Deoxyribozyme binding arm, kit, biosensor and nucleic acid detection method

Abstract

The invention relates to a deoxyribozyme binding arm, a kit, a biosensor and a nucleic acid detection method. The deoxyribozyme binding arm is of an annular structure and comprises a catalytic core A sequence of deoxyribozyme, a monomer amplicon recognition region, a sequence of a fragment containing a detection probe and a deoxyribozyme substrate recognition region; wherein the catalytic core part sequence of the deoxyribozyme comprises a part of sequence in any one of 8-17 type deoxyribozyme, E6 type deoxyribozyme or 10-23 type deoxyribozyme. The invention provides a deoxyribozyme binding arm and a multifunctional DNA nano-machine obtained by combining the deoxyribozyme binding arms, which integrate cutting enhanced rolling circle amplification, self-cutting DNAzyme and rolling circle amplification technologies, construct a self-cascade amplification nano-machine, and can perform molecular signal amplification on the existence of a formulated sequence. The system exhibits an increase in cascade reaction efficiency due to the minimization of the number of independent molecular diffusion / collision events.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biological detection, and in particular relates to a deoxyribozyme binding arm, a reagent kit, a biosensor and a nucleic acid detection method. Background Art

[0002] Functional nucleic acids are DNA or RNA molecules isolated from DNA libraries using in vitro screening techniques. They are nucleic acid sequences with specific target recognition and catalytic activity. These include aptamers, deoxyribonucleases (DNAzymes), G-quadruplexes, and other DNA assemblies. DNAzymes are catalytically active single-stranded DNA enzymes. Compared to protein enzymes, DNAzymes offer advantages such as simple structure, stable activity, and low synthesis cost. They have been widely used in biosensors, bioimaging, environmental monitoring, and nanomachines. DNAzymes with RNA-cleaving activity exhibit strong specific recognition in the presence of metal ions. Their structure consists of a highly conserved catalytic core and two sequence-editable binding arms, which specifically recognize substrate chains and catalyze the cleavage of ribonucleotide phosphodiester bonds within the substrate chains. DNA nanomachines are molecular machines that integrate specific functions with functional nucleic acids (aptamers, DNAzymes, etc.). They rely on programmed sequence-specific interactions between DNA chains to perform their tasks in response to molecular or environmental signals.

[0003] For example, prior art CN 119824073 A discloses a nucleic acid detection method based on DNA nanomachines and its application in a test kit or biosensor. The detection method designs a padlock probe and a DNAzyme chain according to the target gene sequence to be tested, and correspondingly designs primers, protection chains and substrate chains, realizes amplification of the target gene sequence by nicking enhanced rolling circle amplification (NickRCA) technology, utilizes DNAzyme to construct a DNA nanomachine, and the amplified product combines with the DNA nanomachine to change the DNAzyme conformation. Under the action of metal ions, the enzyme activity is activated to cut the substrate chain to realize directional amplification of the signal, and a nano marker is added to the reaction system as a signal reference, and the sensor is used to detect and realize qualitative and / or quantitative analysis of the target nucleic acid sequence to be tested. The invention has the advantages of integration, portability, low cost, etc., and can be applied to complete on-site rapid and instant detection under limited conditions, which is of great significance for disease prevention and control. However, the DNAzyme sensor reaction efficiency is low.

[0004] DNAzymes with endonuclease activity, combined with other molecular strategies (e.g., RCA, SDA, CHA), are also widely used in electrochemical sensors and fluorescence spectrometers. However, electrochemical sensors face challenges such as electrode surface contamination and passivation, and fluctuations in pH, ionic strength, and dissolved oxygen in the environment that directly affect redox reaction kinetics. Fluorescence sensors, due to their reliance on fluorescence readings, are not suitable for detecting highly turbid samples, making them unsuitable for point-of-care diagnostics. Summary of the Invention

[0005] The purpose of the present invention is to provide a DNA enzyme binding arm, a kit, a biosensor and a nucleic acid detection method capable of improving the sensitivity of detecting single nucleotide mutations.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions:

[0007] A deoxyribozyme binding arm having a ring structure, comprising a deoxyribozyme catalytic core A sequence, a monomeric amplicon recognition region, a sequence of a fragment comprising a detection probe, and a deoxyribozyme substrate recognition region; wherein the deoxyribozyme catalytic core partial sequence comprises a partial sequence of any one of the deoxyribozymes 8-17, E6, or 10-23; the deoxyribozyme catalytic core A sequence has a base length of 8-12; and the number of bases in the monomeric amplicon recognition region is greater than 13;

[0008] The DNAzyme substrate recognition region includes a 5'-end recognition region and a 3'-end recognition region, which are respectively located at the two ends of the DNAzyme binding arm; the sequence of the 5'-end recognition region is any one of the following sequences: CCGTACACGATCCC (SEQ ID NO. 1), ATGCGATCGATAGC (SEQ ID NO. 2), TACGCTAGCTAGCT (SEQ ID NO. 3), GATTACAAGCTTCG (SEQ ID NO. 4);

[0009] The sequence of the 3' end recognition region is any one of the following sequences: GAATGAGCCTGGAAGCC (SEQ ID NO. 5), TACGTAGCTAGCTAACGT (SEQ ID NO. 6), GCTAGCTACGTAGCTAGC (SEQ ID NO. 7), and ATCGATCGTAGCTAGCTA (SEQ ID NO. 8).

[0010] In one preferred embodiment, the catalytic core A sequence of the deoxyribozyme is any one of the following sequences:

[0011] SEQ ID NO.9: CGGTCGAA;

[0012] SEQ ID NO.10: GCGATCCGGA;

[0013] SEQ ID NO.11:AGGCTAGCT.

[0014] In a preferred embodiment, the sequence of the monomer amplicon recognition region in the DNAzyme binding arm is any one of the following sequences: AAACAGAGTTAAGAGAAG (SEQ ID NO.12), TCGATAGCTACGTAGC (SEQ ID NO.13), AAGCTTCGATAGCTAC (SEQ ID NO.14), GTACGTAGCTAGCTACG (SEQ ID NO.15).

