Organic phosphorus-degrading bacteria and application thereof

Abstract

The application discloses an organic phosphorus-degrading bacterium, which is Burkholderia (B. Burkholderia sp. ) PF27, which is preserved in the China Center for Type Culture Collection (CCTCC) and has a preservation number of CCTCC NO: M 20232574 and a preservation date of December 15, 2023. The organic phosphorus-degrading bacterium strain is screened from rhizosphere soil in Nanjing Zijinshan forest, has strong organic phosphorus degradation capability, and has a phosphorus-degrading amount of 160.48 mg / L and a phosphorus-degrading rate of 36.36%. In addition, the strain has good growth in a pH 4-8 environment. In addition, the strain has good growth-promoting effect on crops, and has good application prospect in the aspects of degrading organic phosphorus and promoting crop growth.

Description

Technical Field

[0001] This invention relates to an organic phosphate-solubilizing bacterium and its applications, belonging to the fields of agriculture and biotechnology. Background Technology

[0002] Phosphorus is an essential material basis for plant growth and development, and is a crucial component of ATP, nucleic acids, and various enzymes and coenzymes within plants. The phosphorus required for crop growth and development mainly comes from fertilizers and soil.

[0003] Phosphorus in soil exists in both inorganic and organic forms. Organic phosphorus accounts for approximately 40%-50% of total phosphorus in soil, mainly in the form of phytates, phospholipids, and organophosphates. Phytic acid accounts for about 10%-50% of organic phosphorus and is a significant form, while phospholipids account for 1%-5% and nucleotides for 0.2%-2.5%. These cannot be directly absorbed and utilized by plants; they must be converted into usable inorganic forms by microorganisms before absorption. The phosphorus-solubilizing mechanism of organophosphate-solubilizing microorganisms is mostly enzymatic. Phytic acid-based organic phosphorus in the soil can be decomposed by phytase produced by organophosphate bacteria, releasing phosphate, which can then be absorbed and utilized by crops. In addition, phosphorus-solubilizing bacteria in the soil can hydrolyze nucleic acid-based organic phosphorus into phosphate and sugars using phosphatases produced by themselves. Phosphate provides phosphorus nutrition to crops, while sugars can serve as energy sources. Therefore, utilizing phosphorus-solubilizing microorganisms to improve the utilization rate of phosphorus by plants is a key approach to solving the phosphorus deficiency problem. Although researchers at home and abroad have isolated a large number of phosphorus-solubilizing microorganisms, providing a large number of strains for the preparation of phosphorus-solubilizing microbial fertilizers, it is still necessary to further screen for highly efficient phosphorus-solubilizing bacteria to improve the conversion rate of insoluble phosphorus in the soil. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings of the prior art and provide an organic phosphorus-solubilizing bacterium that can improve the conversion rate of insoluble phosphorus in soil.

[0005] The technical solution adopted in this invention is as follows:

[0006] An organic phosphate-solubilizing bacterium, wherein the organic phosphate-solubilizing bacterium is Burkholderia (… Burkholderia sp. PF27, deposited at the China Center for Type Culture Collection, accession number CCTCC NO:M 20232574, on December 15, 2023.

[0007] The organic phosphate-solubilizing bacteria strain of this invention was isolated and screened from the rhizosphere soil of the Zijin Mountain forest in Nanjing, Jiangsu Province. Microbiological classification and identification confirmed that this strain belongs to a new species of the genus Burkholderia, and it was named... Burkholderia sp. PF27.

[0008] The above-mentioned organic phosphorus-solubilizing bacteria are used in the degradation of organic phosphorus.

[0009] The above-mentioned organic phosphate-solubilizing bacteria are used to promote crop growth.

[0010] Application method: Burkholderia sp. PF27 was inoculated into LB liquid medium and cultured at 28°C with shaking at 180 r / min for 37 h, then the OD of the bacterial culture was adjusted. 600 The value was 0.8 (1 × 10⁸ viable bacteria). 9 (CFU / mL) Prepare for use; if using this bacterial solution as a base fertilizer, apply it to the soil using sprinklers or drip irrigation at a soil temperature of 5-25℃ and cover with soil, applying to the sowing area; if using it as a top dressing, it can be directly sprayed onto the crop roots using ground pipes at a soil temperature of 5-25℃. When applying in the field, the dosage of the above bacterial solution is 100L / acre / time, which can achieve good phosphorus solubilization and growth-promoting effects.

