Escherichia coli for producing nylon 12 monomer as well as construction method and application of escherichia coli

Abstract

The invention provides Escherichia coli for producing a nylon 12 monomer. The genotypes of the Escherichia coli are as follows: tesA: PtluxR-PluxluxIUcfatB, adhE: PtluxR-PluxluxIUcfatB, fadE: PluxCYP153A-BM3, pgi: PluxCYP153A-BM3, aldB: PluxCYP153A-BM3, and gabD: PM12CV2025BsADH. The invention also provides a preparation method of the Escherichia coli. The genotypes of the Escherichia coli are as follows: tetluxR: PtluxR: PluxluxIUcfatB, adhE: The invention further provides a construction method of the escherichia coli for producing the nylon 12 monomer, a self-induction system in the escherichia coli is constructed by utilizing a Lu xI / R quorum sensing system in vibrio fischeri, and the synthesis rate of AHL is slowed down, so that the self-induction expression of the gene is realized. An engineering escherichia coli strain is constructed based on an established self-induction system, self-induction synthesis of the nylon 12 monomer can be realized, cell growth and product synthesis are balanced, and synthesis of the nylon 12 monomer from glucose is realized.

Description

Technical Field

[0001] The present invention belongs to the technical field of microbial engineering, and in particular relates to an Escherichia coli for producing nylon 12 monomer, a construction method thereof, and an application thereof. Background Art

[0002] Escherichia coli is widely used in fields such as enzyme engineering, metabolic engineering and pharmaceutical engineering, and is the most commonly used strain in genetic engineering. At present, the genetic modification strategy commonly used in Escherichia coli is mainly to carry out static regulation through gene overexpression and gene knockout. Although these strategies have improved the production performance of the strain to a certain extent, they are usually unable to balance the growth of the strain and the synthesis of the target product. In addition, although the inducible promoter commonly used in Escherichia coli can achieve the balance of growth and production to a certain extent, due to the expensive and toxic inducer, it is restricted in the large-scale production process. Therefore, it is necessary to develop a dynamic control element with wide adaptability to adapt to different industrial production processes.

[0003] Quorum sensing is a system in which microorganisms regulate the expression of related genes. Its inducer is a signaling molecule secreted by the microorganism itself. As the microorganism grows and its population density increases, the concentration of the inducer accumulates. When the inducer concentration reaches a threshold, the expression of the relevant genes is induced. Quorum sensing systems vary among microorganisms. For example, the LuxI / LuxR system in Vibrio fischeri: as cell density increases, the amount of the signaling molecule acylhomoserine lactone (AHL) synthesized by the signaling molecule synthase LuxI increases. AHL freely enters and exits the cell along a concentration gradient, accumulating inside and outside the cell. When the AHL concentration reaches a certain threshold, AHL binds to the signaling molecule binding protein LuxR, forming a LuxR-AHL dimer. This dimer acts as an activator of the promoter Plux, thereby activating transcription of genes controlled by Plux.

[0004] Due to its good heat resistance, wear resistance, chemical resistance, UV resistance and scratch resistance, nylon 12 is widely used in the processing and manufacturing of pipes and automotive parts. At present, the industrial production process of nylon 12 monomer is synthesized from butadiene through a series of steps such as trimerization, catalytic hydrogenation, oxidation, ketoneization, and Beckmann rearrangement (opening of the N double bond and addition of groups). Butadiene is produced by crude oil refining. Due to the non-renewable nature of crude oil and the environmental damage caused by chemical production, the chemical synthesis process of 12 nylon is limited. Therefore, it is necessary to develop an environmentally friendly, green and renewable 12 nylon monomer synthesis process. Currently, mild reaction conditions and environmentally friendly biosynthesis processes are highly favored.

[0005] Heterologous synthesis of nylon 12 monomers in Escherichia coli requires the expression of four additional enzymes: 1. The lauroyl-ACP thioesterase (UcfatB) converts acetyl-CoA to dodecanoic acid; 2. Dodecanoic acid is converted to 12-hydroxy-12-alkanoic acid under the catalysis of the cytochrome P450 enzyme (CYP153A-BM3); 3. 12-hydroxy-12-alkanoic acid is finally converted to nylon 12 monomers through the action of dehydrogenase (BsADH) and transaminase (CV2025). However, intracellular acetyl-CoA is a critical precursor for cell growth. Premature initiation of nylon 12 monomer synthesis will result in insufficient acetyl-CoA for growth, thus affecting cell growth. Summary of the Invention

[0006] The purpose of the present invention is to overcome the problem in the prior art that prematurely starting the synthesis of nylon 12 monomers will lead to insufficient acetyl-CoA for growth in cells, thereby affecting cell growth.

