Gene mutant related to epilepsy and application

Abstract

The invention belongs to the technical field of biology, and particularly relates to an epilepsy-related gene mutant and application thereof. The invention provides a CHD2 gene mutant related to epilepsy, and compared with a wild type CHD2 gene, the CHD2 gene mutant has c.2956del mutation; and the login number of the wild type CHD2 gene is NM001271.4. The invention also discloses a method for preparing the wild type CHD2 gene. The invention provides a new mutant gene for the existing gene field, and further researches the application of the mutant gene. The relationship between mutation and epilepsy is determined, a new scheme is provided for diagnosis and treatment of epilepsy, and particularly, a diagnosis and treatment means is provided for epilepsy.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to epilepsy-related gene mutants and applications. Background Art

[0002] Epilepsy is a common chronic disorder of the central nervous system. It has multiple causes, including genetic factors. Genetic epilepsy refers to seizures that are directly caused by genetic defects and are the core symptom of the disease. It has a broad phenotypic spectrum and high genetic heterogeneity in the causative genes. With the advancement of gene sequencing technology, an increasing number of causative genes have been cloned. Existing research results indicate that approximately 70% of epilepsy cases are closely related to genetics.

[0003] Existing genetic diagnosis relies primarily on Sanger sequencing, which examines each exon and / or intron of a gene suspected of mutation. This is a cumbersome and inefficient process. First-generation sequencing (NGS) has a low throughput, capable of sequencing only 100-1000bp of sequence at a time; third-generation sequencing (NGS) methods are expensive, time-consuming, and labor-intensive. Therefore, developing genomic technologies based on NGS to identify effective mutation sites for epilepsy research and to apply them to clinical diagnosis holds broad promise. Summary of the Invention

[0004] In order to overcome the above-mentioned shortcomings and deficiencies of the prior art, the primary purpose of the present invention is to provide a gene mutant related to epilepsy, specifically a mutation in the CHD2 gene.

[0005] This application uses high-throughput whole-exome sequencing combined with Sanger validation of candidate mutation sites to conduct in-depth research on epilepsy patients and has discovered a new mutation type in the CHD2 gene on chromosome 15. The candidate gene locus information is: CHD2, chromosome location chr15:93524121, transcript NM_001271.4, exon Exon 23, nucleotide and protein c.2956del:p.E986Rfs*10. This is abbreviated as CHD2:NM_001271.4:Exon23 / 39(CDS):c.2956del:p.E986Rfs*10.

[0006] Another object of the present invention is to provide an application of the above-mentioned epilepsy-related gene mutation.

[0007] The purpose of the present invention is achieved through the following solutions:

[0008] The present invention provides an epilepsy-related CHD2 gene mutant. Compared with the wild-type CHD2 gene, the CHD2 gene mutant has a c.2956del mutation; the accession number of the wild-type CHD2 gene is NM_001271.4.

[0009] Furthermore, the present invention provides a nucleic acid encoding a CHD2 gene mutant for screening or diagnosing epilepsy, wherein the nucleic acid sequence thereof has a c.2956del mutation compared with the wild-type CHD2 gene; the accession number of the wild-type CHD2 gene is NM_001271.4.

[0010] Furthermore, the type of nucleic acid includes DNA, RNA or cDNA. The type of nucleic acid is not specifically limited. As long as it has a specific mutation compared with the wild-type CHD2 gene, it should be identified as a nucleic acid within this scope.

[0011] The present invention also provides an epilepsy-associated CHD2 gene mutant protein, which has a p.E986Rfs*10 mutation. That is, compared to the protein encoded by the wild-type CHD2 gene, the CHD2 gene mutant protein has a mutation from glutamic acid (Glu) to arginine (Arg) at position 986, resulting in a stop codon at the subsequent amino acid position 9, and its length is shortened from 1828 amino acids to 994 amino acids.

[0012] The present invention also provides a reagent for detecting the CHD2 gene mutant or the pathogenic gene described in the above technical solution, wherein the reagent at least comprises a primer pair having the nucleotide sequence shown in SEQ ID NO: 1-2.

[0013] The present invention also provides the use of the CHD2 gene mutant described in the above technical solution, the nucleic acid encoding the CHD2 gene mutant, the CHD2 gene mutant protein described in the above technical solution as a target or the reagent described in the above technical solution in the preparation of a reagent or kit for diagnosing, assisting in the diagnosis or screening of epilepsy.