[0015] In one preferred embodiment, the sequence of the detection probe fragment is any one of the following sequences: ATAATTTATACGTAGTACA (SEQ ID NO. 16), GCTAGCTACGTAGCTAGCT (SEQ ID NO. 17), TACGATCGATAGCTACGAT (SEQ ID NO. 18), AGCTAGCTAGCTAGCATCG (SEQ ID NO. 19).

[0016] In a preferred embodiment, the sequence of the DNAzyme binding arm is shown as SEQ ID NO.43.

[0017] SEQ ID NO.43: Phosphate-CCGTACACGATCCCCATAATTTATACGTAGTACACGTCTAATAAGAAAGATGCTCCAA ACAGAGTTAAGAGAAGCGGTCGAAGAATGAGCCTGGAAGCC

[0018] Based on the same inventive concept, the present invention also claims protection for a nanomachine comprising the deoxyribozyme binding arm.

[0019] In one preferred embodiment, the nanomachine comprises three single chains, namely a deoxyribozyme binding arm, a deoxyribozyme substrate and a deoxyribozyme protection chain. The deoxyribozyme substrate comprises a deoxyribozyme catalytic core B sequence, a primer region specifically paired with the deoxyribozyme binding arm, a monomer amplicon recognition region, and a deoxyribozyme protection chain recognition region; the deoxyribozyme protection chain comprises a recognition region specifically paired with the deoxyribozyme substrate.

[0020] The catalytic core B sequence of the deoxyribozyme and the catalytic core A sequence of the deoxyribozyme are combined to obtain the catalytic ring center of the deoxyribozyme.

[0021] In one preferred embodiment, the DNAzyme substrate comprises a ribonucleotide (rA) cleavage site.

[0022] In one preferred embodiment, the catalytic core B sequence of the deoxyribozyme is any one of the following sequences: TCCGAGC (SEQ ID NO. 20), ACGGCACC (SEQ ID NO. 21), TACAACGA (SEQ ID NO. 22).

[0023] In one preferred embodiment, in the deoxyribozyme substrate, the sequence of the primer region that specifically pairs with the deoxyribozyme binding arm is any one of the following sequences: GGGATCGTGTACGGGGCTTCCAGGCTCATTC (SEQ ID NO.23), GCTATCGATCGCATACGTTAGCTAGCTACGTA (SEQ ID NO.24), AGCTAGCTAGCGTAGCTAGCTACGTAGCTAGC (SEQ ID NO.25), and CGAAGCTTGTAATCTAGCTAGCTACGATCGAT (SEQ ID NO.26).

[0024] In one preferred embodiment, in the deoxyribozyme substrate, the sequence of the monomer amplicon recognition region is any one of the following sequences: AAGCCGGGC (SEQ ID NO.27), CGATAGGCT (SEQ ID NO.28), TTAC GCGCT (SEQ ID NO.29), GCGATAGGT (SEQ ID NO.30).

[0025] In one preferred embodiment, in the deoxyribozyme substrate, the sequence of the deoxyribozyme protection chain recognition region is any one of the following sequences: CATGTGTTGGATGTTGTGG (SEQ ID NO.31), TAGCTAGCTACGTAGCTAGC (SEQ ID NO.32), GATCGTAGCTATCGATCGTA (SEQ ID NO.33), TCGATGCTAGCTAGCTAGCT (SEQ ID NO.34).

[0026] In a preferred embodiment, the sequence of the deoxyribozyme protection chain is any one of the following sequences: CCAC AACATCCAACACATG (SEQ ID NO. 35), GCTAGCTACGTAGCTAGCTA (SEQ ID NO. 36), TACGATCGATAGCTACGATC (SEQ ID NO. 37), AGCTAGCTAGCTAGCATCGA (SEQ ID NO. 38).

[0027] In one preferred embodiment, the sequence of the DNAzyme substrate is shown as SEQ ID NO.44.

[0028] SEQ ID NO. 43: TTTTTTTTTGGGATCGTGTACGGGGCTTCCAGGCTCATTCrAGGA AGAGTTTCTCTTCTCCGAGCAAGCCGGGCCATGTGTTGGATGTTGTGG.

[0029] In one preferred embodiment, the sequence of the DNAzyme protection chain is shown as SEQ ID NO.45.

[0030] SEQ ID NO. 44: CCACAACATCCAACAC*A*T*G-Inverted dT.

[0031] The nanomachine is composed of three single strands: a DNAzyme binding arm (PLP-Dz), a DNAzyme substrate sequence (Sub-Dz), and a DNAzyme protection strand (Blocker-Dz). The PLP-Dz and Sub-Dz sequences contain the DNAzyme's catalytic core, enabling it to perform its DNAzyme function. PLP-Dz is also designed as a circular template for rolling circle amplification (RCA), and a portion of the Sub-Dz sequence is designed as a primer that specifically pairs with the circular template, ensuring RCA. Blocker-Dz specifically pairs with the 3' end of Sub-Dz, creating double-stranded DNA that prevents the 3'→5' exonuclease activity of phi29 DNA polymerase from degrading Sub-Dz. NickRCP (the NickRCA amplification product) specifically pairs with a portion of the PLP-Dz and Sub-Dz sequences, inducing a conformational change in the DNA nanomachine, forming the DNAzyme's circular catalytic core, thereby activating RNA cleavage activity in a divalent cation environment.

[0032] Based on the same inventive concept, the present invention also claims protection for a kit comprising a reaction solution a, a reaction solution b, and a reaction solution c; wherein the reaction solution a comprises a padlock probe, a primer, an Ampligase ligase, bovine serum albumin, a target to be detected, and a ligase buffer; the reaction solution b comprises a ligase buffer, a deoxyribozyme binding arm, a deoxyribozyme substrate, bovine serum albumin, a deoxyribozyme protection chain, and an Ampligase ligase; the reaction solution c comprises a ligase reaction product, a nanomachine, a polymerase buffer, bovine serum albumin, deoxynucleotides dNTP, and T4 PNK, DNA polymerase, restriction endonuclease, restriction oligonucleotide, magnetic nanoparticle-labeled detection probe and metal ion solution; design a padlock probe according to the target to be detected, and design primers accordingly; the padlock probe has a phosphorylated 5' end, and is provided with a primer recognition region and an endonuclease recognition region, and has target gene recognition regions complementary to the target sequence to be detected at both ends, and the endonuclease cleavage site of the endonuclease recognition region is methylated; the deoxyribozyme protection chain has the same sequence as a portion of the padlock probe region and has a chemically blocked 3' end.