[0007] To this end, the present invention provides an Escherichia coli for producing nylon 12 monomer, wherein the genotype of the Escherichia coli is tesA::P tet _luxR-P lux _luxI_UcfatB, adhE::P tet _luxR-P lu x _luxI_UcfatB, fadE::P lux _CYP153A-BM3, pgi::P lux _CYP153A-BM3, aldB::P lux _CYP153A-BM3, gabD::P M12 _CV2025_BsADH;

[0008] Among them, the P lux The nucleotide sequence of luxI is shown in SEQ ID NO 1; the nucleotide sequence of luxR is shown in SEQ ID NO 3; the P tet The nucleotide sequence of P is shown in SEQ ID NO 4; M12 The nucleotide sequence of is shown as SEQ ID NO 5; the nucleotide sequence of UcfatB is shown as SEQ ID NO 6; the nucleotide sequence of CYP153A-BM3 is shown as SEQ ID NO 7; the nucleotide sequence of CV2025 is shown as SEQ ID NO 8; and the nucleotide sequence of BsADH is shown as SEQ ID NO 9.

[0009] The present invention also provides a method for constructing Escherichia coli for producing nylon 12 monomer, comprising the following steps:

[0010] (1) Integrate the luxI, luxR, and UcfatB genes and the promoters that control their expression into the tesA gene locus of the Escherichia coli genome to construct strain M22;

[0011] (2) Based on the M22 strain, the same sequence as in step (1) was integrated into the ad hE gene locus to obtain strain M73;

[0012] (3) Based on the M73 strain, CYP153A-BM3 and the promoter controlling CYP153A-BM3 expression were integrated into the fadE site of Escherichia coli to obtain strain M209;

[0013] (4) Based on the M209 strain, the CYP153A-BM3 encoding gene and the promoter controlling CYP153A-BM3 expression were integrated into the aldB site and pgi site of Escherichia coli to obtain strain M210;

[0014] (5) Based on the M210 strain, the genes encoding BsADH and CV2025 and the promoters controlling the expression of BsADH and CV2025 were integrated into the gabD site of Escherichia coli to obtain Escherichia coli that produces nylon 12 monomers.

[0015] Specifically, the promoter for controlling the expression of luxI and UcfatB in the above step (1) is selected from P lux ; The promoter controlling luxR expression is selected from P tet .

[0016] Specifically, the promoter for controlling the expression of CYP153A-BM3 in the above steps (3) and (4) is selected from P lux .

[0017] Specifically, the promoter for controlling the expression of BsADH and CV2025 in the above step (5) is selected from P M12 .

[0018] The present invention also provides a method for producing nylon 12 monomer, comprising inoculating the above-mentioned Escherichia coli for producing nylon 12 monomer into a culture medium for fermentation, and collecting the nylon 12 monomer in the fermentation product.

[0019] Specifically, the culture medium is a TB medium additionally containing 4-40 g / L glucose, 0.1-1 g / L ferrous sulfate heptahydrate, 5-50 mM 5-aminolevulinic acid hydrochloride, 50-500 mM L-alanine, and 0.1-1 mM pyridoxal-5-phosphate.

[0020] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0021] The Escherichia coli for producing nylon 12 monomer provided by the present invention can produce nylon 12 monomer from glucose through shake flask fermentation, and the yield can reach more than 100 mg / L.

[0022] The construction method provided by the present invention utilizes the LuxI / R quorum sensing system in Vibrio fischeri to construct an autoinduction system in Escherichia coli, slowing the synthesis rate of AHLs, thereby achieving autoinduced gene expression. The engineered E. coli strain constructed based on the established autoinduction system can achieve autoinduced synthesis of nylon 12 monomers, balancing cell growth and product synthesis, and achieving the synthesis of nylon 12 monomers from glucose. DETAILED DESCRIPTION

[0023] The technical solutions of the present invention will be clearly and completely described below in conjunction with the embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Although the representative embodiments of the present invention have been described in detail, it will be understood by those skilled in the art that various modifications and changes can be made to the present invention without departing from the scope of the present invention. Therefore, the scope of the present invention should not be limited to the embodiments, but should be defined by the appended claims and their equivalents.