[0014] Screening for epilepsy is mainly to check the risk of disease, so as to facilitate early intervention; diagnosis is to provide auxiliary diagnosis for people who are already sick. Of course, whether or not the disease is already there is based on the actual changes in the patient's body and the corresponding standards and specifications, and is not based on people's subjective cognition.

[0015] The reagents for diagnosing, assisting in the diagnosis, or screening of epilepsy include at least one of an antibody, probe, primer, or mass spectrometry detection reagent specific for the nucleic acid. Specifically, the reagents include products that specifically detect nucleic acids, which can be at least one of the antibodies, probes, primers, and mass spectrometry detection reagents, and can also be other reagents with similar functions. Furthermore, the kit can be in the form of kits similar to existing products, and the equipment can be some sequence detection equipment. Both primers and probes can be selected from any one of these, and they can also be used in combination as needed.

[0016] More specifically, the primers at least include a primer pair having the nucleotide sequences shown in SEQ ID NOs: 1-2.

[0017] The present invention also provides a kit for screening epilepsy biological samples, comprising a reagent capable of detecting a CHD2 gene mutant; the CHD2 gene mutant has a c.2956del mutation compared to the wild-type CHD2 gene; the accession number of the wild-type CHD2 gene is NM_001271.4.

[0018] In this case, as long as the corresponding product uses a reagent capable of detecting the aforementioned CHD2 gene mutant, it should be deemed to have applied the technology of the present invention.

[0019] The reagents include nucleic acid probes or primers, and the primers include at least a primer pair having a nucleotide sequence as shown in SEQ ID NO: 1-2.

[0020] The term "test kit" should also be interpreted broadly, including some test strips, equipment, etc.

[0021] The present invention also proposes the use of a reagent for specifically altering nucleic acid in the preparation of a drug for treating epilepsy; wherein the nucleic acid has a c.2956del mutation compared to the wild-type CHD2 gene; the accession number of the wild-type CHD2 gene is NM_001271.4.

[0022] The present invention also provides a construct comprising the aforementioned CHD2 gene mutant, a nucleic acid encoding the CHD2 gene mutant, a CHD2 gene mutant protein as a target, and at least one of the reagents.

[0023] It should be noted that the nucleic acid sequence contains the c.2956del mutation compared to the wild-type CHD2 gene; the wild-type CHD2 gene accession number is NM_001271.4. The construct can also be used as a model for testing drug efficacy in pharmaceutical manufacturing. Thus, recombinant cells obtained by transforming recipient cells with the construct of the present invention can be effectively used as a model for epilepsy-related research.

[0024] For the nucleic acid described in the present invention, those skilled in the art will understand that it actually includes any one or both of the complementary double strands. For convenience, in the present invention, although only one strand is provided in most cases, the other strand complementary thereto is actually also disclosed.

[0025] The present invention also proposes an application of a biological model in drug screening, wherein the biological model carries the above-mentioned CHD2 gene mutant, nucleic acid encoding the CHD2 gene mutant, CHD2 gene mutant protein as a target and at least one of the reagents.

[0026] One form of the biological model is a cell model. One application of the cell model is to conduct large-scale drug screening. The drug can be used to act on the cell model to verify whether the drug has the effect of inhibiting the corresponding mutation, and based on this, it can be further verified whether the drug can treat the corresponding disease by inhibiting the mutation. For example, the cell model can be used to simulate the disease environment of epilepsy, and then the model can be further used to verify the effects of some drugs in vitro. In this article, the main screening factor considered is the corresponding mutation, and the specific treatment object of the drug is not specifically limited. This application method is mainly used in the process of drug research and development. Among them, the drug is a drug for treating epilepsy; the limitation is mainly caused by the aforementioned mutation. Therefore, the present biological model can be used to screen some substances with unknown effects, which facilitates further research on whether the substance has the expectation of being used to treat epilepsy.

[0027] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0028] The present invention provides a gene mutant for diagnosing epilepsy, providing a novel mutant gene for the existing gene field and further studying the applications of this mutant gene. The present invention establishes a link between the mutation and epilepsy, thereby providing a new approach to the diagnosis and treatment of epilepsy, particularly a diagnostic and therapeutic approach for epilepsy. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments. It should be understood that the following drawings only illustrate certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other relevant drawings can be obtained based on these drawings without paying any creative work.

[0030] Figure 1 To provide a pedigree chart for epilepsy patients;

[0031] Figure 2-Figure 6This is the Sanger sequencing result of the 10-base mutation site of the CHD2 gene NM_001271.4:Exon23 / 39(CDS):c.2956del:p.E986Rfs* of the family members.