[0011] Beneficial effects of the present invention: The present invention provides an organic phosphate-solubilizing bacterium isolated from the rhizosphere soil of *Cunninghamia lanceolata*. Burkholderia sp. PF27 is a strain with a strong ability to degrade organic phosphorus, achieving a phosphorus solubility of 160.48 mg / L and a phosphorus solubility rate of 36.36%. It also grows well in environments with a pH of 4–8. Furthermore, this strain can promote crop growth. In a growth-promoting experiment, when the bacterial solution was applied to the soil where lettuce was sown, the dry weight of the lettuce increased by more than 8% compared to the control group after 30 days of planting. Detailed Implementation

[0012] The technical solution of the present invention will be clearly and completely described below with reference to specific embodiments.

[0013] The culture media and formulations involved in the following examples are as follows:

[0014] (1) Egg yolk culture medium: 3 g beef extract, 10 g peptone, 16 g NaCl agar, 1000 mL distilled water, pH 7.0~7.2; after sterilizing the prepared culture medium, incubate at approximately 55°C. o Add 8-10 mL of fresh egg yolk liquid to every 100 mL of culture medium at around C (soak fresh eggs in 75% alcohol for 2-3 hours, remove the egg white, pour the egg yolk into a sterilized Erlenmeyer flask, and mix with an equal volume of physiological saline before use).

[0015] (2) Monkina Organic Phosphorus Medium: 10g glucose, 0.5g (NH4)2SO4, NaCl 0.3 g, KCl 0.3g, CaCO3 5g, MgSO4·7H2O 0.3g, FeSO4·7H2O 0.03g, MnSO4·4H2O 0.03g, lecithin 0.4g, distilled water 1000 mL, pH 7.0~7.2.

[0016] (3) LB liquid medium: 10 g tryptone, 5 g yeast extract, NaCl 10 g, 1000 mL distilled water, pH 7.0–7.2.

[0017] (4) LB solid medium: 10 g tryptone, 5 g yeast extract, NaCl 10 g of agar, 15 g of agar, 1000 mL of distilled water, pH 7.0–7.2. Used for plate culture and slant preservation.

[0018] Example 1

[0019] Screening of phosphate-solubilizing bacteria in the rhizosphere:

[0020] Soil samples were collected from rhizosphere soil in the Zijin Mountain forest in Nanjing, Jiangsu Province. The collected soil samples were finely ground using a mortar and pestle. 10 g of soil was weighed and added to 90 mL of sterile water, followed by approximately 20 sterile glass beads. The mixture was shaken for 30 minutes and then diluted 10-fold. 10 g of the sample was pipetted into the solution. -4 10 -5 10 -6 10 -7 Four dilutions of the sample, each 0.1 mL, were spread onto egg yolk agar plates, repeated three times. The plates were incubated upside down at 28°C. The plates were removed on days 2, 3, 4, 5, 6, and 7 to observe growth and record the number of colonies. Colonies with distinct morphology and clear zones or good growth were randomly selected from the plates and further purified three times on egg yolk agar plates using the streak method (rescreening). The strains that could continue to grow on egg yolk agar plates were then transferred to LB solid slant agar.

[0021] Experimental results: After initial screening using egg yolk medium, 24 organic phosphorus-solubilizing bacteria from forest rhizosphere soil were obtained. Subsequent screening using plates refractory to egg yolk medium yielded 8 organic phosphorus-solubilizing bacteria from forest rhizosphere soil, numbered as Yousen 2-1, Yousen 2-3, Yousen 2-4, Yousen 2-5, Yousen 2-6, Yousen 2-7, Yousen 2-8, and Yousen 2-13.