[0033] In one preferred embodiment, the reaction solution a includes ligase buffer 1×, bovine serum albumin 0.2 mg / mL, padlock probe 60 nM, primer 180 nM, water, Ampligase 0.2 U / μL, and target to be detected 20 nM).

[0034] In a preferred embodiment, the reaction solution b includes ligase buffer 1×, bovine serum albumin 0.2 mg / mL, deoxyribozyme binding arm 20 nM, deoxyribozyme substrate 20 nM, deoxyribozyme protection chain 200 nM, and Ampligase ligase 0.2 U / μL.

[0035] In one preferred embodiment, the reaction solution c includes 10 pM nanomachines, 1× polymerase buffer, 0.2 mg / mL bovine serum albumin, 0.33 mM deoxynucleotide dNTP, 0.33 U / μL T4 PNK, 5 mM metal ion solution, 1 μM restriction oligonucleotide, 0.1 mg / mL magnetic nanoparticle-labeled detection probe, 0.17 U / μL DNA polymerase, and 0.33 U / μL restriction endonuclease AluI.

[0036] In a preferred embodiment, the sequence of the padlock probe is shown as SEQ ID NO.39.

[0037] SEQ ID NO.38:

[0038] Represents methylation.

[0039] In a preferred embodiment, the sequence of the primer is shown as SEQ ID NO.40.

[0040] SEQ ID NO. 40: TAACGTTCTTATACATTATT.

[0041] In one preferred embodiment, the gene sequence of the target to be detected is shown as SEQ ID NO.41.

[0042] SEQ ID NO. 41: CCACAAGGCCGACTGTTGGCGCTGGGGCCCGG.

[0043] In a preferred embodiment, the restriction oligonucleotide is shown as SEQ ID NO.47.

[0044] SEQ ID NO. 47: AACTAGCTAATAAGAAA*G*A*T-Inverted dT.

[0045] A biosensor comprises the above-mentioned kit.

[0046] A biosensor for detecting Mycobacterium tuberculosis comprises the above-mentioned kit for detecting Mycobacterium tuberculosis rpoB 531T, wherein the sequence of the target gene is shown as SEQ ID NO.40.

[0047] A nucleic acid detection method comprising the following steps:

[0048] S1. Design a padlock probe according to the target gene sequence to be measured, and design primers accordingly; wherein the padlock probe has a phosphorylated 5' end and is provided with a target gene recognition region, a primer recognition region, and an endonuclease recognition region, the target gene recognition region being located at both ends of the padlock probe and complementary to the target gene sequence to be measured, and the endonuclease cleavage site of the endonuclease recognition region is methylated;

[0049] S2, mixing the target with the padlock probe, primer, bovine serum albumin, and Ampligase ligase to perform a ligase reaction to obtain a ligase reaction product;

[0050] S3, nanomachine construction: mixing the DNAzyme binding arm, DNAzyme substrate, DNAzyme protection chain, ligase buffer, bovine serum albumin, and Ampligase ligase, and connecting them into a nanomachine;

[0051] S4, mixing the ligase reaction product, the nanomachine, the polymerase, the detection probe labeled with magnetic nanoparticles, the metal ion solution, the endonuclease, T4 PNK, and the polymerase buffer to perform a NickRCA-DNAzyme-cRCA reaction to obtain a final reaction system;

[0052] S5. Using a sensor to detect the final reaction system, qualitative analysis and / or quantitative analysis of the target gene to be detected is achieved.

[0053] The molecular strategy of the present invention is as follows Figure 1 As shown, it includes five different molecular reactions: padlock probe ligation (process I), nick-enhanced rolling circle amplification 2 (NickRCA, process II), nick-enhanced rolling circle amplification product (NickRCP)-induced nanomachine conformational change (process III), DNA self-cleavage with RNA cleavage activity (process IV), and rolling circle amplification (RCA, process V). In addition, during the rolling circle amplification reaction, the product of the first reaction is dropped and can be further utilized in the homogeneous system in process III (process VI). Padlock probe ligation is an independent step, and the other reactions can be combined and carried out homogeneously in the same system.

[0054] The molecular reaction design NickRCA-DNAzyme-cRCA strategy includes the following core steps: Figure 1 ):

[0055] 1. Target-triggered padlock probe (PLP) circularization: Target DNA is partially sequence-specifically paired with PLP. Only when a single nucleotide mutation occurs in the target (such as the single nucleotide mutation TCG→TTG at codon 531 of the rpoB gene), it can assist the ligase in connecting the 5' and 3' ends of the PLP, thereby circularizing the PLP.

[0056] 2. Nicking-enhanced rolling circle amplification (NickRCA): phi29 DNA polymerase and AluI restriction endonuclease work synergistically to generate long, single-stranded amplification products with repetitive sequences (monomers specifically pair with PLPs). The introduction of an oligonucleotide (RO) specifically pairs with NickRCP and contains an AluI restriction endonuclease nicking site, thereby assisting in the generation of monomeric amplicons. Furthermore, the double-stranded DNA generated by the RO and the 3' end of NickRCP prevents the 3'→5' exonuclease activity of phi29 DNA polymerase from destroying NickRCP.

