Cotton fiber length gene GhCRK26 and molecular marker and application thereof

Abstract

The invention belongs to the field of molecular breeding, and particularly discloses a cotton fiber length gene GhCRK26 and a molecular marker and application thereof, the nucleotide sequence of the GhCRK26 in a tetraploid upland cotton line 9 is shown as SEQ ID NO: 7, and the amino acid sequence is shown as SEQ ID NO: 8; according to the invention, the SNP locus A0958778018, which is remarkably related to the fiber length, in the GHA09G0882 gene is identified through BSA-seq correlation analysis based on the fiber length of a sea-land backcross population; the SNP locus is located at the 1931bp position of a gene CDS region, and allele variation (C / T) of the SNP locus is closely associated with the fiber length character; a specific KASP-SNP molecular marker is developed on the basis of the key site and has the advantages of rapidness and high efficiency in detection; and a powerful technical support is provided for molecular breeding of cotton fiber length characters.

Description

Technical Field

[0001] The present invention belongs to the field of molecular breeding, and in particular relates to a cotton fiber length gene GhCRK26 and a molecular marker and application thereof. Background Art

[0002] The CRK (Cysteine-rich receptor-like kinase) gene family, a family of plant-specific receptor-like protein kinases, plays a key role in plant growth and development, hormone signaling, and abiotic stress responses. Numerous reverse genetics studies have revealed the regulatory functions of different CRK members in plant growth and stress tolerance. For example, in Arabidopsis thaliana, CRK2, CRK5, and CRK36 influence plant phenotype by mediating callose deposition, thereby participating in processes such as seed germination, seedling growth, rosette leaf morphogenesis, and root development. Furthermore, CRK45 not only participates in the ABA signaling pathway and regulates responses to osmotic and salt stresses, but also influences bolting timing and early seedling development. Studies have shown that the transcript levels of CRK genes in Arabidopsis thaliana, wheat, and pepper are significantly regulated by exogenous salicylic acid (SA), methyl jasmonate (MeJA), ethylene, and abscisic acid (ABA). In addition to the model plant Arabidopsis thaliana, the functions of CRKs have been extensively studied in a variety of important crop plants. For example, wheat TaCRK3 significantly enhances resistance to Rhizoctonia graminearum by directly inhibiting fungal growth and activating defense genes in the ethylene signaling pathway. Maize ZmCRK27 may be involved in responses to ABA and salt stress. Members of the rice OsCRK gene cluster play diverse roles in drought resistance, low-temperature tolerance, high-temperature tolerance, and resistance to bacterial blight, with OsCRK26 shown to enhance drought resistance in rice. Currently, research on CRK genes in cotton primarily focuses on disease resistance. For example, GhCRK25 and GbCRK18 have been reported to be associated with resistance to Verticillium wilt. However, the role of CRKs in cotton fiber development remains unclear and warrants further investigation. Notably, receptor-like protein kinases of the CrRLK1L subfamily have been shown to be involved in regulating fiber development, providing important clues for understanding the function of GhCRK genes in cotton fiber development.

[0003] As one of the world's most important cash crops, cotton is not only a strategic resource crucial to national economy and people's livelihoods, but also plays a crucial role in global economic development. The quality of its fiber directly determines the production efficiency and added value of textile products. Fiber length, a key indicator of fiber quality, has a decisive impact on various textile properties. With technological advancements in the textile industry and the growing market demand for high-quality cotton fiber, genetic improvement of fiber length has become a key goal in cotton breeding. However, cotton fiber quality is a complex quantitative trait characterized by polygenic control and susceptibility to environmental influences. This results in significant phenotypic differences between identical genotypes under different environmental conditions, posing significant challenges for genotype-phenotype association analysis. While traditional breeding methods have achieved some success in improving fiber quality through phenotypic selection, they suffer from inherent drawbacks such as long breeding cycles, low selection efficiency, and significant environmental interference. Against this backdrop, marker-assisted selection (MAS) technology has emerged, providing a breakthrough solution for precise genotype selection and efficient breeding of high-quality varieties.

[0004] With the rapid development of modern biotechnology, breeders have integrated bioinformatics and genetic engineering techniques to conduct in-depth research on the association mechanism between gene polymorphism mutations and phenotypic variation. Based on this, they have developed efficient molecular markers, promoted the innovation of molecular marker-assisted selection breeding technology, and significantly improved breeding efficiency. Molecular marker technology has undergone a technological evolution from restriction fragment length polymorphism (RFLP), simple sequence repeats (SSR), to single nucleotide polymorphism (SNP), achieving a major breakthrough from low-throughput to high-throughput and high-precision. Among them, competitive allele-specific PCR (KASP) technology, with its advantages of high cost-effectiveness, flexible operation, and strong compatibility, has demonstrated its wide application value in genotyping and marker-assisted breeding of various crops such as rice, wheat, maize, pepper, and cotton. Therefore, in-depth research on cotton fiber length-related genes and their molecular markers has important theoretical and practical significance for breaking the current bottleneck of cotton yield and quality. Summary of the Invention

[0005] The purpose of the present invention is to provide a cotton fiber length gene GhCRK26 and its molecular marker and application, so as to solve the problems raised in the above background technology.