[0022] Example 2

[0023] 1. Preliminary determination of phosphorus-solubilizing ability using the phosphorus-solubilizing zone method: The eight organic phosphorus-solubilizing strains obtained in Example 1 were cultured on egg yolk medium plates. The diameter of the clear zone (D) and the diameter of the colony (d) were measured from day 3 to day 8, and the D / d value was calculated. The test results are shown in Table 1:

[0024] Table 1. D / d values ​​of various organic phosphate-solubilizing bacteria at 3-8 days

[0025]

[0026] Table 1 shows that during the culture period, the D / d ratio of strain Jiang 2-7 was consistently significantly higher than that of other strains. Therefore, among the eight tested strains, strain Jiang 2-7 exhibited the best performance in dissolving organophosphates.

[0027] 2. Study on quantitative phosphorus solubility under liquid culture conditions

[0028] The eight bacterial strains screened in Example 1 were first inoculated into LB liquid medium and cultured at 28°C with shaking at 180 r / min for 37 h. Then the OD of the bacterial culture was adjusted. 600 The value was 0.8 (1 × 10⁸ viable bacteria). 9 (CFU / mL) Then, 10 μL was inoculated into a 150 mL Erlenmeyer flask containing 50 mL of Monkina organic phosphorus medium (lecithin content 0.02 g). An equal volume of uninoculated Monkina organic phosphorus medium was used as a control. Each strain was incubated in triplicate. The cultures were incubated at 28℃ with shaking at 180 r / min for 72 h. Afterward, the fermentation broth was centrifuged at 10000 r / min for 10 min, and the supernatant was used to determine the available phosphorus content and pH. The available phosphorus content was determined using the molybdenum-antimony-scandium colorimetric method, the specific method of which is as follows:

[0029] The method for determining soluble phosphorus concentration using the molybdenum-antimony-scandium colorimetric method is as follows: Prepare standard solutions of phosphorus (K₂HPO₄) with phosphorus concentrations of 0.0, 0.2, 0.4, 0.6, 0.8, and 1.0 mg / L. Measure the absorbance at 700 nm. Plot a standard curve with absorbance as the ordinate and phosphorus concentration as the abscissa. Filter the supernatant to be tested through a 0.22 μm filter membrane, recover the filtrate, and add 5 mL of the filtrate to a 50 mL volumetric flask. Dilute with water to approximately 3 / 5 of the total volume. Add 1-2 drops of dinitrophenol indicator to adjust the solution to a slightly yellow color. Add 5 mL of molybdenum-antimony-scandium colorimetric reagent, shake well, and dilute to volume. Measure the absorbance OD. 700 nm, calculate its phosphorus content according to the standard curve, and calculate the phosphorus solubility rate according to the following formula to determine its phosphorus solubility.

[0030]

[0031] The results are shown in Table 2:

[0032] Table 2. Phosphate-solubilizing effects of various phosphate-solubilizing bacteria after 3 days of liquid shaking.

[0033]

[0034] Table 2 shows that after 3 days of culture on the Monkina organic phosphorus medium, compared with the control, the pH of the culture medium inoculated with phosphate-inoculating bacteria decreased to varying degrees. Furthermore, as the pH decreased, the available phosphorus content in the culture medium increased, and the phosphorus solubility rate increased. Among them, the liquid medium of Yusen 2-7 had the lowest pH (4.01) and the highest available phosphorus content (160.48 mg / L). -1 It also has the highest phosphorus solubility, reaching 36.36%.

[0035] Example 3

[0036] Strain identification of Yusen 2-7:

[0037] (1) Extraction of total bacterial DNA

[0038] Strain Yusen 2-7 was inoculated into LB liquid medium and cultured with shaking for 24 h. The cells were collected by centrifugation at 5000 r / min for 10 min. 1 mL of cell lysis buffer was added to each 30 mg of cells to resuspend the precipitate. 5 μL of lysozyme (50 mg / mL) was added, mixed, and incubated at 37℃ for 20 min. 20 μL of proteinase K (20 mg / mL) was added, mixed, and incubated at 65℃ for 1 h. Extraction was performed using an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1), centrifuged at 12000 r / min for 10 min, and the supernatant was collected in another centrifuge tube. This extraction was repeated once. Extraction was performed once more using an equal volume of chloroform:isoamyl alcohol (24:1), centrifuged at 12000 r / min for 10 min, and the supernatant was collected in another centrifuge tube. 0.1 volume of sodium acetate solution (pH 5.2) and 2 volumes of anhydrous ethanol were added, mixed, and the mixture was incubated at -20℃ for 2 h. Centrifuge at 12000 r / min for 10 min at 4℃, collect the precipitate, wash the precipitate with 70% ethanol, dry it and dissolve it in an appropriate amount of TE, and store it at -20℃ for later use.