[0057] 3. NickRCP-induced conformational changes in the nanomachine: The nanomachine is composed of three single strands: the DNAzyme binding arm (PLP-Dz), the DNAzyme substrate sequence (Sub-Dz), and the DNAzyme protection strand (Blocker-Dz). The PLP-Dz and Sub-Dz sequences contain the DNAzyme's catalytic core, enabling it to perform its DNAzyme function. PLP-Dz is also designed as a circular template for rolling circle amplification (RCA), and a portion of the Sub-Dz sequence is designed as a primer that specifically pairs with the circular template, ensuring its ability to perform the RCA reaction. Blocker-Dz specifically pairs with the 3' end of Sub-Dz, generating double-stranded DNA that prevents the 3'→5' exonuclease activity of phi29 DNA polymerase from destroying Sub-Dz. NickRCP pairs specifically with the partial sequence of PLP-Dz and Sub-Dz, thereby inducing conformational changes in the DNA nanomachine, forming a ring-shaped catalytic core of the deoxyribozyme, thereby activating the activity of the deoxyribozyme with RNA cleavage activity.

[0058] 4. Activation of DNAzyme with RNA cleavage activity; in the presence of divalent cations (Mg 2+ or Zn 2+ ) environment, DNAzyme cuts the RNA site, and the cut product can be used as a primer for rolling circle amplification. The product of rolling circle amplification is a long single strand with a repetitive sequence.

[0059] 5. Rolling circle amplification and magnetic nanoparticle (MNP) signal output: The products of rolling circle amplification can be specifically paired with labeled detection probes, resulting in MNP aggregation. The hydrodynamic size changes can be monitored in real time through the optical magnetic system.

[0060] Recycling of nicking-enhanced rolling circle amplification reaction products: In the rolling circle amplification reaction, the monomeric amplicons specifically paired with the nanomachine undergo chain displacement and fall off, freely diffuse in the homogeneous system, and are reused by the activation process of the deoxyribozyme activity with RNA cleavage activity.

[0061] Compared with the prior art, the present invention has the following beneficial effects:

[0062] The present invention provides a multifunctional DNA nanomachine obtained by combining DNAzyme binding arms. It integrates nicking-enhanced rolling circle amplification (NickRCA), self-cleaving DNAzyme and rolling circle amplification (cRCA) technology to construct a self-cascade amplification nanomachine that can amplify molecular signals for the presence of a specified sequence. The system exhibits improved cascade reaction efficiency due to the minimization of the number of independent molecular diffusion / collision events. Compared with traditional cascade reactions, the constructed nanomachine reduces molecular diffusion events and significantly improves reaction efficiency. The cascade coupling efficiency of the DNA nanomachine between DNAzyme-assisted nucleic acid circulation and cRCA is estimated to be 43.9%. However, since NickRCA is not integrated into the cascade nanomachine, its cascade coupling efficiency with the nanomachine is only 17.0% due to diffusion limitations. These two roughly estimated cascade coupling efficiency values ​​indicate that the design of the DNAzyme binding arm and the nanomachine can effectively improve sensing performance. The nanomachine of the present invention is combined with a photomagnetic detection system of magnetic nanoparticles (MNPs). This method can achieve sub-femtomolar sensitive detection of single nucleotide mutations in a homogeneous system. For example, the present invention was used for real-time optical and magnetic detection of the 531T mutation in the rpoB gene of Mycobacterium tuberculosis, with a detection limit of 0.3 fM and a total detection time of 100 minutes. The present invention also establishes a general technical framework for detecting other single nucleotide mutations. BRIEF DESCRIPTION OF THE DRAWINGS

[0063] Figure 1 This is the molecular strategy of the present invention.

[0064] Figure 2 This is the electrophoresis result of Example 1.

[0065] Figure 3 This is the optical magnetic phase difference sensor result of Example 2.

[0066] Figure 4 This is the electrophoresis verification result of Comparative Example 1. DETAILED DESCRIPTION

[0067] The present invention is not limited to the following specific embodiments. Based on the disclosure of the present invention, a person skilled in the art may adopt a variety of other specific embodiments to implement the present invention. Any simple changes or modifications made to the design structure and concept of the present invention fall within the scope of protection of the present invention. It should be noted that the embodiments and features of the embodiments of the present invention may be combined with each other unless they conflict.

[0068] Example 1

[0069] The sequences involved in the examples are shown in Table 1. The nucleic acid sequences involved were independently designed and synthesized by Shanghai Bioengineering. The reagents involved are shown in Table 2. The 44th base of the padlock probe contains a methylated * indicates phosphorothioate modification. The synthetic nicking reaction product is modified with a C3 spacer at its 3' end and contains two phosphorothioate bonds (*). The restriction oligonucleotide is modified with an inverted dT at its 3' end and contains three phosphorothioate bonds (*). The DNAzyme substrate contains a ribonucleotide (rA) cleavage site. The padlock probe and DNAzyme binding arm are modified with a 5'-phosphate group.

[0070] Table 1 Sequences involved in the examples

[0071]

[0072] Table 2 Reagents involved in the examples

[0073]

[0074]

[0075] The molecular reaction strategy of this embodiment includes a ligase reaction, nanomachine construction, and molecular amplification. After the molecular reaction is completed, quantitative analysis can be performed using electrophoresis or optical magnetic phase contrast sensors. The reaction triggered by the target gene is as follows:

[0076] ① Ligase reaction: DNA ligase buffer (1×, working concentrations of reactants are in brackets, the same below), padlock probe (60 nM), primer (180 nM), water, BSA (0.2 mg / mL), Ampligase ligase (0.2 U / μL) and target gene _rpoB (20 nM) were mixed and reacted at 50°C for 10 minutes to obtain the ligase reaction product.

[0077] ② Nanomachine construction: DNA enzyme binding arm (0.1 μM), DNA enzyme substrate (0.1 μM), and DNA enzyme protection chain (1 μM) were mixed in TE buffer at 95°C and then cooled from 95°C to 50°C at a rate of 2°C / min. DNA ligase buffer (1×), DNA enzyme binding arm (20 nM), DNA enzyme substrate (20 nM), DNA enzyme protection chain (200 nM), water, Ampligase ligase (0.2 U / μL), and BSA (0.2 mg / mL) were then reacted at 50°C for 10 minutes to obtain the nanomachine.

