a large number of bacterial resources for the preparation of phosphate-solubilizing microbial fertilizers, there is still a need to further screen out efficient phosphate-solubilizing bacteria to improve the conversion rate of insoluble phosphorus in the soil. Summary of the Invention

[0004] The purpose of the present invention is to solve the deficiencies of the prior art and provide an organic phosphate-solubilizing bacteria capable of improving the conversion rate of insoluble phosphorus in soil.

[0005] The technical solution adopted in the present invention is as follows: An organic phosphate-solubilizing bacterium, the organic phosphate-solubilizing bacterium is Burkholderia ( Burkholderia sp. )PF27, deposited in the China Center for Type Culture Collection, the deposit number is CCTCC NO:M 20232574, and the deposit date is December 15, 2023.

[0006] The organic phosphate-solubilizing bacteria strain of the present invention was isolated and screened from the rhizosphere soil of the forest of Zijin Mountain in Nanjing, Jiangsu Province. After microbial classification and identification, it was determined that the strain belonged to a new species of the genus Burkholderia and was named Burkholderia sp. PF27.

[0007] The application of the above-mentioned organic phosphate-solubilizing bacteria in degrading organic phosphorus.

[0008] The application of the above-mentioned organic phosphate-solubilizing bacteria in promoting the growth of crops.

[0009] Application method: Burkholderia sp. PF27 was inoculated into LB liquid medium and cultured at 28°C with shaking at 180 rpm for 37 h. The OD value of the bacterial solution was then adjusted. 600 0.8 (viable bacteria count 1× 10 9 CFU / mL) for future use. If using the bacterial solution as basal fertilizer, apply it to the soil using a sprayer or drip irrigation system at a soil temperature of 5-25°C, then cover the soil and apply it to the sowing area. If using it as a topdressing fertilizer, apply it directly to the roots of crops using surface irrigation pipes at a soil temperature of 5-25°C. For field application, a dosage of 100 L / mu (approximately 1000 liters) per application will achieve excellent phosphate solubilization and growth promotion results.

[0010] Beneficial effects of the present invention: The present invention provides an organic phosphate-solubilizing bacteria isolated from the rhizosphere soil of a Chinese fir in Zijin Mountain. Burkholderia sp. PF27, a strain with a strong ability to degrade organic phosphorus, can solubilize up to 160.48 mg / L, achieving a solubility rate of 36.36%. It also thrives in environments with a pH of 4-8. Furthermore, this strain can promote crop growth. In growth-promoting experiments, when the bacterial solution was applied to soil seeded with lettuce, the dry weight of the lettuce increased by over 8% after 30 days of planting, compared to the control. DETAILED DESCRIPTION

[0011] The technical solution of the present invention is clearly and completely described below in conjunction with specific embodiments.

[0012] In the following examples, the culture medium and formulations involved are as follows: (1) Egg yolk culture medium: 3 g beef extract, 10 g peptone, 16 g NaCl agar, 1000 mL distilled water, pH 7.0-7.2; sterilize the prepared culture medium and incubate at about 55 o Add 8-10 mL of fresh egg yolk liquid for every 100 mL of culture medium at about C (fresh eggs are soaked in 75% alcohol for 2-3 hours, the egg white is removed and the egg yolk is poured into a sterilized conical flask and mixed with an equal amount of physiological saline before use).

[0013] (2) Montgina organic phosphorus medium: glucose 10g, (NH4)2SO4 0.5g, NaCl 0.3 g, KCl 0.3 g, CaCO35 g, MgSO4·7H2O 0.3 g, FeSO4·7H2O 0.03 g, MnSO4·4H2O 0.03 g, lecithin 0.4 g, distilled water 1000 mL, pH 7.0~7.2.

[0014] (3) LB liquid medium: tryptone 10 g, yeast extract 5 g, NaCl 10 g, 1000 mL of distilled water, pH 7.0-7.2.

[0015] (4) LB solid medium: 10 g tryptone, 5 g yeast extract, NaCl 10 g, 15 g agar, 1000 mL distilled water, pH 7.0-7.2. For plate culture and slant storage.