[0006] To achieve the above object, the present invention provides the following technical solutions:

[0007] In a first aspect, the present invention provides a cotton fiber length gene GhCRK26, wherein the 9-nucleotide sequence of GhCRK26 in tetraploid upland cotton is shown as SEQ ID NO: 7, and the amino acid sequence is shown as SEQ ID NO: 8.

[0008] Preferably, the physical position of the SNP site of GhCRK26 in the cotton reference genome TM-1_ZJU_V2.1 is A09_58778018, the nucleotide at the SNP site is a C / T mutation, and the mutation site is located at 1931 bp in the CDS region.

[0009] In a second aspect, the present invention provides a molecular marker for the cotton fiber length gene GhCRK26, wherein the molecular marker contains a nucleotide sequence 100 bp upstream and downstream of the extracted variation site as shown in SEQ ID NO: 1, and the primer pair sequence for amplifying the molecular marker is shown in SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4.

[0010] In a third aspect, a kit for identifying or assisting in identifying the fiber length of cotton varieties comprises the primer pairs shown in SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4, and a KASP detection PCR amplification system and an amplification program.

[0011] In a fourth aspect, the present invention provides any of the following applications of a cotton fiber length gene GhCRK26 or a molecular marker of the cotton fiber length gene GhCRK26 or a kit for identifying or assisting in identifying the fiber length of cotton varieties, including applications in identifying or assisting in identifying the fiber length of cotton varieties in parental material lines 9 and Xinhai 16, fiber extreme materials of sea-land backcross populations, upland cotton resource materials, and sea island cotton resource materials.

[0012] In a fifth aspect, the present invention provides a cotton breeding method, which utilizes the above-mentioned molecular markers to detect cotton samples, selects different populations for breeding, and screens germplasm resources with long fiber traits.

[0013] In a sixth aspect, the present invention provides an expression difference analysis of the cotton fiber length gene GhCRK26 at different stages of fiber development, including the above-mentioned cotton fiber length gene GhCRK26, wherein the primer pair sequence is shown in SEQ ID NO: 5 and SEQ ID NO: 6.

[0014] Compared with the prior art, the present invention has the following beneficial effects:

[0015] The present invention successfully identified a SNP site A09_58778018 in the GH_A09G0882 gene that is significantly associated with fiber length through BSA-seq association analysis of fiber length in a marine-terrestrial backcross population. This SNP site is located at the 1931bp position in the CDS region of the gene, and its allele variation (C / T) is closely associated with the fiber length trait: when the site is a C base, it exhibits a long fiber trait; when it is a T base, it exhibits a short fiber trait. Based on this key site, a specific KASP-SNP molecular marker was developed, which has the advantages of rapid and efficient detection. In addition, the present invention also analyzed the expression pattern of this gene at different stages of fiber development through qRT-PCR technology and successfully cloned the gene, laying an important foundation for in-depth analysis of its molecular mechanism. The development of this molecular marker provides strong technical support for molecular breeding of cotton fiber length traits and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for describing the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. Those skilled in the art can also derive other drawings based on these drawings without inventive effort. Among them:

[0017] Figure 1 This is a schematic diagram of the typing results of GhCRK26-1931SNP in 512 materials of the present invention; in the figure, A is the typing results of parental line 9 and Xinhai 16; B is the typing results of fiber extreme materials of the sea-land backcross population; C is the typing results of upland cotton resource materials; D is the typing results of sea island cotton resource materials.

[0018] Figure 2 This is a schematic diagram of the fiber length clustering diagram of 512 materials of the present invention; in the figure, A represents the fiber length extreme material clustering diagram of the land-sea backcross population; B represents the fiber length clustering diagram of the upland cotton resource material; C represents the fiber length clustering diagram of the sea island cotton resource material.

[0019] Figure 3 Schematic diagram of the significance analysis between genotype and fiber length of the present invention; in the figure, *: P < 0.05, **: P < 0.01; A is the significant result typing of the extreme fiber materials of the land-sea backcross population; B is the significant result typing of the upland cotton resource material; C is the significant result typing of the sea island cotton resource material.