[0039] (2) Using the extracted bacterial DNA as a template, 16S rDNA was amplified using universal primers for bacterial 16S rDNA (forward primer 16Sf: AGAGTTTGATCCTGGCTCAG; reverse primer 16Sr: ACGGCTACCTTGTTACGACT). The reaction mixture consisted of 20 μL of 10×Buffer (Mg... 2+2 μL of dNTP (2.5 mmol / L), 1.5 μL of MgCl2 (25 mmol / L), 1.3 μL of primers (10 μmol / L), 1 μL of Taq enzyme, 0.15 μL of DNA template, and ddH2O to a final volume of 20 μL. PCR amplification program: 94℃ denaturation for 2 min; 94℃ denaturation for 30 s, 52℃ annealing for 30 s, 72℃ extension for 1.5 min, for a total of 30 cycles; 72℃ extension for 7 min. The PCR products were electrophoresed on a 2% agarose gel to determine their length and concentration, and then sent to Nanjing Qingke Biotechnology Co., Ltd. for purification and sequencing.

[0040] The 16S rDNA sequence obtained from sequencing (see SEQ ID NO.1) was BLAST-aligned on NCBI to find the most homologous sequence in GenBank. The similar strains were... Burkholderia sp. A15 (accession number KF479534.1) showed a similarity of 99.80%, therefore strains 2-7 were preliminarily identified as Burkholderia (…). Burkholderia sp. ), named Burkholderia sp. PF27.

[0041] SEQ ID NO.1 16SrDNA sequence of Arisen 2-7

[0042]

[0043] Example 4

[0044] strains Burkholderia sp. PF27 growth-promoting effect test:

[0045] The tested soil was yellow-brown soil, with an organic matter content of 12.7 g / kg, available nitrogen content of 83.20 mg / kg, total nitrogen content of 0.67 g / kg, available phosphorus content of 1.36 mg / kg, total phosphorus content of 0.65 g / kg, available potassium content of 115.84 mg / kg, and pH of 7.17.

[0046] Preparation of phosphate-solubilizing bacteria: First, prepare 150 mL of the solution in a 500 mL Erlenmeyer flask. Burkholderia sp. The specific procedure for preparing the PF27 seed culture is as follows: Prepare 150 mL of LB liquid medium in a 500 mL Erlenmeyer flask, autoclave at 121°C for 30 minutes, cool to 30-35°C, inoculate in a clean bench, and incubate at 28°C and 180 r / min for 24 hours. After incubation, measure the OD600 value to be >1.2. Simultaneously, in the later stages of seed culture preparation, prepare 1.5 L of LB medium in a 5L baffled Erlenmeyer flask, cover the flask opening with 8 layers of gauze and kraft paper, autoclave at 121°C for 30 minutes, cool to 30-35°C, and inoculate 75 mL of the prepared seed culture. Burkholderia sp. PF27 seed culture was cultured at 28℃ and 180 r / min for 24 hours, with the shaking speed increased by 10 rpm every 2 hours, up to a maximum of 220 r / min. The viable cell count reached 2.0 × 10⁻⁶. 10 CFU / mL or higher, i.e., OD600 value > 1.2, indicates that... Burkholderia sp. The fermentation broth of PF27 strain is a phosphate-solubilizing agent.

[0047] Preparation of inactivating agent: Take the above... Burkholderia sp. The fermentation broth of strain PF27 was sterilized at 121 °C for 30 min, and then resuspended at 30-35 °C to prevent cell precipitation and clumping. Sterility tests were performed by LB agar plating and LB liquid incubation for 14 days each to prove sterility before it could be used as an inactivating agent.