[0016] Example 1 Screening of rhizosphere phosphate-solubilizing bacteria: Soil samples were collected from the rhizosphere soil of the Purple Mountain forest in Nanjing, Jiangsu Province. The collected soil samples were ground into powder using a mortar. 10 g of soil was weighed and added to 90 mL of sterile water. About 20 sterilized glass beads were added and shaken for 30 minutes. The samples were diluted 10-fold using a pipette. -4 , 10 -5 , 10 -6 , 10 -7 0.1 mL of each of the four diluted concentration samples was spread on an egg yolk medium plate, repeated three times, and cultured in an incubator at 28°C. The strains were taken out and observed for growth on days 2, 3, 4, 5, 6, and 7, and the number of colonies was recorded. Bacterial colonies with different morphologies, transparent circles, or good growth on the plate were randomly picked, and then further purified three times by the streak method on the egg yolk medium plate (rescreening). The strains that could continue to grow on the egg yolk medium plate were transferred to LB solid slant medium after purification.

[0017] Experimental results: After initial screening using egg yolk culture medium, 24 organic phosphate-solubilizing strains from forest rhizosphere soil were obtained. Subsequently, rescreening was carried out using plates coated with egg yolk culture medium, and 8 organic phosphate-solubilizing strains from forest rhizosphere soil were obtained, which were numbered Yousen 2-1, Yousen 2-3, Yousen 2-4, Yousen 2-5, Yousen 2-6, Yousen 2-7, Yousen 2-8, and Yousen 2-13.

[0018] Example 2 1. Preliminary determination of phosphate-solubilizing capacity using the phosphate-solubilizing zone method: The eight organic phosphate-solubilizing strains obtained in Example 1 were cultured on egg yolk culture plates. The diameter of the clear zone (D) and colony diameter (d) were measured on days 3-8 of culture, and the D / d ratio was calculated. The test results are shown in Table 1: Table 1 D / d values ​​of various organic phosphate-solubilizing bacteria from 3 to 8 days

[0019] As can be seen from Table 1, during the culture period, the D / d of strain Youjiang 2-7 was significantly greater than that of the other strains. Therefore, among the eight strains tested, strain Youjiang 2-7 was the best at dissolving organic phosphorus.

[0020] 2. Study on the quantitative phosphate solubilization ability under liquid culture conditions The 8 strains screened in Example 1 were first inoculated into LB liquid culture medium and cultured at 28°C, 180 rpm, and shaking for 37 h. The OD value of the bacterial solution was then adjusted. 600 0.8 (viable bacteria count 1× 10 9 CFU / mL), and then 10 μL was inoculated into a 150 mL Erlenmeyer flask containing 50 mL of Montana organophosphate medium (lecithin content 0.02g). The same volume of uninoculated Montana organophosphate medium was used as a control. Three replicates were set for each strain. After constant temperature and shaking culture at 28°C and 180 rpm for 72 h, the fermentation broth was centrifuged at 10,000 rpm for 10 min, and the supernatant was collected to determine the available phosphorus content and pH. The available phosphorus content was determined using the molybdenum antimony scandium colorimetric method, as follows: Molybdenum antimony scandium colorimetric method for determining soluble phosphorus concentration: Prepare phosphorus (K2HPO4) standard solutions with phosphorus contents of 0.0, 0.2, 0.4, 0.6, 0.8, and 1.0 mg / L, and measure their absorbance at a wavelength of 700 nm. Plot a standard curve with absorbance as the ordinate and phosphorus concentration as the abscissa. Filter the supernatant to be tested with a 0.22 μm filter membrane, recover the filtrate, take 5 mL of the filtrate and add it to a 50 mL volumetric flask. Dilute with water to approximately 3 / 5 of the total volume, add 1-2 drops of dinitrophenol indicator, adjust the solution to a slightly yellow color, add 5 mL of molybdenum antimony scandium colorimetric reagent, shake to volume, and measure its absorbance OD. 700 nm, calculate its phosphorus content according to the standard curve, and calculate the phosphorus solubility rate according to the following formula to determine its phosphorus solubility capacity.

[0021]

[0022] The results are shown in Table 2: Table 2 Phosphate solubilization effect of various phosphate solubilizing bacteria after 3 days of liquid shaking

[0023] Table 2 shows that after 3 days of culture in the Montkina organic phosphorus medium, the pH of the culture medium inoculated with the phosphorus-inoculating bacteria strains decreased to varying degrees compared with the control. As the pH decreased, the available phosphorus content in the culture medium increased, and the phosphorus solubility rate increased. Among them, the liquid culture medium of Sen 2-7 had the lowest pH of 4.01 and the highest available phosphorus content in the culture medium of 160.48 mg L -1 , the phosphate solubilization efficiency is also the highest, reaching 36.36%.