[0032] Figure 7 The results of CHD2 gene conservation analysis in 8 animal species. DETAILED DESCRIPTION

[0033] The present invention will be further described in detail below with reference to the examples, but the embodiments of the present invention are not limited thereto. Unless otherwise specified, the materials involved in the following examples can be obtained from commercial channels. The methods described are conventional methods unless otherwise specified.

[0034] Example 1: Determining the causative genes and mutation sites of epilepsy

[0035] 1. Sample Collection

[0036] A three-generation family of epilepsy patients was collected, and the family diagram is as follows Figure 1 As shown in the figure, □ represents a normal male, ○ represents a normal female, ■ represents a male patient, and ● represents a female patient; I represents the first generation, II represents the second generation, and III represents the third generation; III-1 represents a third-generation family member, who was clinically diagnosed with epilepsy based on the electroencephalogram and onset symptoms; II-1 and II-2 represent second-generation family members, and I-1 and I-2 represent first-generation family members, among whom I-2 and II-1 were also clinically diagnosed with epilepsy based on the electroencephalogram and onset symptoms, and the rest of the family members are normal.

[0037] DNA extraction:

[0038] In this case, peripheral blood was collected from five members of an epilepsy family, and DNA was extracted from each of the five samples. The sample DNA was extracted using a magnetic bead-based blood DNA rapid extraction kit, and the concentration and purity of the extracted DNA were measured using NanoDrop. In terms of purity, OD 260 / OD 280 The ratio is between 1.8-2.0, OD 260 / OD 230 The ratio should be between 1.8 and 2.2. If it exceeds this range, the extracted DNA is considered to be of substandard purity and requires re-extraction or repurification. The concentration should be above 25 ng / μL, with a total volume of no less than 2000 ng, to meet the needs of subsequent research. Extracted DNA samples are routinely stored at -20°C for future use and at -80°C for long-term storage.

[0039] 2. Whole-exome library construction, capture, and sequencing

[0040] The extracted DNA was used to prepare a genomic DNA library using a gene sequencing library construction kit (random endonuclease method). Adapters (VAHTS DNA Adapters Set 8 for MG1, lot number 7E0460H4, manufacturer: Nanjing Novozymes Biotech) were then added and pre-capture LM-PCR amplification was performed. The adapter-added DNA fragment sample was then amplified using a pre-capture LM PCR system (25 μL 2× KAPA HiFi Hot Start Ready Mix, 2.5 μL 5 μM Pre LM PCR Oligos 1 and 2, and 20 μL of the adapter-added DNA fragment sample; reaction conditions were 98°C for 45 seconds, followed by 9 cycles of 98°C for 15 seconds, 60°C for 30 seconds, and 72°C for 30 seconds, followed by 72°C for 1 minute). The pre-capture LM-PCR library product was obtained after amplification. 4-12 library samples to be sequenced were mixed and hybridized using a full-exon capture probe (Naangda-IDT2.0-20357-209803-20240827.amcare). The hybridization enrichment product was used as a template for post-capture LM-PCR amplification (the reaction system included 25 μL KAPA HiFi Hot Start Ready Mix, 2.5 μL of 5 μM Post-capture LM-PCR Oligos 1 and 2, and 20 μL of magnetic bead-captured DNA sample; the reaction conditions were 98°C for 45 seconds; 98°C for 15 seconds, 60°C for 30 seconds, and 72°C for 30 seconds for a total of 14 cycles; 72°C for 1 minute). After the amplified library was tested, 2*150bp read length sequencing was performed using the MGISEQ-2000 sequencing platform to obtain raw sequencing data.

[0041] 3. Library alignment, variant detection, and annotation

[0042] After obtaining the raw sequencing data, quality control was first performed to remove adapter sequences, low-quality sequences, and N bases. The remaining sequences were aligned to the UCSC human reference genome hg19 using BWA (Burrows Wheeler Aligner). The aligned sequences were then analyzed for variant identification using GATK (Genome Analysis ToolKit). The identified variants were annotated against databases such as gnomAD, ClinVar, VarCard, HGMD, and PubMed. Sites with known alleles with a population frequency above 0.005 or annotated as benign variants were filtered out. The remaining mutations were then analyzed for the three most likely disease-associated categories: non-synonymous mutations, splice acceptor / donor site mutations, and coding region insertions and deletions.

[0043] Data analysis of the filtered variants revealed that all three patients had the mutation NM_001271.4:Exon23 / 39(CDS):c.2956del:p.E986Rfs*10 in the CHD2 gene on chromosome 15. This mutation was inherited from the phenotypically abnormal grandmother Ⅰ-2, consistent with family co-segregation.