[0020] Figure 4 Schematic diagram of the expression level of GhCRK26 in the parent of the present invention; **: P < 0.01, ***: P < 0.001.

[0021] Figure 5Schematic diagram of the expression of GhCRK26 in the root, stem and leaf tissues of Xi9 and Xinhai16; in the figure, *: P < 0.05, **: P < 0.01, t test.

[0022] Figure 6 Schematic diagram of the GhCRK26 gene cloning of the present invention; M in the figure is DL2000 marker; 1 is the PCR amplified fragment of the GhCRK26 gene.

[0023] Figure 7 Schematic diagram of the alignment of GhCRK26 protein sequences from different species of the present invention Figure 1 .

[0024] Figure 8 Schematic diagram of the evolutionary tree of GhCRK26 protein sequences from different species according to the present invention.

[0025] Figure 9 Schematic diagram of the protein characteristics encoded by the GhCRK26 gene of the present invention; A in the figure is the predicted amino acid affinity and hydrophobicity of the GhCRK26 encoded protein; B is the predicted transmembrane region of the GhCRK26 encoded protein.

[0026] Figure 10 Schematic diagram of signal peptide prediction and phosphorylation site prediction of the protein encoded by the GhCRK26 gene of the present invention; Figure A is the phosphorylation site prediction of the protein encoded by the GhCRK26 gene; Figure B is the signal peptide prediction of the protein encoded by the GhCRK26 gene.

[0027] Figure 11 Schematic diagram of the secondary and tertiary structures of the protein encoded by the GhCRK26 gene of the present invention; A in the figure is the secondary structure of GhCRK26; B is the tertiary structure of GhCRK26; blue: α-helix structure; purple: extended chain structure; green: β-pleated sheet structure; orange: random coil structure.

[0028] Figure 12 Schematic diagram of the conserved domain analysis of GhCRK26 of the present invention.

[0029] Figure 13 Schematic diagram of the analysis of cis-acting elements of the GhCRK26 promoter of the present invention.

[0030] Figure 14Schematic diagram of PCR electrophoresis detection of the PHG::GhCRK26 gene in bacterial solution of the present invention; Figure A is PCR detection of PHG::GhCRK26 bacterial solution cloning primers, where M is DL2000 marker and 1 is the PCR result of PHG::GhCRK26 bacterial solution; Figure B is PCR detection of PHG::GhCRK26 bacterial solution specific primers, where M is DL2000 marker and 1 is the PCR result of PHG::GhCRK26 bacterial solution.

[0031] Figure 15 Schematic diagram of the subcellular localization of the PHG::GhCRK26 fusion protein of the present invention; the first row of the figure shows tobacco mesophyll cells transformed with an empty GFP vector, and the second row shows tobacco mesophyll cells transformed with a fusion vector; GFP represents the fluorescence field, Bright field represents the bright field, and Merge represents the fusion field of fluorescence and bright field.

[0032] Figure 16 Schematic diagram of the alignment of GhCRK26 protein sequences from different species of the present invention Figure 2 .

[0033] Figure 17 Schematic diagram of the alignment of GhCRK26 protein sequences from different species of the present invention Figure 3 .

[0034] Figure 18 Schematic diagram of the alignment of GhCRK26 protein sequences from different species of the present invention Figure 4 . DETAILED DESCRIPTION

[0035] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific embodiments of the present invention are described in detail below with reference to the accompanying drawings.

[0036] In the following description, many specific details are set forth to facilitate a full understanding of the present invention. However, the present invention may also be implemented in other ways different from those described herein. Those skilled in the art may make similar generalizations without violating the connotation of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0037] Secondly, the term "one embodiment" or "embodiment" herein refers to a specific feature, structure, or characteristic that may be included in at least one implementation of the present invention. The phrase "in one embodiment" appearing in various places throughout this specification does not necessarily refer to the same embodiment, nor does it refer to a separate or selective embodiment that is mutually exclusive of other embodiments.

[0038] As attached Figure 1 To the attached Figure 15 As shown:

[0039] Example 1: This example provides a cotton fiber length gene GhCRK26. The nucleotide sequence of GhCRK26 in tetraploid upland cotton is shown in SEQ ID NO: 7, and the amino acid sequence is shown in SEQ ID NO: 8.

[0040] The physical position of the SNP site of GhCRK26 in the cotton reference genome TM-1_ZJU_V2.1 is A09_58778018. The nucleotide at the SNP site is a C / T mutation, and the mutation site is located at 1931bp in the CDS region.

[0041] The molecular marker contains a nucleotide sequence 100 bp upstream and downstream of the extracted mutation site as shown in SEQ ID NO: 1, and the primer pair sequences for amplifying the molecular marker are shown in SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4.