[0024] Example 3 Identification of strain Arisen 2-7: (1) Extraction of total bacterial DNA Strain Yousen 2-7 was inoculated into LB liquid medium and cultured with shaking for 24 hours. The cells were then centrifuged at 5000 rpm for 10 minutes and harvested. For every 30 mg of cells, 1 mL of cell lysis buffer was added to precipitate the pellet. 5 μL of lysozyme (50 mg / mL) was added, mixed, and incubated at 37°C for 20 minutes. 20 μL of proteinase K (20 mg / mL) was added, mixed, and incubated at 65°C for 1 hour. Extraction was performed with an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1), centrifuged at 12000 rpm for 10 minutes, and the supernatant was transferred to another centrifuge tube. The extraction was repeated once with an equal volume of chloroform:isoamyl alcohol (24:1), centrifuged at 12000 rpm for 10 minutes, and the supernatant was transferred to another centrifuge tube. 0.1 volume of sodium acetate solution (pH 5.2) and 2 volumes of anhydrous ethanol were added, mixed, and precipitated at -20°C for 2 hours. Centrifuge at 12000 r / min at 4℃ for 10 min, collect the precipitate, wash the precipitate with 70% ethanol, dry it, dissolve it in an appropriate amount of TE, and store it at -20℃ for later use.

[0025] (2) Using the extracted bacterial DNA as a template, amplify 16S rDNA using universal primers for bacterial 16S rDNA (forward primer 16Sf: AGAGTTTGATCCTGGCTCAG; reverse primer 16Sr: ACGGCTACCTTGTTACGACT). Reaction system 20 μL: 10× Buffer (MgCl2 2+ ) 2 μL, dNTPs (2.5 mmol / L) 1.5 μL, MgCl2 (25 mmol / L) 1.3 μL, primers (10 μmol / L) 1 μL each, Taq enzyme 0.15 μL, DNA template 1 μL, and ddH2O to 20 μL. PCR amplification protocol: denaturation at 94°C for 2 min; 30 cycles of denaturation at 94°C for 30 s, annealing at 52°C for 30 s, and extension at 72°C for 1.5 min; and extension at 72°C for 7 min. PCR products were run on a 2% agarose gel to check length and concentration and then sent to Nanjing Qingke Biotechnology Co., Ltd. for purification and sequencing.

[0026] The 16S rDNA sequence obtained by sequencing (see SEQ ID NO.1) was compared with BLAST on NCBI to find the related sequence with the highest homology in Genbank. Burkholderia sp. A15 (accession number KF479534.1), with a similarity of 99.80%, it was preliminarily determined that strains Yousen 2-7 were Burkholderia ( Burkholderia sp. ), named Burkholderia sp. PF27.

[0027] SEQ ID NO.1 16SrDNA sequence of Arisen 2-7

[0028] Example 4 strain Burkholderia sp. PF27 growth-promoting effect test: The test soil was yellow-brown soil with a soil organic matter content of 12.7 g / kg, alkaline nitrogen content of 83.20 mg / kg, total nitrogen content of 0.67 g / kg, available phosphorus content of 1.36 mg / kg, total phosphorus content of 0.65 g / kg, available potassium content of 115.84 mg / kg, and a pH of 7.17.

[0029] Preparation of phosphate-dissolving bacteria agent: First, prepare 150 mL of Burkholderia sp. The specific operation of PF27 seed solution is as follows: 150 mL of LB liquid medium is prepared in a 500 mL Erlenmeyer flask, autoclaved at 121°C for 30 minutes, cooled to 30-35°C, inoculated on a clean bench and cultured at 28°C and 180 r / min for 24 hours. After the culture is completed, the OD600 value is measured to be >1.2. At the end of the seed solution preparation, 1.5 L of LB medium is prepared in a 5L baffled Erlenmeyer flask, the bottle mouth is covered with 8 layers of gauze + kraft paper, autoclaved at 121°C for 30 minutes, cooled to 30-35°C, and after the seed solution is prepared, 75 mL of Burkholderia sp. PF27 seed solution was cultured at 28°C and 180 r / min for 24 hours. During this period, the shaking speed was increased by 10 rpm every 2 hours to a maximum of 220 r / min. The viable bacterial content reached 2.0×10 10 CFU / mL or above, that is, OD600 value>1.2, get Burkholderia sp. The fermentation broth of PF27 strain is a phosphate-solubilizing bacterial agent.