[0078] ③ NickRCA reaction (unrestricted oligonucleotide RO): Mix the ligase reaction product (0.2 nM), polymerase buffer (1×), bovine serum albumin (0.2 mg / mL), deoxynucleotide dNTP (0.33 mM), water, phi29 DNA polymerase (0.17 U / μL), and AluI restriction endonuclease (0.33 U / μL) and react at 37°C for 2 h.

[0079] ④NickRCA reaction (with restriction oligonucleotide RO): Mix the ligase reaction product (0.2 nM), polymerase buffer (1×), bovine serum albumin (0.2 mg / mL), deoxynucleotide dNTP (0.33 mM), water, phi29 DNA polymerase (0.17 U / μL), RO (2 μM), and AluI restriction endonuclease (0.33 U / μL) and react at 37°C for 2 h.

[0080] ⑤RCA reaction: Mix the ligase reaction product (0.2 nM), polymerase buffer (1×), bovine serum albumin (0.2 mg / mL), deoxynucleotide dNTP (0.33 mM), water, and phi29 DNA polymerase (0.17 U / μL) and react at 37°C for 2 h.

[0081] ⑥NickRCA-DNAzyme-cRCA reaction: Mix the ligase reaction product (0.2 nM), nanomachine (0.4 nM), polymerase buffer (1×), water, bovine serum albumin (0.2 mg / mL), deoxynucleotide dNTP (0.33 mM), T4 PNK (0.33 U / μL), MgSO4 (5 mM), restriction oligonucleotide RO (1 M), phi29 DNA polymerase (0.17 U / μL) and AluI restriction endonuclease (0.33 U / μL) and react at 37°C for 2 h.

[0082] ⑦ Electrophoresis verification: Add 2 g agarose and 80 mL TBE buffer (1×) to prepare 2.5% agarose gel. Take 15 μL of the sample to be analyzed and mix it with 0.1 μL SYBR Gold and 3 μL loading buffer (6×).

[0083] Each product was verified by electrophoresis reaction, and the electrophoresis reaction was designed as follows:

[0084] 1. Lane M is the marker;

[0085] 2. Lane 1 is the target sequence; Lane 2 is the padlock probe; Lane 3 is the ligase product; Lane 4 is the restriction oligonucleotide (RO);

[0086] 3. Lane 5 is the RCA reaction product; lanes 6 and 7 are the NickRCA reaction products without and with RO, respectively;

[0087] 4. Lane 8 shows the DNAzyme binding arm; Lane 9 shows the DNAzyme substrate; Lane 10 shows the nanomachine; Lane 11 shows the NickRCA reaction after the entire system is inactivated at 70°C for 10 minutes before the nanomachine is added. Lane 12 shows the product of the NickRCA-DNAzyme-cRCA reaction initiated by the target gene.

[0088] Gel electrophoresis was performed at room temperature (100 V, 45 minutes) and images were taken. Figure 2 shown.

[0089] The results show that lane M is a marker used as a reference, and lanes 1 and 2 are the target sequence and padlock probe, respectively. The target sequence can be specifically paired with the padlock probe to form a complete circular template under the action of the ligase, and their ligation product is shown in lane 3. After the complete circular template is formed, with the help of the polymerase, the RCA process (lane 5) can be carried out to generate a long single-stranded product. The addition of endonuclease can then be used to carry out the NickRCA process (lane 6). By adding the restriction oligonucleotide RO (lane 4), the amplicon can be monomerized and protected from digestion by the 3'-5' exonuclease activity of the phi29 polymerase. A clear ladder-like band can be observed in lane 7, indicating that the restriction oligonucleotide has played a role. Lanes 8 and 9 are the deoxyribozyme binding arm PLP-dz and the deoxyribozyme substrate chain Sub-dz, respectively. PLP-dz can specifically pair with Sub-dz, forming a complete circular template under the action of ligase. Blocker-dz, a protective chain, is then added, and their trimer, the nanomachine, is shown in lane 10. After the NickRCA reaction, the entire system was inactivated at 70°C for 10 minutes. The nanomachine was then added, and the result is shown in lane 11. Lane 12 represents the one-step reaction of the entire isothermal homogeneous cascade amplification system (i.e., the NickRCA-DNAzyme-cRCA reaction). The presence of a band in lane 12 that was absent in lane 11 is due to the binding of the NickRCA product in lane 11 to the nanomachine. Furthermore, a significant increase in RCA product was observed in lane 12 compared to lane 5, demonstrating that the introduction of the nanomachine improved the efficiency of homogeneous cascade amplification. Gel electrophoresis feasibility verification was completed.

[0090] Example 2

[0091] The target gene-triggered reaction product optical magnetic phase difference sensor was verified as follows:

[0092] ① Ligase reaction: DNA ligase buffer (1×, working concentrations of reactants are in brackets, the same below), padlock probe (60 nM), primer (180 nM), water, BSA (0.2 mg / mL), Ampligase ligase (0.2 U / μL) and target gene _rpoB (20 nM) were mixed and reacted at 50°C for 10 minutes to obtain the ligase reaction product.

[0093] ②Nanomachine construction: The deoxyribozyme binding arm (0.1 μM), deoxyribozyme substrate (0.1 μM), and deoxyribozyme protection chain (1 μM) were mixed in TE buffer, starting from 95°C and gradually cooled to 50°C at a rate of 2°C / min. Then, DNA ligase buffer (1×), deoxyribozyme binding arm (20 nM), deoxyribozyme substrate (20 nM), deoxyribozyme protection chain (200 nM), water, Ampligase ligase (0.2 U / μL), and BSA (0.2 mg / mL) were reacted at 50°C for 10 minutes to obtain the nanomachine.

[0094] ③ Construction of functionalized magnetic beads: Biotinylated detection probes (NickRCA-detection probe 1 and NickRCA-detection probe 2, as listed in Table 1) were conjugated to streptavidin-functionalized magnetic nanoparticles (MNPs) at a final concentration of 1.8 μM DP and 1 mg / mL MNP. The mixture was incubated at 37°C for 30 minutes, magnetically separated, and resuspended to an MNP concentration of 1 mg / mL. This yielded magnetic nanoparticle-labeled NickRCA-detection probe 1, NickRCA-detection probe 2, and magnetic nanoparticle-labeled detection probe, which were then stored at 4°C until use.