[0042] In this example, 512 cotton varieties (lines) were selected as experimental materials, including 2 parents of the sea-land backcross population (Line 9 and Xinhai 16), 60 extreme fiber materials of the sea-land backcross population, 305 upland cotton resource materials, and 145 sea island cotton resource materials. All materials were preserved in this laboratory, and the relevant phenotypic data were identified by the research team in the early stage. Fibers of the parents were collected 0-35 days after the plants bloomed in the field, and the above samples were immediately placed in liquid nitrogen for quick freezing.

[0043] The experiment was conducted in 2023 at the experimental base in Dafeng Town, Hutubi County, Xinjiang. A randomized block design was used, with a six-row planting pattern of one film covering each material, two rows per material, 2m long, 0.1m plant spacing, 0.7m row spacing, and a 2.35m sowing width. Conventional field management was used. Young cotton leaf samples from 512 materials were collected at the bud stage and stored in centrifuge tubes containing solid silica gel.

[0044] Cotton DNA was extracted using a modified CTAB method. DNA quality and content were determined using 1% agarose gel electrophoresis and a KAIAO K5800 spectrophotometer. DNA concentration was uniformly diluted to 20 ng / μL to meet KASP typing requirements.

[0045] In the early stage, BSA resequencing was performed on Line 9 (R01), Xinhai 16 (R02), a long-fiber pool (R03), and a short-fiber pool (R05) using Line 9, Xinhai 16, and a backcross population constructed from their parents. Based on the fiber length BSA-seq candidate intervals, SnpEff software was used to extract SNP annotation information for the candidate intervals.

[0046] From the SNPs identified in the initial screening, sites with high polymorphism were selected for KASP marker development. Sequences 100 bp upstream and downstream of the target site were extracted for primer design. Three KASP primers were designed. The 3' ends of the two forward primers were aligned with the two allelic variants of the detection site, and the 5' ends contained FAM and VIC fluorescent group linker sequences, respectively. The reverse primer was a universal primer.

[0047] The experiment was performed using the LGC (Laboratory of the Government Chemist, UK) high-throughput genotyping platform. The PCR amplification reaction system and procedures are described in Tables 1 and 2. After the reaction, the endpoint fluorescence signal was read using an LGC OMEGA fluorescence detector. Genotyping was performed using Kluster Caller software (LGC). Genotyping results were visualized using a two-color fluorescence scatter plot (FAM vs. VIC).

[0048] Table 1 PCR reaction system for KASP detection

[0049]

[0050]

[0051] Table 2 KASP detection PCR amplification procedure

[0052]

[0053] Molecular marker polymorphism was verified using DNA from 62 samples of fiber extremes from the parental upland backcross population and its population. Further typing was performed in 305 upland cotton resource materials and 145 island cotton resource materials. The molecular markers were evaluated based on genotyping results from the test materials and two years of fiber length phenotypic data.

[0054] The acquired fluorescence signal values, genotyping results, and fiber length data were analyzed and collated using Microsoft Excel 2021. Scatter plots were drawn using RStudio software; descriptive statistics of the material fiber data were performed using SPSS 26.0 software; cluster heat maps of the material fiber data were drawn using TBtools software; and a two-tailed T test was performed on the fiber length data and genotypes of the test materials using GraphPad Prism 9 software. A significance analysis was performed between fiber length and the (C / T) genotype at the GhCRK26-1931 SNP.

[0055] Fluorescence quantification of GhCRK26

[0056] The fluorescence quantitative instrument was ABI7500, and the reagents for RNA extraction, cDNA synthesis, and fluorescence quantitative analysis were Tiangen DP441 Plant Total RNA Extraction Kit, FastKing cDNA First Strand Synthesis Kit, and Full-Gold qPCR SuperMix, respectively. The specific reaction system and procedures were referred to the manufacturer's instructions. UBQ7 was used as an internal reference, with three replicates, and expression was calculated using 2– ΔΔ Ct method.

[0057] The fluorescent quantitative primers are as follows:

[0058] CRK26-RT-F:TAGACTCCAGTTTGAGGGATGG

[0059] CRK26-RT-R:AAATGCAGGCTCTGAGGGTAG.

[0060] A cotton fiber length gene GhCRK26 was obtained. The 9-nucleotide sequence of GhCRK26 in tetraploid upland cotton is shown in SEQ ID NO:7.

[0061] Cloning of GhCRK26

[0062] GhCRK26 was cloned using the cDNA of the fiber of line 9 10 days after flowering as a template. The amplified products were recovered, purified and ligated, and single clones were selected for bacterial liquid PCR detection. After the positive strains were screened, they were sent to Shanghai Biotechnology for sequencing.