[0024] The effects of the Escherichia coli for producing nylon 12 monomer and the construction method thereof of the present invention are studied below through specific examples.

[0025] Example 1:

[0026] The method for constructing Escherichia coli for producing nylon 12 monomer based on the quorum sensing system of this embodiment includes the following steps:

[0027] (1) The luxI, luxR, and UcfatB genes and the promoters that control their expression were integrated into the tesA gene site of the Escherichia coli genome to construct strain M22 with the genotype tesA::P tet _luxR-P lux _luxI_UcfatB;

[0028] The promoters controlling the expression of luxI and UcfatB were selected from P lux ; The promoter controlling luxR expression is selected from P tet .

[0029] (2) Based on the M22 strain, the same sequence as in step (1) was integrated into the adhE gene locus to obtain strain M73, with a genotype of tesA::P tet _luxR-P lux_luxI_UcfatB, adhE::P tet _luxR-P lux _luxI_UcfatB;

[0030] (3) Based on the M73 strain, the cytochrome P450 enzyme (CYP153A-BM3) encoding gene and the promoter controlling CYP153A-BM3 expression were integrated into the fadE site of Escherichia coli to obtain strain M209 with the genotype of tesA::P tet _luxR-P lux _luxI_UcfatB, adhE::P tet _luxR-P lux _luxI_UcfatB, fadE::P lux _CYP153A-BM3;

[0031] The promoter controlling the expression of CYP153A-BM3 was selected from P lux .

[0032] (4) Based on the M209 strain, the CYP153A-BM3 encoding gene and the promoter controlling CYP153A-BM3 expression were integrated into the aldB site and pgi site of Escherichia coli to obtain strain M210 with the genotype of tesA::P tet _luxR-P lux _luxI_UcfatB, adhE::P tet _luxR-P lux _luxI_UcfatB, fadE::P lux _CYP153A-BM3, pgi::P lux _CYP153A-BM3, aldB::P lux _CYP153A-BM3;

[0033] The promoter controlling the expression of CYP153A-BM3 was selected from P lux .

[0034] (5) Based on the M210 strain, the genes encoding BsADH and CV2025 and the promoters controlling the expression of BsADH and CV2025 were integrated into the gabD site of Escherichia coli to obtain Escherichia coli M434 that produces nylon 12 monomers. Its genotype is tesA::P tet _luxR-P lux _luxI_UcfatB, adhE::P tet _luxR-P lux _luxI_UcfatB, fadE::Plux _CYP153A-BM3, pgi::P lux _CYP153A-BM3, aldB::P lux _CYP153A-BM3, gabD::P M12 _CV2025_BsADH.

[0035] The promoter controlling the expression of BsADH and CV2025 was selected from P M12 .

[0036] The P lux The nucleotide sequence of luxI is shown in SEQ ID NO 1; the nucleotide sequence of luxR is shown in SEQ ID NO 3; the P tet The nucleotide sequence of P is shown in SEQ ID NO 4; M12 The nucleotide sequence of is shown as SEQ ID NO 5; the nucleotide sequence of UcfatB is shown as SEQ ID NO 6; the nucleotide sequence of CYP153A-BM3 is shown as SEQ ID NO 7; the nucleotide sequence of CV2025 is shown as SEQ ID NO 8; and the nucleotide sequence of BsADH is shown as SEQ ID NO 9.

[0037] SEQ ID NO 1:

[0038] ACCTGTAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGAATAAA

[0039] SEQ ID NO 2:

[0040] ATGACCATCATGATCAAAAAATCTGATTTCCTGGCGATCCCGAGCGAAGAATACAAAGGCATCCTGAGCCTGCGTTACCAGGTTTTCAAACAGCGTCTGGAATGGGATCTGGTTGTTGAAAACAACCTGGAAAGCGATGAATACGATAACAGCAACGCGGAATACATCTACGCGTGCGATGATACCGAAAACGTTAGCGGCTGCTGGCGTCTGCTGCCGACCACCGGCGATTACATGCTGAAAAGCGTTTTCCCGGAACTGCTGGGCCAGCAGAGCGCGCCGAAAGATCCGAACATCGTTGAACTGAGCCGTTTCGCGGTTGGCAAAAACAGCAGCAAAATCAACAACAGCGCGAGCGAAATCACCATGAAACTGTTCGAAGCGATCTACAAACACGCGGTTAGCCAGGGCATCACCGAATACGTTACCGTTACCAGCACCGCGATCGAACGTTTCCTGAAACGTATCAAAGTTCCGTGCCACCGTATCGGCGATAAAGAAATCCACGTTCTGGGCGATACCAAAAGCGTTGTTCTGAGCATGCCGATCAACGAACAGTTCAAAAAAGCGGTTCTGAACTAA

[0041] SEQ ID NO3:

[0042] TTAGTTTTTGAAGTACGGGCAATCGATCGCGCCGGTCAGGATCGCTTTGCTGATGCTCTGGCAGCGGTTGGTGGTGTTCAGTTTCATCTGCGCGTTGGTCAGGTGGAAGGTAACGGTACGTTCGCTGCAGCCCAGGATTTTAGAGATATCCCAGCTGGATTTGCCTTCGCACGCCCACGCCAGGCATTCTTTTTCACGTTTGGTCAGGTCGTTGTTGCTTTTGTTGTTCGCGATGTTGATTTTACGGTAGTTATCAACCAGGCTCGGAACGATCAGCGGGATGTTCATGCACGCGTGCAGGAACAGAGAATCGATGTAGTTGTCTTTTTCGCTGTGCGCGAAGCTCAGCATGCCGAAGCCGTTGTTCGCGGTGTGGATCGGGAAGCTGAAACCGGTGATCAGGCCGCTGGTTTTCGCTTCTTTGATAACGTTCGGGGATTTTTTGTTAACCGCGTTGTTTTCGAAGATGTTCCAGTTGATCGGGCTGTGGTTGCTGTTAGAGTAGTCCACGATCGGATCGTATTTGATCAGGTTCGCATCATCGTAGTACTGACGCCATTTTTTCGGGTAGTTGTCCAGGATGCTGATGTCGCTTTTCACCATGCTGTGCGGGTAGATGATCGCCAGCAGGTAGTATTCGCAGTGAACCATTTTGGTCATATCAGACAGGCACTGGTTGATATCGTTGTTGCTGCGGCACGCTTTGATTTTGTTGATGATACGGTAGGTATCATCCGCGTTGATGTTTTTCAT

[0043] SEQ ID NO4:

[0044] TCCCTATCAGTGATAGAGATTGACATCCCTATCAGTGATAGAGA

[0045] SEQ ID NO5:

[0046] TTATCTCTGGCGGTGTTGACAAGAGATAACAACGTTGATATAATTGAGCCCTTTTGGTGCGTCAGTCAGTTTAAACCAGGAAACAGCT

[0047] SEQ ID NO6:

[0048] ATGCTGGAATGGAAACCAAAACCGAAACTGCCACAACTGCTGGACGATCACTTCGGCCTGCATGGTCTGGTGTTCCGTCGTACGTTCGCTATTCGCAGCTACGAAGTTGGTCCGGATCGCAGCACCTCTATCCTGGCTGTAATGAACCATATGCAGGAAGCGACCCTGAACCACGCTAAAAGCGTTGGTATTCTGGGCGACGGTTTCGGTACTACCCTGGAAATGTCCAAACGTGACCTGATGTGGGTGGTGCGTCGTACTCACGTGGCGGTTGAACGTTACCCGACTTGGGGCGATACTGTCGAAGTTGAATGTTGGATCGGCGCTTCCGGTAACAACGGTATGCGTCGCGATTTTCTGGTGCGCGATTGCAAAACCGGCGAAATTCTGACGCGCTGCACTTCCCTGTCTGTACTGATGAACACCCGCACCCGTCGCCTGTCTACCATCCCGGACGAAGTACGTGGTGAGATCGGTCCGGCGTTTATTGACAACGTGGCGGTTAAAGACGACGAAATCAAGAAGCTGCAGAAGCTGAACGACTCCACCGCAGACTATATCCAGGGTGGCCTGACCCCGCGCTGGAACGATCTGGACGTAAACCAGCACGTGAACAACCTGAAATACGTTGCCTGGGTTTTCGAAACCGTTCCGGACAGCATCTTCGAATCTCACCACATCTCTTCCTTCACCCTGGAGTACCGCCGTGAATGTACCCGCGATTCTGTTCTGCGTTCCCTGACTACCGTTTCCGGTGGTTCTTCTGAAGCTGGCCTGGTCTGTGATCATCTGCTGCAACTGGAAGGCGGTAGCGAGGTACTGCGTGCTCGCACTGAATGGCGCCCGAAACTGACGGATTCTTTCCGTGGCATTTCCGTGATCCCGGCAGAACCACGTGTT