[0095] ④ NickRCA reaction: Mix the ligase reaction product, polymerase buffer (1×), bovine serum albumin (0.2 mg / mL), deoxynucleotide dNTP (0.33 mM), phi29 DNA polymerase (0.17 U / μL), magnetic nanoparticle-labeled NickRCA-detection probe 1 (0.05 mg / mL), magnetic nanoparticle-labeled NickRCA-detection probe 2 (0.05 mg / mL), and AluI restriction endonuclease (0.33 U / μL) and react at 37°C for 90 min.

[0096] ⑤DNAzyme-cRCA reaction: Mix the synthetic nicking reaction product, nanomachine (10 pM), polymerase buffer (10×), bovine serum albumin (0.2 mg / mL), deoxynucleotide dNTP (0.33 mM), phi29 DNA polymerase (0.17 U / μL), and magnetic nanoparticle-labeled NickRCA-detection probe (0.1 mg / mL) and incubate at 37°C for 90 min.

[0097] ⑥NickRCA-DNAzyme-cRCA reaction: Mix the ligase reaction product, nanomachine (10 pM), polymerase buffer (1×), water, bovine serum albumin (0.2 mg / mL), deoxynucleotide dNTP (0.33 mM), T4PNK (0.33 U / μL), MgSO4 (5 mM), restriction oligonucleotide RO (1 μM), magnetic nanoparticle-labeled NickRCA-detection probe (0.1 mg / mL), phi29 DNA polymerase (0.17 U / μL) and AluI restriction endonuclease (0.33 U / μL) and react at 30°C for 90 min.

[0098] ⑦ Validation of optical magnetic phase difference sensor: Take 60 μL of the EP tube containing the reactant and place it in the detection chamber of the optical magnetic phase difference sensor. Adjust the temperature control module to the reaction temperature and analyze it after 90 minutes of reaction detection.

[0099] The optical and magnetic detection parameters were set as follows: 2 mT magnetic field, 650 nm wavelength light source, 30°C reaction temperature, and signal acquisition every 3 minutes. The increased signal in the blank control group was attributed to nonspecific aggregation of magnetic nanoparticles. A dose-effect curve was plotted based on the optical and magnetic phase signals after 90 minutes of detection.

[0100] The results of the optical magnetic phase difference sensor are as follows Figure 3 As shown. The results show that during the optomagnetic measurement, the reaction mixture in the PCR tube is simultaneously subjected to thermal regulation and magnetic field. The system's automated magnetic field control and signal processing architecture is implemented using LabVIEW programming algorithms. The sensing principle is based on detecting the time-resolved voltage output of the photodetector, which corresponds to the magnetization dynamics of the MNP in an oscillating magnetic field. The magnetization response of the MNP includes phase shifts caused by Brownian relaxation and Néel relaxation mechanisms. Since Brownian relaxation is dominant in this particle size range, the signal modulation follows the following relationship: V(t) = V ref +V AC sin 2 (2πft-φ). Frequency domain analysis can obtain the second harmonic voltage component V2(f)=iV AC (1+if / f B ) -2 = -V2(sin2φ+i cos 2φ), which can be decomposed into in-phase V′2=-V2sin 2φ and out-of-phase V″2=-V2cos2φ components. The Brownian characteristic frequency Integrated thermal energy k B T, fluid viscosity η and hydrodynamic diameter D hBased on the above principle, quantitative analysis of molecular reactions on the MNP surface was achieved using parameters such as TCG→TTG at position 531 of the rpoB gene. In the presence of the TCG→TTG mutation at position 531 of the rpoB gene, the probe-functionalized MNPs bind to the NickRCA-DNAzyme-cRCA product, increasing the hydrodynamic volume and causing a change in the phase difference φ between the output voltage and the magnetic field, thus enabling quantitative analysis. The detection limits for the NickRCA reaction, DNAzyme-cRCA reaction, and homogeneous cascade one-step reaction were 268 fM, 76 fM, and 0.3 fM, respectively.

[0101] Comparative Example 1

[0102] Electrophoresis verification of the effect of binding arm design method on amplification reaction

[0103] Comparative Example 1 differs from Example 1 in that the design of the DNAzyme binding arm is different. The sequence of the DNAzyme binding arm is shown in SEQ ID NO. 51. The nucleic acid sequence involved in the comparative example was independently designed and synthesized by Shanghai Bioengineering. The involved sequences are shown in Table 3. The DNAzyme binding arm is modified with a 5'-phosphate group. The DNAzyme substrate chain contains a ribonucleotide (rA) cleavage site.

[0104] Table 3 Sequences involved in Comparative Example 1

[0105]

[0106]

[0107] Table 4 Reagents involved in the comparative examples

[0108] Reagent name Specification Item No. supplier DNA Ligase Buffer 10× A32750 Biosearch technologiesr Ampligase ligase 5U / mL A32750 Biosearch technologiesr Phi29 DNA polymerase 10 U / mL EP0094 Thermo Fisher polymerase buffer 10× EP0094 Thermo Fisher T4 PNK 10 U / mL M0201V New England BioLabs SYBR Gold 10000× S11494 Thermo Fisher TBE buffer 10× B1111c Beijing Prilai Bovine serum albumin (BSA) 100mg 109Z054 Beijing Solebow Technology dNTP mix 10mM PC2200 Beijing Solebow Technology agarose / BY-R0100 Burgos Spain DNA Marker 500mL AG11906 Hunan Aikerui Biological Loading buffer 6× AG11902 Hunan Aikerui Bioengineering Co., Ltd. magnesium sulfate 100mM M0374S New England BioLabs

[0109] The experimental steps are as follows:

[0110] ① Nanomachine construction: The deoxyribozyme binding arm (0.1 μM), deoxyribozyme substrate chain (0.1 μM), and deoxyribozyme protection chain (0.1 μM) were mixed in TE buffer, and the temperature was gradually decreased from 95°C to 50°C at a rate of 2°C / min. Then, DNA ligase buffer (1×), deoxyribozyme binding arm (20 nM), deoxyribozyme substrate (20 nM), deoxyribozyme protection chain (20 nM), water, Ampligase ligase (0.2 U / μL), and BSA (0.2 mg / mL) were reacted at 50°C for 10 minutes.