[0063] The cloning primers are as follows:

[0064] CRK26-KF: ATGGCAATGGATCTTTCATTGCAG

[0065] CRK26-KR:CTATCTTGGATACAGCTCGGTAATG

[0066] The amplification program was as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 54.9°C for 15 s, extension at 72°C for 2 min, 35 cycles; and final extension at 72°C for 5 min.

[0067] The obtained GhCRK26 amino acid sequence is shown in SEQ ID NO:8.

[0068] Bioinformatics analysis of GhCRK26

[0069] The websites and software used for bioinformatics analysis are listed in Table 3.

[0070] Table 3 Bioinformatics prediction websites

[0071]

[0072]

[0073] Subcellular localization vector construction and transformation

[0074] Using the correctly sequenced cloned plasmid as a template, amplify it with primers containing BamH I and Pst I restriction sites and recover it on gel:

[0075] CRK26-PHG-F:ctctctctcaagcttggatccATGGCAATGGATCTTTCATTGC

[0076] CRK26-PHG-R:acgggtcatgagctcctgcagTCTTGGATACAGCTCGGTAATGG

[0077] The PHG vector was double-digested with BamH I and Pst I, followed by gel recovery. The amplified product was ligated to the PHG vector after digestion and transferred to the competent colon. The ligated product was plated and a single clone was picked. PCR verification was performed using the clone and specific primers. After sequencing was completed and confirmed successful, the corresponding plasmid was extracted and then introduced into Agrobacterium cells using the freeze-thaw method:

[0078] PHG-F:TGAAATCACCAGTCTCTCTCT

[0079] PHG-R:GCTATTGATGCAGTTGAAGC

[0080] Nicotiana benthamiana was cultivated, and one-month-old tobacco plants with good growth conditions were selected as recipient plants for transient expression analysis.

[0081] Plasmid extraction used the Tiangen Plasmid Mini Extraction Kit (DP103), gel recovery used the Tiangen DP209 ordinary agarose gel DNA recovery kit, BamH I and Pst I enzymes were purchased from NEW ENGLAND Biolabs, the seamless cloning kit used was Norwegian C112-01, the E. coli competent cell was purchased from Shanghai Bioengineering, and Agrobacterium GV3101 was purchased from Shanghai Weidi Biotechnology Co., Ltd. Primer synthesis and sequencing were completed by Shanghai Bioengineering.

[0082] Screening of polymorphic SNP sites within the interval

[0083] The resequencing data of the two parents, Xi9 (R01) and Xinhai 16 (R02), as well as the long fiber pool (R03) and the short fiber pool (R05), were annotated and analyzed. The sequencing results of the SNP sites in the parents and the pool are shown in Table 4:

[0084] Table 4 Candidate SNP site information

[0085]

[0086] The physical position of the SNP site of GhCRK26 in the cotton reference genome TM-1_ZJU_V2.1 was A09_58778018, the nucleotide at the SNP site was a C / T mutation, and the mutation site was located at 1931bp in the CDS region.

[0087] Development of GhCRK26-KASP-SNP molecular markers

[0088] The SNP site at A09_58778018 in the GH_A09G0882 gene was selected for KASP-SNP molecular marker development. The GH_A09G0882 variant is located at 1931 bp in the CDS region, so it was named GhCRK26-1931SNP. The 3' ends of GhCRK26-1931SNP-FAM and GhCRK26-1931SNP-VIC are the two allelic variants of the detection site, and the 5' ends contain FAM and VIC fluorescent linker sequences, respectively. GhCRK26-1931SNP-Reverse is a universal reverse primer, as shown in Table 5:

[0089] Table 5 GhCRK26-1931 SNP molecular marker primer sequences

[0090] Table 5 Sequence of GhCRK26-1931SNP molecular marker primers

[0091]

[0092] Note: The underlined parts are FAM and VIC fluorescent groups

[0093] Note:The underlined sections are FAM and VIC fluorophores

[0094] The molecular marker of cotton fiber length gene GhCRK26 contains a nucleotide sequence 100 bp upstream and downstream of the extracted mutation site as shown in SEQ ID NO: 1, and the primer pair sequences for amplifying the molecular marker are shown in SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4.

[0095] Example 2: Application of a molecular marker of cotton fiber length gene GhCRK26 in identifying or assisting in identifying fiber length of cotton varieties in parental material line 9 and Xinhai 16, fiber extreme materials of Hailu backcross population, upland cotton resource materials and sea island cotton resource materials.