[0049] SEQ ID NO7:

[0050] ATGCCTACCCTGCCGCGCACCTTCGACGACATCCAAAGCCGCCTGATCAATGCAACCTCTCGTGTTGTTCCGATGCAGCGCCAGATCCAGGGTCTGAAATTTCTGATGTCCGCGAAACGTAAAACCTTCGGTCCGCGCCGCCCAATGCCGGAATTCGTTGAGACCCCAATCCCGGATGTAAACACCCTGGCCCTGGAAGACATCGATGTTAGCAATCCGTTCCTGTACCGTCAGGGCCAGTGGCGCGCATACTTTAAGCGTCTGCGTGACGAGGCCCCGGTACATTACCAGAAAAACTCCCCTTTCGGTCCGTTCTGGTCCGTGACTCGTTTCGAAGACATCCTGTTCGTGGATAAAAGCCACGATCTGTTCAGCGCGGAACCTCAGATCATCCTGGGCGATCCTCCTGAAGGTCTGTCCGTCGAGATGTTCATCGCGATGGATCCGCCGAAACACGACGTCCAGCGCTCTTCTGTCCAGGGTGTTGTAGCGCCGAAAAACCTGAAAGAAATGGAGGGTCTGATCCGCAGCCGTACCGGTGATGTTCTGGACTCTCTGCCGACTGACAAACCGTTCAACTGGGTGCCGGCGGTTTCTAAAGAACTGACCGGCCGTATGCTGGCTACCCTGCTGGACTTCCCGTATGAAGAACGTCATAAGCTGGTAGAATGGTCTGATCGTATGGC