[0111] ②RCA reaction: Mix the nanomachine, polymerase buffer (1×), bovine serum albumin (0.2 mg / mL), deoxynucleotide dNTP (0.33 mM), water, phi29 DNA polymerase (0.17 U / μL), T4 PNK (0.33 U / μL), and MgSO4 (5 mM) and react at 37°C for 2 h.

[0112] Electrophoresis verification: Add 2 g agarose and 80 mL TBE (1×) to prepare 2.5% agarose gel. Take 15 μL of the sample to be analyzed and mix it with 0.1 μL SYBR Gold and 3 μL loading buffer (6×).

[0113] Gel electrophoresis was performed at room temperature (100 V, 45 minutes) and images were taken. Figure 4 shown.

[0114] In the results, Lane M is the marker, Lane 1 is the product of the RCA reaction of the nanomachine of Comparative Example 1 at 20 nM, and Lane 2 is the product of the RCA reaction of the nanomachine of Comparative Example 1 at 200 pM. It can be seen that RCA products are generated in Lanes 1 and 2 even when the NickRCA product is not added. This indicates that the nanomachine constructed in Comparative Example 1 can also amplify without the NickRCA reaction, which would bring a serious risk of false positives. Therefore, compared with Example 1, the binding arm sequence of Comparative Example 1 is not feasible.

[0115] Comparative Example 2

[0116] Electrophoresis verification of the effect of DNAzyme substrate chain design method on amplification reaction

[0117] Comparative Example 2 differs from Example 1 in that the DNAzyme substrate chain is designed differently. The nucleic acid sequence involved in Comparative Example 2 was independently designed and synthesized by Shanghai Bioengineering. The sequence of the DNAzyme substrate chain is shown in SEQ ID NO. 52. The experimental procedures differ only in that a different DNAzyme substrate chain was used in the nanomachine construction process; otherwise, the experimental procedures were the same as in Example 1.

[0118] Gel electrophoresis was performed at room temperature (100 V, 45 minutes), and no RCA product was generated in the corresponding lanes. The results indicate that the nanomachine constructed with the substrate chain of Comparative Example 2 was unable to function. Compared to Example 1, the DNA enzyme substrate chain sequence of Comparative Example 2 is not feasible.

[0119] Comparative Example 3

[0120] Electrophoresis verification of the impact of protection chain design methods on amplification reactions

[0121] The difference between Comparative Example 3 and Example 1 is that the design of the deoxyribozyme protection chain is cancelled in the nanomachine. The nucleic acid sequence involved in Comparative Example 3 is independently designed and synthesized by Shanghai Bioengineering. The sequences involved are shown in Table 3. The experimental steps are the only step in not using the deoxyribozyme protection chain during the construction of the nanomachine, that is, the nanomachine is constructed by mixing the deoxyribozyme binding arm (0.1 μM) and the deoxyribozyme substrate (0.1 μM) in TE buffer at 95°C, starting from 95°C, and gradually cooling to 50°C at a rate of 2°C / min. Then, DNA ligase buffer (1×), deoxyribozyme binding arm (20nM), deoxyribozyme substrate (20nM), water, Ampligase ligase (0.2U / μL), and BSA (0.2mg / mL) are reacted at 50°C for 10 minutes to obtain the nanomachine. Others are the same as in Example 1. The experimental steps are the same as Comparative Example 1.

[0122] Gel electrophoresis at room temperature (100 V, 45 minutes) revealed that RCA products were generated in the corresponding lanes even when the NickRCA product was not added. This indicates that the nanomachine constructed in Comparative Example 3 can amplify even without the NickRCA reaction, which carries a serious risk of false positives. Compared to Example 1, the design of Comparative Example 3 is not feasible.

[0123] It should be noted that the above embodiments are merely examples for the purpose of clearly illustrating the present invention and are not intended to limit the embodiments of the present invention. A person skilled in the art would be able to make other variations or modifications based on the above description. It is not possible to enumerate all embodiments here. Any obvious variations or modifications arising from the technical solution of the present invention remain within the scope of protection of the present invention.

Claims

1. A DNAzyme binding arm, characterized in that The invention relates to a cyclic structure comprising a deoxyribozyme catalytic core A sequence, a monomer amplicon recognition region, a sequence of a fragment comprising a detection probe, and a deoxyribozyme substrate recognition region; wherein the deoxyribozyme catalytic core partial sequence comprises a partial sequence of any one of the deoxyribozymes 8-17, E6, or 10-23; the deoxyribozyme catalytic core A sequence has a base length of 8-12; and the number of bases in the monomer amplicon recognition region is greater than 13; The deoxyribozyme substrate recognition region includes a 5'-end recognition region and a 3'-end recognition region, which are respectively located at the two ends of the deoxyribozyme binding arm; the sequence of the 5'-end recognition region is any one of the following sequences: CCGTACACGATCCC (SEQ ID NO. 1), ATGCGATCGATAGC (SEQ ID NO. 2), TACGCTAGCTAGCT (SEQ ID NO. 3), GATTACAAGCTTCG (SEQ ID NO. 4); The sequence of the 3' end recognition region is any one of the following sequences: GAATGAGCCTGGAAGCC (SEQ ID NO. 5), TACGTAGCTAGCTAACGT (SEQ ID NO. 6), GCTAGCTACGTAGCTAGC (SEQ ID NO. 7), and ATCGATCGTAGCTAGCTA (SEQ ID NO. 8).