[0030] Preparation of inactivated fungicide: take the above Burkholderia sp. The fermentation broth of PF27 strain is sterilized at 121℃ for 30 minutes, and then resuspended when cooled to 30-35℃ to prevent the bacteria from precipitating and clumping. Sterility tests are performed by LB plate coating and LB liquid culture for 14 days each. Only after sterility is proven can it be used as an inactivated fungicide.

[0031] The experiment used a potted design with six treatments: no phosphorus application plus an inactivated fungicide (CK), no phosphorus application plus a phosphate-solubilizing agent (T1), application of 1 / 4 the conventional rate of phosphorus plus a phosphate-solubilizing agent (T2), application of 1 / 2 the conventional rate of phosphorus plus a phosphate-solubilizing agent (T3), application of a conventional rate of phosphorus plus a phosphate-solubilizing agent (T4), and application of a conventional rate of phosphorus plus an inactivated fungicide (T5). Each treatment was replicated four times. Fertilization was applied to each treatment under conditions of equal nitrogen and potassium nutrient availability. Each pot contained 8 kg of soil and the fertilizers used were urea (containing 46% N), superphosphate (containing 12% P2O5), and potassium sulfate (containing 42% K2O). Specific fertilizer rates for each treatment are shown in Table 3. Table 3 Fertilizer dosage for each treatment

[0032] The above fertilizers were applied as basal fertilizers, mixed with the soil, and applied once. Lettuce seeds were year-round bolting-resistant, purchased from Jiangsu Mingtian Seed Co., Ltd. The phosphate-solubilizing agent was inoculated at 50 mL per head of lettuce, along with 50 mL of inactivated fungicide per head. The phosphate-solubilizing agent was applied around the roots after transplanting. Each treatment group had five pots, with two lettuces planted per pot. The replicates were randomly arranged and managed uniformly. Lettuce was transplanted 15 days after germination. Rapeseed seedlings with consistent growth were selected for uniform transplanting. Bacterial solution treatment was applied three days after transplanting. Harvest was completed 20 days after treatment, and the fresh weight of the lettuce and the available phosphorus content in the rhizosphere soil were measured for each treatment.

[0033] The experimental results are shown in Table 4: Table 4 Fresh weight and phosphorus content of lettuce, available phosphorus content in soil, changes in available phosphorus in the lettuce-soil system, and average yield increase of lettuce under each treatment 20 days after transplanting

[0034] The results in Table 4 show that, in the absence of phosphate fertilizer, application of a phosphate-solubilizing bacteria solution significantly increased lettuce yield by 10.6%. With the phosphate-solubilizing bacteria solution, lettuce yield increased with increasing phosphate fertilizer application rates. When the phosphate fertilizer application rate reached half the conventional rate (T3), the yield per lettuce plant stabilized, showing no significant difference from conventional phosphate fertilizer application, and a 55.3% increase over the control (CK) treatment. Furthermore, with the same phosphate application rate, there was no significant difference between the T4 and T5 treatments. This indicates that the application of a phosphate-solubilizing bacteria solution can effectively replace phosphate fertilizer, contributing to reduced chemical fertilizer use. Furthermore, Table 4 shows that the change in available phosphorus in the lettuce-soil system increased with increasing phosphate fertilizer application rates, indicating that changes in available phosphorus in the soil reservoir throughout the lettuce growth period are closely related to the application of phosphate fertilizer. In the two phosphorus-free treatments, CK and T1, the change in available phosphorus in the lettuce-soil system in T1 was significantly higher than that in CK. In the two full phosphorus application treatments, T4 and T5, the change in available phosphorus in the soil-crop system in T4 was significantly higher than that in T5, but the increase was relatively smaller. There was no significant difference in the change in available phosphorus in the lettuce-soil system between T3 and T5. However, the amount of phosphorus fertilizer applied in T3 was only 1 / 2 of that in T5, indicating that phosphate-solubilizing bacteria can more effectively promote the release of available phosphorus in the soil when the available phosphorus content in the soil is low, thereby promoting the accumulation of available phosphorus in the soil pool, while this promoting effect is weakened when the available phosphorus content in the soil is relatively rich.

Claims

1. An organic phosphate-solubilizing bacterium, characterized in that: The organic phosphate-solubilizing bacteria is Burkholderia ( Burkholderia sp. )PF27, deposited in the China Center for Type Culture Collection, the deposit number is CCTCC NO:M 20232574, and the deposit date is December 15, 2023.

2. Use of the organic phosphate-solubilizing bacteria according to claim 1 in degrading organic phosphorus.

3. Use of the organic phosphate-solubilizing bacteria according to claim 1 in promoting the growth of crops.

Images