[0051] TGGCGCTGCTTCCGCCACCGGCGGCGAATTCGCTGATGAAAAC

[0052] GCCATGTTCGACGATGCCGCTGATATGGCTCGTAGCTTCTCTCG

[0053] TCTGTGGCGTGACAAAGAAGCGCGTCGCGCCGCGGGCGAAGA

[0054] GCCGGGTTTCGACCTGATTAGCCTGCTGCAGTCCAACAAAGAA

[0055] ACCAAAGACCTGATTAACCGCCCTATGGAATTCATTGGCAACC

[0056] TGACCCTGCTGATCGTTGCCGGCAACGATACCACCCGCAATTC

[0057] TATGTCCGGTGGCCTGGTTGCTATGAACGAATTCCCGCGCGAA

[0058] TTCGAAAAGCTGAAGGCTAAACCGGAACTGATCCCAAACATG

[0059] GTTAGCGAGATCATCCGTTGGCAAACCCCGCTGGCATACATGC

[0060] GTCGTATCGCGAAACAGGATGTGGAACTGGGCGGTCAGACCA

[0061] TCAAGAAAGGCGACCGCGTTGTGATGTGGTATGCATCCGGCAA

[0062] CCGTGACGAGCGCAAATTCGACAACCCGGACCAGTTTATCATC

[0063] GACCGTAAGGACGCACGCAACCACATGTCCTTCGGTTATGGTG

[0064] TTCATCGCTGTATGGGCAATCGCCTGGCTGAACTGCAGCTGCG

[0065] CATTCTGTGGGAAGAAATCCTGAAACGTTTCGACAACATCGAA

[0066] GTAGTGGAAGAACCAGAACGTGTACAGTCCAACTTCGTTCGTG

[0067] GCTATTCTCGTCTGATGGTAAAGCTGACCCCGAACTCTGGTGG

[0068] TTCCGGTGGCTCTGGCGGCTCTATTCCATCTCCGTCCACCGAGC

[0069] AGTCTGCTAAGAAAGTGCGTAAAAAAGCTGAGAACGCACACA

[0070] ACACTCCGCTGCTGGTGCTGTACGGTTCTAACATGGGTACGGC

[0071] TGAAGGTACCGCTCGCGATCTGGCCGATATCGCGATGTCCAAA

[0072] GGTTTTGCGCCGCAGGTCGCCACGCTGGACTCTCATGCTGGTA

[0073] ACCTGCCGCGTGAGGGTGCTGTGCTGATCGTTACCGCCTCCTA

[0074] CAACGGTCACCCACCGGACAATGCAAAGGAATTCGTGGATTG

[0075] GCTGGATCAGGCGTCTGCGGATGAAGTCAAGGGTGTCCGCTAT

[0076] TCCGTATTCGGCTGCGGTGACAAGAACTGGGCAACTACCTATC

[0077] AGAAGGTCCCGGCCTTCATCGACGAAACGCTGGCTGCTAAAGG

[0078] CGCAGAAAACATTGCGGAACGTGGTGAGGCAGACGCTAGCGA

[0079] TGACTTCGAGGGTACCTACGAGGAATGGCGCGAACATATGTGG

[0080] AGCGACCTGGCGGCGTACTTCAACCTGGACATCGAAAATTCCG

[0081] AAGAAAATGCCAGCACTCTGTCCCTGCAGTTTGTAGATTCCGC

[0082] CGCAGATATGCCGCTGGCTAAAATGCACCGTGCATTCAGCGCT

[0083] AACGTTGTGGCCTCTAAAGAACTGCAGAAGCCAGGTTCTGCAC

[0084] GCTCCACCCGTCACCTGGAAATCGAGCTGCCGAAAGAAGCTAG

[0085] CTACCAAGAAGGTGATCACCTGGGCGTTATCCCGCGCAACTAC

[0086] GAGGGTATTGTGAACCGCGTTGCAACCCGTTTCGGTCTGGATG

[0087] CAAGCCAGCAGATCCGTCTGGAAGCCGAAGAAGAAAAACTGG

[0088] CTCACCTGCCGCTGGGCAAAACGGTCAGCGTGGAAGAACTGCT

[0089] GCAGTATGTTGAACTGCAGGATCCGGTTACCCGTACTCAGCTG

[0090] CGTGCGATGGCGGCAAAAACCGTGTGCCCACCTCACAAAGTA

[0091] GAGCTGGAGGTACTGCTGGAAAAACAGGCGTATAAGGAACAG

[0092] GTCCTGGCCAAACGTCTGACCATGCTGGAACTGCTGGAAAAAT

[0093] ATCCGGCTTGCGAAATGGAATTCTCTGAATTCATCGCGCTGCT

[0094] GCCGTCCATGCGTCCGCGTTACTACTCTATCTCTTCCTCCCCAC

[0095] GTGTAGATGAGAAACAGGCAAGCATTACGGTCTCTGTTGTAAG

[0096] CGGTGAAGCTTGGTCTGGTTACGGTGAATACAAAGGTATCGCG

[0097] AGCAACTATCTGGCTAACCTGCAGGAAGGTGACACTATTACCT

[0098] GTTTCGTGTCCACCCCTCAGTCCGGCTTTACTCTGCCGAAAGGC

[0099] CCGGAAACGCCGCTGATCATGGTTGGTCCTGGTACCGGCGTTG

[0100] CCCCGTTTCGCGGCTTCGTGCAGGCGCGCAAGCAGCTGAAGGA

[0101] GCAGGGTCAGAGCCTGGGTGAAGCTCACCTGTACTTCGGCTGC

[0102] CGTTCTCCGCACGAAGACTACCTGTACCAGAAAGAACTGGAAA

[0103] ACGCTCAGAACGAAGGTATCATCACGCTGCATACTGCCTTTTC

[0104] TCGTGTGCCGAACCAGCCGAAAACCTATGTTCAGCACGTCATG

[0105] GAGCAAGACGGTAAAAAACTGATCGAACTGCTGGACCAGGGT

[0106] GCCCACTTCTATATCTGCGGCGACGGTTCTCAAATGGCACCGG

[0107] ACGTGGAAGCGACCCTGATGAAGTCTTACGCGGAGGTTCATCA

[0108] GGTAAGCGAAGCGGACGCACGTCTGTGGCTGCAGCAGCTGGA

[0109] AGAAAAAGGTCGTTATGCGAAAGATGTTTGGGCGGGT

[0110] SEQ ID NO8:

[0111]

[0112] SEQ ID NO9:

[0113]

[0114] Example 2:

[0115] The engineered strain M434, containing the autoinduction system constructed in Example 1, was inoculated into TB medium supplemented with 4-40 g / L glucose, 0.1-10 g / L ferrous sulfate heptahydrate, 5-50 mM 5-aminolevulinic acid hydrochloride, 50-500 mM L-alanine, and 0.1-1 mM pyridoxal-5-phosphate. Fermentation was performed in a shake flask. Production of greater than 100 mg / L of nylon 12 monomer was detected at 72 hours of fermentation.

[0116] The above examples are merely illustrative of the present invention and do not limit the scope of protection of the present invention. Any design that is identical or similar to the present invention falls within the scope of protection of the present invention.

Claims

1. An Escherichia coli for producing nylon 12 monomer, characterized in that: The genotype of the Escherichia coli is tesA::P tet _luxR-P lux _luxI_UcfatB, adhE::P tet _luxR-P lux _lux I_UcfatB, fadE::P lux _CYP153A-BM3, pgi::P lux _CYP153A-BM3, ald B::P lux _CYP153A-BM3, gabD::P M12 _CV2025_BsADH; Among them, the P lux The nucleotide sequence of luxI is shown in SEQ ID NO 1; the amino acid sequence of luxI is shown in SEQ ID NO 2; the amino acid sequence of luxR is shown in SEQ ID NO 3; the P tet The nucleotide sequence of P is shown in SEQ ID NO 4; M12 The nucleotide sequence of UcfatB is shown in SEQ ID NO 5; the amino acid sequence of CYP153A-BM3 is shown in SEQ ID NO 6; the amino acid sequence of CV2025 is shown in SEQ ID NO 8; and the amino acid sequence of BsADH is shown in SEQ ID NO 9.

2. A method for constructing Escherichia coli for producing nylon 12 monomer, characterized in that: The following steps are involved: (1) Integrate the luxI, luxR, and UcfatB genes and the promoters that control their expression into the tesA gene locus of the Escherichia coli genome to construct strain M22; (2) Based on the M22 strain, the same sequence as in step (1) was integrated into the ad hE gene locus to obtain strain M73; (3) Based on the M73 strain, CYP153A-BM3 and the promoter controlling CYP153A-BM3 expression were integrated into the fadE site of Escherichia coli to obtain strain M209; (4) Based on the M209 strain, the CYP153A-BM3 encoding gene and the promoter controlling CYP153A-BM3 expression were integrated into the aldB site and pgi site of Escherichia coli to obtain strain M210; (5) Based on the M210 strain, the genes encoding BsADH and CV2025 and the promoters controlling the expression of BsADH and CV2025 were integrated into the gabD site of Escherichia coli to obtain Escherichia coli that produces nylon 12 monomers.

3. The method for constructing Escherichia coli for producing nylon 12 monomer according to claim 2, characterized in that: The promoter for controlling the expression of luxI and UcfatB in step (1) is selected from P lux ; The promoter controlling luxR expression is selected from P tet .

4. The method for constructing Escherichia coli for producing nylon 12 monomer according to claim 2, wherein: The promoter for controlling the expression of CYP153A-BM3 in steps (3) and (4) is selected from P lux .

5. The method for constructing Escherichia coli for producing nylon 12 monomer according to claim 2, characterized in that: The promoter for controlling the expression of BsADH and CV2025 in step (5) is selected from P M12 .

6. Use of the Escherichia coli for producing nylon 12 monomer according to claim 1 or the construction method according to any one of claims 2 to 5 in the production of nylon 12 monomer.

7. A method for producing nylon 12 monomer, characterized in that: The Escherichia coli for producing nylon 12 monomer according to claim 1 is inoculated into a culture medium for fermentation, and the nylon 12 monomer in the fermentation product is collected.

8. The method for producing nylon 12 monomer according to claim 7, wherein: The culture medium is a TB medium additionally containing 4-40 g / L glucose, 0.1-1 g / L ferrous sulfate heptahydrate, 5-50 mM 5-aminolevulinic acid hydrochloride, 50-500 mM L-alanine, and 0.1-1 mM pyridoxal-5-phosphate.