[0096] GhCRK26-KASP-SNP marker genotyping

[0097] The genotyping results of parental material line 9 and Xinhai 16 were obtained by KASP technology. Figure 1 A): Xinhai 16 showed a predominance of FAM fluorescence signals (CC type), while Xi 9 showed a predominance of VIC fluorescence signals (TT type). This typing result was completely consistent with the previous BSA resequencing data, verifying the reliability of the marker. The GhCRK26-1931 SNP marker was further applied to three groups ( Figure 1 ), it was found that in the extreme fiber materials of the marine-terrestrial backcross population (n=60), CC type and TT type accounted for 37 and 23 respectively ( Figure 1 B); Among the upland cotton resource materials (n=305), there were 283 CC-type materials, 1 CT-type material, 20 TT-type materials, and 1 material with unknown genotype ( Figure 1 C); Among the sea island cotton resource materials (n = 145), 129 were CC type materials, 3 were TT type materials, and 13 were of unknown genotype ( Figure 1 D) These data indicate that the GhCRK26-1931 SNP locus is significantly polymorphic within the population. The KASP marker developed based on this locus can enable rapid and accurate typing of cotton germplasm resources, providing a highly efficient technical means for molecular marker-assisted breeding.

[0098] Example 3: A cotton breeding method, using the above molecular markers to detect cotton samples, selecting different populations for breeding, and screening germplasm resources with long fiber traits.

[0099] Identification of fiber length of 512 cotton varieties (lines)

[0100] The fiber length of 512 cotton varieties (lines) under two environments was statistically analyzed, as shown in Table 6:

[0101] Table 6512 analysis of fiber length variation of materials under different environments

[0102]

[0103] The results showed significant phenotypic variation in fiber length across populations, with coefficients of variation ranging from 3.48% to 9.65%, indicating rich genetic diversity among the different populations. The average fiber length of parental line 9 was 28.67 mm over two years; the average fiber length of Xinhai 16 was 34.94 mm over two years; the average fiber length of extreme materials in the Hailu backcross population had a minimum of 24.22 mm and a maximum of 32.85 mm over two years; the average fiber length of upland cotton resources was 29.62 mm over two years; and the average fiber length of sea island cotton resources was 34.10 mm over two years. These results not only confirm the genetic diversity of cotton germplasm resources but also provide an important phenotypic foundation for subsequent genetic analysis and molecular breeding of fiber length traits.

[0104] Cluster analysis based on two years of fiber length phenotypic data ( Figure 2 ), the three populations of 512 materials were divided into four groups with significant differences. Among the extreme materials of the marine-terrestrial backcross population, type I and II materials correspond to materials with extremely short fibers, and type III and IV materials correspond to materials with extremely long fibers. There are 11 materials in type I (24.22≤FL≤25.47), 19 materials in type II (25.72≤FL≤26.77), 15 materials in type III (29.68≤FL≤30.45), and 15 materials in type IV (30.75≤FL≤32.85). Figure 2 A); Among the upland cotton resources, there are 21 materials in Class I (26.36≤FL≤28.01), 224 materials in Class II (28.12≤FL≤30.41), 53 materials in Class III (30.47≤FL≤31.83), and 7 materials in Class IV (32.06≤FL≤32.76). Figure 2 B); Among the sea island cotton resources, there is 1 material in Class I (FL=24.82), 42 materials in Class II (30.03≤FL≤33.02), 88 materials in Class III (33.10≤FL≤36.39), and 14 materials in Class IV (36.68≤FL≤38.84). Figure 2 C).

[0105] Association analysis between genotype and fiber length phenotypic traits

[0106] To systematically evaluate the breeding application value of the GhCRK26-1931 SNP marker, the genotype-phenotype association of 512 cotton materials was analyzed in depth ( Figure 3 ), as shown in Table 7:

[0107] Table 7 Effect of GhCRK26-1931 SNP labeling on fiber length

[0108]

[0109] The study found that in the marine-land backcross population, upland cotton resource materials and sea island cotton resource materials, the materials carrying the CC genotype were significantly better than the materials with the TT genotype in terms of fiber length (P < 0.05), indicating that the CC genotype has a positive effect on improving fiber length. The fiber length and marker typing data of 512 materials were analyzed. The average fiber length of CC and TT genotype materials in the marine-land backcross population fiber extreme materials were 28.95mm and 27.13mm respectively ( Figure 3 A); The average fiber length of CC and TT genotype materials in upland cotton resources is 29.68 mm and 28.98 mm ( Figure 3 B); The average fiber length of CC and TT genotype materials in the sea island cotton resource materials is 34.26mm and 31.78mm ( Figure 3 C) This study, through multi-population validation, confirmed that the GhCRK26-1931 SNP marker is stably associated with cotton fiber length, providing a reliable theoretical basis for molecular marker-assisted selection.