[0044] This frameshift variant was analyzed for Very Strong Evidence of Pathogenicity (PVS1) (https: / / autopvs1.bgi.com / ). The PVS1 assessment was Very Strong, predicting the potential for premature termination of amino acids in protein synthesis. It was predicted to cause nonsense-mediated mRNA decay (NMD), and the exon in which the variant resides is present in a biologically relevant transcript. The gene's association with the disease was definitive, and the haploinsufficiency score was 3, pursuant to which the Very Strong Evidence of Pathogenicity rating was assigned.

[0045] This variant has not been reported in existing population databases or published literature. Based on its population frequency, sequence information, PVS1 algorithm prediction, and the patient's clinical symptoms, and in accordance with the American College of Medical Genetics and Genomics (ACMG) genetic variation classification criteria and guidelines, the variant classification indicated that the NM_001271.4:Exon23 / 39(CDS):c.2956del:p.E986Rfs*10 mutation in the CHD2 gene is the pathogenic mutation in this epilepsy family. This identifies a novel epilepsy-associated mutation. Sequencing results revealed that the mRNA CDS sequence of the mutant gene contains a single deletion at position c.2956 in the CHD2 gene, compared to the wild-type gene. This deletion results in a frameshift mutation, altering the wild-type Glu to Arg at position 986 in the encoded polypeptide. This frameshift also results in a premature stop codon.

[0046] Compared with the wild-type CHD2 gene, the nucleic acid of the CHD2 gene mutant provided by the present invention has a deletion of base NM_001271.4c.2956 in the CHD2 gene transcript, while the base of the wild-type CEL gene is G.

[0047] At the same time, the present invention analyzes the conservation of this site in the CHD2 gene. A gene or site is highly conserved, indicating that it varies little in different species, which generally indicates that it has an important function or plays an important role in the growth and development of an individual. Its mutation is very likely to cause individual abnormalities, and the site will not spread within the population. In this case, the CHD2 genes of 8 animals were selected for analysis, including macaques (Rhesus), mice (Mouse), dogs (Dog), elephants (Elephant), chickens (Chicken), African clawed frogs (X_tropicalis), zebrafish (Zebrafish) and humans (Human). The CHD2 amino acid sequences of these 8 animals were downloaded from the NCBI database and compared using UCSC (https: / / genome.ucsc.edu / ). The results showed that the site was glutamic acid E in all 8 animals, indicating that the site was highly conserved ( Figure 7 These data suggest that the Exon23 / 39(CDS):c.2956del:p.E986Rfs*10 mutation on the CHD2 gene transcript NM_001271.4 is likely to be the pathogenic site in epilepsy patients.

[0048] Example 2: Sanger sequencing verification

[0049] In this case, Sanger sequencing was used to verify the gene mutation. Specifically, primers were designed targeting the candidate mutation site NM_001271.4:Exon23 / 39(CDS):c.2956del:p.E986Rfs*10 in the CHD2 gene. PCR amplification, product purification, and Sanger sequencing were performed to detect the CHD2 gene in first-generation members I-1 and I-2, second-generation members II-1 and II-2, and third-generation member III-1 of the epilepsy family. Sequencing results determined whether the mutation was wild-type, and combined with the individual's disease profile, the association between the CHD2 gene transcript NM_001271.4:Exon23 / 39(CDS):c.2956del:p.E986Rfs*10 and epilepsy was confirmed.

[0050] The specific steps are as follows:

[0051] 1. DNA extraction: According to the DNA extraction method of Example 1, genomic DNA was extracted from the peripheral blood of the father (I-1) and the mother (I-2) for detection.

[0052] 2. Primer Design and PCR Reaction

[0053] With reference to the human genome sequence database hg19 / GRCh37, specific primers for exon 23 of the CHD2 gene were designed, and the amplified region length was 406 bp, as shown in the following table. The primer pairs were used to perform PCR amplification on the genomic DNA of the first-generation members I-1 and I-2, the second-generation members II-1 and II-2, and the third-generation member III-1.