[0048] The experiment used a pot design with six treatments: no phosphorus + inactivated fungicide (CK), no phosphorus + phosphate-solubilizing fungicide (T1), 1 / 4 of the conventional amount of phosphorus + phosphate-solubilizing fungicide (T2), 1 / 2 of the conventional amount of phosphorus + phosphate-solubilizing fungicide (T3), conventional amount of phosphorus + phosphate-solubilizing fungicide (T4), and conventional amount of phosphorus + inactivated fungicide (T5). Each treatment was replicated four times. Fertilizers were applied under isonitrogen and potassium nutrient conditions. Each pot contained 8 kg of soil, and the fertilizers used were urea (containing 46% N), superphosphate (containing 12% P2O5), and potassium sulfate (containing 42% K2O). Specific fertilizer application rates for each treatment are shown in Table 3.

[0049] Table 3 Fertilizer application rates for each treatment

[0050]

[0051] The above fertilizers were applied as base fertilizer, mixed into the soil once. The lettuce seeds were year-round bolting resistant lettuce, purchased from Jiangsu Mingtian Seed Industry Co., Ltd. The inoculation amount of phosphate-solubilizing bacteria was 50 mL per lettuce plant, and the inactivation agent was also 50 mL per plant. The phosphate-solubilizing bacteria were applied around the roots after transplanting. Each treatment group consisted of 5 pots, with 2 lettuce plants per pot, randomly arranged between replicates and managed uniformly. Lettuce was transplanted 15 days after germination, selecting uniformly growing lettuce seedlings for transplanting. The bacterial solution was applied 3 days after transplanting to stabilize the plants. Harvesting was conducted 20 days after treatment, and the fresh weight of the lettuce and the available phosphorus content in the rhizosphere soil were measured for each treatment.

[0052] The experimental results are shown in Table 4:

[0053] Table 4. Fresh weight and phosphorus content of lettuce under each treatment, available phosphorus content in the soil, changes in available phosphorus in the lettuce-soil system, and average yield increase of lettuce 20 days after transplanting.

[0054]

[0055] Table 4 shows that, without phosphate fertilizer, the application of phosphate-solubilizing bacteria solution significantly increased lettuce yield by 10.6%. With phosphate-solubilizing bacteria solution, lettuce yield increased with increasing phosphate fertilizer application. When the phosphate fertilizer application reached half the conventional amount (T3), the lettuce yield per plant stabilized, showing no significant difference from the conventional phosphate fertilizer application, but still representing a 55.3% increase compared to the control (CK). Simultaneously, under the same phosphate application rate, there was no significant difference between treatments T4 and T5. This indicates that the application of phosphate-solubilizing bacteria solution can effectively replace phosphate fertilizer, contributing to fertilizer reduction. Furthermore, Table 4 shows that with increasing phosphate fertilizer application, the change in available phosphorus in the lettuce-soil system also increased, indicating that the change in available phosphorus in the soil pool throughout the lettuce's growth period is closely related to phosphate fertilizer application. In the two treatments without phosphorus application (CK and T1), the change in available phosphorus in the lettuce-soil system was significantly higher in treatment T1 than in CK. In the two treatments with full phosphorus application (T4 and T5), the change in available phosphorus in the soil-crop system was significantly higher in treatment T4 than in treatment T5, but the increase was relatively smaller. There was no significant difference in the change in available phosphorus in the lettuce-soil system between treatments T3 and T5, but the amount of phosphate fertilizer applied in treatment T3 was only half that in treatment T5. This indicates that phosphate-solubilizing bacteria can more effectively promote the release of available phosphorus in the soil when the available phosphorus content is low, thereby promoting the accumulation of available phosphorus in the soil pool. However, this promoting effect is weakened when the available phosphorus content in the soil is relatively high.

Claims

1. An organic phosphate-solubilizing bacterium, characterized in that, The organic phosphate-solubilizing bacteria are Burkholderia (… Burkholderia sp. PF27, deposited at the China Center for Type Culture Collection, accession number CCTCC NO:M 20232574, on December 15, 2023.

2. The application of the organic phosphorus-solubilizing bacteria of claim 1 in the degradation of organophosphates.

3. The application of the organic phosphate-solubilizing bacteria of claim 1 in promoting lettuce growth.

Images