[0110] Example 3: This example provides an analysis of the differential expression of the cotton fiber length gene GhCRK26 at different stages of fiber development.

[0111] Analysis of differential expression of GhCRK26 gene at different stages of fiber development

[0112] qRT-PCR revealed that in Xi9 and Xinhai16 ( Figure 4 ), attached Figure 4**: P < 0.01, ***: P < 0.001. The expression levels of the GhCRK26 gene were significantly different between the two accessions at 10, 20, and 30 days post-flowering (P < 0.001), with peak expression at 10 days post-flowering. GhCRK26 expression in Xinhai 16 was higher than in Line 9 on most days of development. The expression trends of GhCRK26 in Line 9 and Xinhai 16 were inconsistent. Within 20-35 days after flowering, GhCRK26 expression in Line 9 initially increased and then decreased, while in Xinhai 16 it decreased and then increased.

[0113] Analysis of differential expression of GhCRK26 gene in different tissues

[0114] The expression levels of GhCRK26 in different tissues of Xi9 and Xinhai 16 were detected by qRT-PCR. The results showed that the expression levels of GhCRK26 in the roots, stems and leaves of Xi9 were significantly different (P < 0.05), with the highest expression level in leaves. There was no significant difference in the expression levels between the stems and leaves of Xinhai 16 ( Figure 5 ), attached Figure 5 *: P < 0.05, **: P < 0.01, t test.

[0115] A cotton fiber length gene GhCRK26 was obtained, wherein the primer pair sequences are shown as SEQ ID NO: 5 and SEQ ID NO: 6.

[0116] Example 4: Experimental verification.

[0117] Cloning of the GhCRK26 gene

[0118] Using the fibrous tissue cDNA of line 9 as a template, the GhCRK26 gene was amplified by PCR, and a 2049 bp fragment was obtained ( Figure 6 ), attached Figure 6 M.DL2000 marker; 1. PCR amplified fragment of the GhCRK26 gene. The amplified product was gel-recovered and ligated with the pEASYR-T5 vector plasmid, then transformed into DH5α E. coli. After verification of the PCR product in the bacterial culture, positive strains were sent to Shanghai Bioengineering for sequencing, where the target fragment was successfully identified through alignment.

[0119] Homology analysis and phylogenetic tree construction of GhCRK26 gene

[0120] The homologous amino acid sequences of GhCRK26 gene protein with amino acid similarity of more than 70% were downloaded from NCBI. After the amino acid sequences were sorted, multiple sequence alignment and beautification were performed using CLUSTALW and ESPript3.0 respectively. Figure 7、 Figure 16 、 Figure 17 、 Figure 18 The protein has similarities of 99.56%, 99.41%, 94.74%, 94.87%, 95.21%, 77.65%, 73.52%, 73.10%, and 71.91% with those of Gossypium arboreum, Gossypium barbadense, Gossypium mustelinum, Gossypium tomentosum, Gossypium raimondii, Hibiscus syriacus, Duri o zibethinus, and Hibiscus trionum, respectively.

[0121] MEGA11 was used, Neighbor-Joining was used as the tree construction method, and Original Tree was selected to construct the phylogenetic tree. The results showed that ( Figure 8 ), the phylogenetic tree is mainly divided into three branches, and the wild watermelon seedling is more distantly related to the other two branches; upland cotton, Hawaiian cotton and island cotton are clustered on the same branch, indicating that the three are closely related.

[0122] GhCRK26 protein analysis

[0123] The predicted molecular formula of GhCRK26 protein is: C 3297 H 5193 N 927 O 1018 S 33 , encoding 682 amino acids, with a theoretical isoelectric point of 7.18 and an atomic number of 10468. Leucine (Leu) accounts for the largest proportion of the total amino acids, reaching 10.4%. The instability coefficient is 44.35, making it an unstable protein, and the fat coefficient is 83.26. The hydrophobicity value of GhCRK26 protein is the strongest at position 297, at 2.844, and the hydrophilicity value is the strongest at position 112, at -2.956. The average hydrophilicity is -0.193, which is a hydrophilic protein ( Figure 9 A). Transmembrane structure prediction shows that ( Figure 9 B) GhCRK26 protein has two transmembrane domains.

[0124] The results of GhCRK26 protein phosphorylation site prediction showed that ( Figure 10 A), the protein encoded by the GhCRK26 gene contains 54 serine (Ser) sites, 23 threonine (Thr) sites, 8 tyrosine (Tyr) sites, and a total of 85 phosphate sites. The signal peptide prediction results show that ( Figure 10B), the protein has a signal peptide structure, and the cleavage site is located between amino acids 25 and 26.