[0054] Primer sequences:

[0055]

[0056] The PCR amplification system is as follows:

[0057] reagent 1X / μL 2XKA P A Taq Ready Mix PCR Kit 15.0 Primer_F (2.5 μM) 2.0 Primer_R (2.5μM) 2.0 DNA (50 ng / μL) 1.0 <![CDATA[ddH2O]]> 10.0 Total 30.0

[0058] The PCR amplification procedure is as follows:

[0059]

[0060] The sequence of the amplified product is as follows:

[0061] >chr15:93523865+93524270

[0062] GGTTACCATCACAGACTCATCctgtagatagaaaatgcgatgtttgagaaatcatttttcttgaggcagagtttatattttcagcagttaacttgacctctttctgaaggatagttattctgaagtagaacactttagaggttatttgatgtttctaacaactacattttacttccacag ctcaaatccttttaataaagaagagctgacagctattttgaaatttggagcagaggatctcttcaaagaactggaaggggaggaatcagaacctcaggtaattaacaatgagg agagggaaatttttttgagaagtatgatctgtgagagtctaacttttctgtaagaagattctgttagaggcttttgtaaagaaaaagtaatTACTTGAAGGACAGTGTGTTTT

[0063] 3. Sanger sequencing

[0064] The PCR amplification products obtained in step 2 were subjected to Sanger sequencing. The Sanger sequencing results showed that the CHD2 gene NM_001271.4c.2956del (p.E986Rfs*10) position of I-2, II-1, and III-1 all had a G base deleted (the area indicated by the arrow). Figure 4-Figure 6 , which is a mutant type. According to the sequencing results, it is judged to be a patient with genetic epilepsy, which is consistent with its clinical symptoms; the base of the CHD2 gene NM_001271.4c.2956del (p.E986Rfs*10) of I-1 and II-2 is G, such as Figure 2-Figure 3 As shown, all are wild-type and normal according to sequencing results, a result consistent with their clinical phenotype. Sanger validation results suggest that the CHD2 gene NM_001271.4 c.2956del (p.E986Rfs*10) mutation was detected in all three epilepsy patients, while the mutation was not detected in phenotypically normal individuals I-1 and II-2. This indicates that the c.2956del variant in the CHD2 gene NM_001271.4 on chromosome 15 in these patients is inherited from AD and co-segregates within this family. These data suggest that this locus is likely the pathogenic locus in this epilepsy family.

[0065] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. An epilepsy-related CHD2 gene mutant, characterized by: Compared with the wild-type CHD2 gene, the CHD2 gene mutant has a c.2956del mutation; the accession number of the wild-type CHD2 gene is NM_001271.

4.

2. An epilepsy-related CHD2 gene mutant protein, characterized in that The CHD2 gene mutant protein has a p.E986Rfs*10 mutation; compared with the protein encoded by the wild-type CHD2 gene, the 986th amino acid of the CHD2 gene mutant protein mutates from glutamic acid to arginine, causing the subsequent 9th amino acid to become a stop codon, and its length is shortened from 1828 amino acids to 994 amino acids.

3. A reagent for detecting the CHD2 gene mutant according to claim 1.

4. The reagent according to claim 3, characterized in that A primer pair having the nucleotide sequence shown in SEQ ID NO: 1-2 is included.

5. Use of the CHD2 gene mutant according to claim 1, the CHD2 gene mutant protein according to claim 2 as a target, or the reagent according to any one of claims 3 to 4 in the preparation of a reagent or kit for diagnosis, auxiliary diagnosis or screening of epilepsy.

6. The use according to claim 5, characterized in that: The reagent for diagnosing, assisting in the diagnosis or screening of epilepsy comprises at least one of an antibody, a probe, a primer and a mass spectrometry detection reagent specific for the nucleic acid; the primer comprises at least the primer pair according to claim 4.

7. A kit for screening epilepsy biological samples, characterized in that: The invention comprises a reagent capable of detecting a CHD2 gene mutant; the CHD2 gene mutant has a c.2956del mutation compared with the wild-type CHD2 gene; the accession number of the wild-type CHD2 gene is NM_001271.4; the reagent comprises a nucleic acid probe or a primer; the primer comprises at least the primer pair according to claim 4.

8. Use of a reagent for specifically altering nucleic acid in the preparation of a medicament, characterized in that: The drug is used to treat epilepsy; the nucleic acid has a c.2956del mutation compared with the wild-type CHD2 gene; the accession number of the wild-type CHD2 gene is NM_001271.

4.

9. A construct characterized in that The construct comprises the CHD2 gene mutant according to claim 1, the CHD2 gene mutant protein according to claim 2 as a target, and at least one of the reagents according to any one of claims 3-4.

10. Application of a biological model in drug screening, characterized in that The biological model carries the CHD2 gene mutant according to claim 1, the CHD2 gene mutant protein according to claim 2 as a target and at least one of the reagents according to any one of claims 3-4.

Images