2. The DNAzyme binding arm according to claim 1, characterized in that The catalytic core A sequence of the deoxyribozyme is any one of the following sequences: SEQ ID NO.1: CGGTCGAA (SEQ ID NO.9); SEQ ID NO.2: GCGATCCGGA (SEQ ID NO.10); SEQ ID NO.3: AGGCTAGCT (SEQ ID NO.11); The sequence of the monomer amplicon recognition region in the deoxyribozyme binding arm is any one of the following sequences: AAACAGAGTTAAGAGAAG (SEQ ID NO. 12), TCGATAGCTACGTAGC (SEQ ID NO. 13), AAGCTTCGATAGCTAC (SEQ ID NO. 14), GTACGTAGCTAGCTACG (SEQ ID NO. 15); The sequence of the detection probe fragment is any one of the following sequences: ATAATTTATACGTAGTACA (SEQ ID NO. 16), GCTAGCTACGTAGCTAGCT (SEQ ID NO. 17), TACGATCGATAGCTACGAT (SEQ ID NO. 18), AGCTAGCTAGCTAGCATCG (SEQ ID NO. 19).

3. The DNAzyme binding arm according to claim 1, characterized in that The sequence of the DNAzyme binding arm is shown in SEQ ID NO.

42.

4. A nanomachine, characterized in that: The method comprises the DNA enzyme binding arm according to any one of claims 1 to 3.

5. The nanomachine according to claim 4, characterized in that The nanomachine comprises three single chains, namely a deoxyribozyme binding arm, a deoxyribozyme substrate and a deoxyribozyme protection chain. The deoxyribozyme substrate comprises a deoxyribozyme catalytic core B sequence, a primer region specifically paired with the deoxyribozyme binding arm, a monomer amplicon recognition region, and a deoxyribozyme protection chain recognition region; the deoxyribozyme protection chain comprises a recognition region specifically paired with the deoxyribozyme substrate; The catalytic core B sequence of the deoxyribozyme and the catalytic core A sequence of the deoxyribozyme are combined to obtain the catalytic ring center of the deoxyribozyme.

6. The nanomachine according to claim 5, characterized in that In the deoxyribozyme substrate, the sequence of the primer region specifically paired with the deoxyribozyme binding arm is any one of the following sequences: GGGATCGTGTACGGGGCTTCCAGGCTCATTC (SEQ ID NO.23), GCTATCGATCGCATACGTTAGCTAGCTACGTA (SEQ ID NO.24), AGCTAGCTAGCGTAGCTACGTAGCTAGC (SEQ ID NO.25), CGAAGCTTGTAATCTAGCTAGCTACGATCGAT (SEQ ID NO.26); the sequence of the monomer amplicon recognition region is any one of the following sequences: AAGCCGGGC (SEQ ID NO.27), CGATAGGCT (SEQ ID NO.28), TTACGCGCT (SEQ ID NO.29), GCGATAGGT (SEQ ID NO.30); the sequence of the deoxyribozyme protection chain recognition region is any one of the following sequences: CATGTGTTGGATGTTGTGG (SEQ ID NO.31), TAGCTAGCTACGTAGCTAGC (SEQ ID NO.32). NO.32), GATCGTAGCTATCGATCGTA (SEQ ID NO.33), TCGATGCTAGCTAGCTAGCT (SEQ ID NO.34); preferably, the sequence of the deoxyribozyme protection chain is any one of the following sequences: CCACAACATCCAACACATG (SEQ ID NO.35), GCTAGCTACGTAGCTAGCTA (SEQ ID NO.36), TACGATCGATAGCTACGATC (SEQID NO.37), AGCTAGCTAGCTAGCATCGA (SEQ ID NO.38).

7. A kit, characterized in that The invention comprises reaction solution a, reaction solution b and reaction solution c; wherein the reaction solution a comprises a padlock probe, a primer, a DNA ligase, a target to be detected and a ligase buffer; the reaction solution b comprises a ligase buffer, a deoxyribozyme binding arm, a deoxyribozyme substrate, a deoxyribozyme protection chain and an Ampligase ligase; the reaction solution c comprises a ligase reaction product, a nanomachine, a polymerase buffer, bovine serum albumin, deoxynucleotide dNTP, T4 PNK, DNA polymerase, restriction endonuclease, restriction oligonucleotide, magnetic nanoparticle-labeled detection probe and metal ion solution; design a padlock probe according to the target to be detected, and design primers accordingly; the padlock probe has a phosphorylated 5' end, and is provided with a primer recognition region and an endonuclease recognition region, and has target gene recognition regions complementary to the target sequence to be detected at both ends, and the endonuclease cleavage site of the endonuclease recognition region is methylated; the deoxyribozyme protection chain has the same sequence as a portion of the padlock probe region and has a chemically blocked 3' end; the deoxyribozyme binding arm is the deoxyribozyme binding arm described in any one of claims 1-3; and the nanomachine is the nanomachine described in any one of claims 4-6.

8. A biosensor, characterized in that: Comprising the kit according to claim 7.

9. A biosensor for detecting Mycobacterium tuberculosis, characterized in that: The kit according to claim 7 is included, and the sequence of the target gene is shown as SEQ ID NO.

40.

10. A nucleic acid detection method, characterized in that: The following steps are involved: S1. Design a padlock probe according to the target gene sequence to be measured, and design primers accordingly; wherein the padlock probe has a phosphorylated 5' end and is provided with a target gene recognition region, a primer recognition region, and an endonuclease recognition region, the target gene recognition region being located at both ends of the padlock probe and complementary to the target gene sequence to be measured, and the endonuclease cleavage site of the endonuclease recognition region is methylated; S2, mixing the target with the padlock probe, primers, and DNA ligase to perform a ligase reaction to obtain a ligase reaction product; S3, connecting the DNAzyme binding arm, the DNAzyme substrate, and the DNAzyme protection chain into a nanomachine under the action of DNA ligase; S4, mixing the ligase reaction product, the nanomachine, the polymerase, the detection probe labeled with magnetic nanoparticles, the metal ion solution, the endonuclease, T4 PNK, and the polymerase buffer to perform a NickRCA-DNAzyme-cRCA reaction to obtain a final reaction system; S5. Using a sensor to detect the final reaction system, qualitative analysis and / or quantitative analysis of the target gene to be detected is achieved.

Images