[0125] The secondary structure of the protein encoded by GhCRK26 gene was analyzed using SOPMA and SWISS-MODEL. Figure 11 A) and tertiary structure ( Figure 11 B) The results showed that the secondary structure of the protein encoded by the GhCRK26 gene was composed of three structures: α-helix, extended chain and random coil, with structural values ​​of 33.28%, 17.16% and 49.56% respectively.

[0126] The GhCRK26 domain structure was analyzed using NCBI Conserved domains ( Figure 12 ) and found that the GhCRK26 gene contains a stress-antifung domain (the conserved motif is C-X8-C-X2-C), STKc_IRAK (the catalytic domain of serine / threonine kinase, interleukin-1 receptor-associated kinase and related STK) and a Gnk2-like domain (the conserved motif is C-X8-C-X2-C).

[0127] Analysis of cis-acting elements in the GhCRK26 promoter

[0128] The promoter cis-acting element 2 kb upstream of the GhCRK26 start codon was extracted using TBtools software and analyzed using the online website Plant Care. The results showed that ( Figure 13 ), the promoter region of GhCRK26 contains different numbers and types of cis-acting elements, including those involved in low temperature response, abscisic acid response, anaerobic induction, light response, methyl jasmonate (MeJA) response, MYB binding sites, etc.

[0129] GhCRK26 subcellular localization

[0130] Construction of PHG::GhCRK26 fusion vector ( Figure 14 ), one-month-old tobacco plants were transiently transformed with Agrobacterium, and the location of eGFP fluorescence was observed under a laser confocal microscope, using tobacco plants transformed with empty PHG as a control. The results showed that the fluorescence signal in plants injected with empty GFP was localized to the nucleus and cell membrane, while the fluorescence signal in plants injected with the PHG::GhCRK26 fusion vector was localized to the cell membrane, indicating that PHG::GhCRK26 is a membrane-localized protein ( Figure 15 ).

[0131] Additionally, in order to provide a concise description of exemplary embodiments, all features of an actual embodiment (i.e., those features that are not relevant to the best mode presently contemplated for carrying out the invention or those that are not relevant to implementing the invention) may not be described.

[0132] It will be appreciated that in the development of any actual embodiment, as in any engineering or design project, numerous implementation-specific decisions may be made. Such a development effort may be complex and time-consuming, but will, for those of ordinary skill having the benefit of this disclosure, be a routine undertaking of design, fabrication, and production without undue experimentation.

[0133] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present invention, which should all be included in the scope of the claims of the present invention.

Claims

1. A cotton fiber length gene GhCRK26, characterized in that: The nucleotide sequence of GhCRK26 in tetraploid upland cotton is shown in SEQ ID NO: 7, and the amino acid sequence is shown in SEQ ID NO:

8.

2. The cotton fiber length gene GhCRK26 according to claim 1, characterized in that: The physical position of the SNP site of GhCRK26 in the cotton reference genome TM-1_ZJU_V2.1 is A09_58778018, the nucleotide at the SNP site is a C / T mutation, and the mutation site is located at 1931 bp in the CDS region.

3. A molecular marker for the cotton fiber length gene GhCRK26 according to any one of claims 1-2, characterized in that: The molecular marker contains a nucleotide sequence 100 bp upstream and downstream of the extracted variation site as shown in SEQ ID NO: 1, and the primer pair sequences for amplifying the molecular marker are shown in SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO:

4.

4. A kit for identifying or assisting in identifying the fiber length of cotton varieties, characterized by: The kit contains the primer pairs shown in SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4, as well as a KASP detection PCR amplification system and an amplification program.

5. Any of the following uses of the cotton fiber length gene GhCRK26 according to any one of claims 1 to 2, the molecular marker of the cotton fiber length gene GhCRK26 according to claim 3, or the kit for identifying or assisting in identifying the fiber length of cotton varieties according to claim 4, characterized in that: It includes the application of identifying or assisting in identifying the fiber length of cotton varieties in parental material lines 9 and Xinhai 16, fiber extreme materials of sea-land backcross populations, upland cotton resource materials, and sea island cotton resource materials.

6. A cotton breeding method, characterized in that: The molecular markers described in claim 3 are used to detect cotton samples, select different populations for breeding, and screen germplasm resources with long fiber traits.

7. An analysis of differential expression of the cotton fiber length gene GhCRK26 at different stages of fiber development, characterized by: The invention comprises a cotton fiber length gene GhCRK26 according to any one of claims 1 to 2, wherein the primer pair sequences are shown as SEQ ID NO: 5 and SEQ ID NO: 6.

Images